Molecular markers, detection primers and applications related to the floral fragrance traits of Dianthus

Abstract

The present invention relates to the field of molecular biology and genetic breeding technology, and specifically to a molecular marker, detection primer and application related to the floral fragrance trait of the genus Dianthus. The InDel molecular marker mentioned in the present invention is located at Indel‑52 at 47,321,163 to 47,321,205bp of chromosome 14 of Chinese Dianthus, and a primer for amplifying this InDel marker has been developed. The molecular marker of the present invention can quickly and efficiently identify varieties with high, low or no β‑caryophyllene content of the floral fragrance trait of Dianthus during the seedling stage of Dianthus, with an accuracy rate of 100%. Compared with traditional breeding that requires about a year to wait for flowering, the marker is applied to auxiliary breeding with the advantages of early time, low cost, accuracy and speed.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology and genetic breeding, and in particular to a molecular marker related to the flower fragrance trait of Dianthus, a detection primer and an application thereof. Background Art

[0002] Dianthus spp. plants are colorful and have a variety of flower shapes. They are widely used in flower beds, flower borders and other landscaping, and have high garden ornamental value. As an important ornamental trait, flower fragrance is known as the "soul of flowers", which directly affects the ornamental quality of Dianthus flowers. Cultivating fragrant Dianthus varieties is one of the important breeding goals of Dianthus plants. Superbus (D.superbus) has been loved by people in recent years because of its strong fragrance, bright colors and beautiful flower shapes. It can be used as an important material for studying flower fragrance.

[0003] The breeding methods for Dianthus plants are mainly based on hybrid vigor breeding and conventional hybrid breeding. The traditional breeding method of screening based on the phenotypic traits of hybrid offspring takes 3-6 years, which seriously limits the breeding efficiency and the research and development of new varieties.

[0004] DNA molecular markers are developed after traditional phenotypic markers, cytological markers, and biochemical markers. DNA-based genetic marker technology has been widely used in variety identification, gene positioning, and strain identification due to its high accuracy and high polymorphism (Chen Xing, Gao Zihou. Research and Application of DNA Molecular Marker Technology. Molecular Plant Breeding, 2019, 17: 1970-1977). InDel refers to the difference in the insertion or deletion of DNA fragments of different lengths at the same site in the genome between the same species or closely related species (Yang Jie, He Jia, Wang Danbi, Shi En, Yang Wenyu, Geng Qifang, Wang Zhongsheng. Research and Application Progress of InDel Markers. Biodiversity, 2016, 24: 237-243). The polymorphism of InDel can be displayed by designing specific primers on both sides of the InDel site of the genome for amplification, and its essence still belongs to the length polymorphic marker. InDels have high density and wide distribution in the genome. InDel markers are highly accurate and stable, and can effectively type DNA samples. They have been widely used in genetic analysis, molecular-assisted breeding, gene fine positioning, and screening of functional genes.

[0005] Previously, there were few studies on the floral fragrance of Dianthus plants, and few reports on related molecular markers. There was no reliable method for early identification of the floral fragrance traits of Dianthus hybrid offspring. Therefore, it is necessary to further develop molecular markers linked to the floral fragrance traits of Dianthus to assist and accelerate Dianthus breeding. Summary of the invention

[0006] In order to solve the above problems, the present invention provides an InDel molecular marker related to the floral fragrance trait of the genus Dianthus. The molecular marker is a specific sequence, which is shown as SEQ ID NO.1.

[0007] Another object of the present invention is to provide the application of the above molecular markers in the breeding of floral fragrance-related traits of the genus Dianthus.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] The parent materials selected in this experiment were the fragrant Dianthus superbus '345', the fragranceless Chinese carnation (D. chinensis) 'MH', and the F2 generation segregation population obtained by '345'×'MH'. Based on the high and low content of β-caryophyllene in the F2 population, DNA of 15 individuals with the highest and lowest β-caryophyllene content in the F2 generation was extracted and mixed in equal amounts to construct two progeny mixed pools with high β-caryophyllene content (β-caryophyllene>400μg / g) (HP) and low β-caryophyllene content (β-caryophyllene<5μg / g) (LPF). After BSA analysis, InDel markers were developed within the positioning interval, and an InDel molecular marker highly associated with the β-caryophyllene floral fragrance trait of carnation was obtained, which was Indel-52. When 47,321,163~47,321,205bp of chromosome 14 of Dianthus chinensis is AAT, the content of β-caryophyllene, the floral fragrance component of Dianthus chinensis, is high (β-caryophyllene>300μg / g); when 47,321,163~47,321,205bp of chromosome 14 of Dianthus chinensis is GTACATGTAGAAGGCCACCATACAATATCAGAGAGTAAACC (shown in SEQ ID NO.1), the content of β-caryophyllene, the floral fragrance component of Dianthus chinensis, is low or absent (β-caryophyllene<10μg / g).

[0010] Therefore, the content of β-caryophyllene, a floral fragrance component in carnation, can be determined by detecting the specific sequence shown in SEQ ID NO.1.

[0011] The protection scope of the present invention includes:

[0012] An InDel molecular marker related to the floral fragrance trait of Dianthus. The molecular marker is a specific sequence, which is shown as SEQ ID NO.1.

[0013] Application of a reagent for detecting the specific sequence shown in SEQ ID NO.1 in determining the content of β-caryophyllene, a floral fragrance component in carnations.

[0014] In the above application, preferably, if the dianthus contains the specific sequence shown in SEQ ID NO.1, the β-caryophyllene in the dianthus is less than 10 μg / g.

[0015] A molecular marker primer related to the floral fragrance trait of Dianthus, the primer is:

[0016] Forward primer Indel-52 F: 5′-CTCTTAGGCACACGATTTTGTTTTG-3′

[0017] Reverse primer Indel-52 R: 5′-AAGGCATTGTGCTTGCTTACAGATA-3′

[0018] The application of the primers mentioned above in the breeding of floral fragrance-related traits of Dianthus.

[0019] In the above application, preferably, if the product fragment size amplified by the primer is 306 bp, the content of β-caryophyllene, the carnation fragrance component to be tested, is high, that is, β-caryophyllene>300 μg / g; if the product fragment size is 341 bp, the content of β-caryophyllene, the carnation fragrance component to be tested, is low or absent, that is, β-caryophyllene<10 μg / g.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] 1) The present invention provides an InDel molecular marker that can identify the high and low content of β-caryophyllene, the main floral fragrance component of dianthus, at an early stage. By using the marker primer Indel-52F / R, the high and low content of β-caryophyllene can be quickly identified in the dianthus seedling stage. Traditional breeding requires about 3-6 years to wait for flowering and screen phenotypes. In comparison, this marker has the advantages of early time, low cost, accuracy and rapidity.

[0022] 2) Compared with other identification methods such as SNP, the method of InDel molecular markers provided by the present invention for early identification of the high and low content of β-caryophyllene, the main floral fragrance component of carnation, can be detected by ordinary PCR and polyacrylamide gel electrophoresis without sequencing, and is simple, fast and low-cost.

[0023] 3) The molecular marker of the present invention was verified in 48 individual plants of dianthus, and the accuracy rate was 100%. Therefore, the molecular marker can be used to identify the content of β-caryophyllene, the main floral fragrance component of dianthus, at an early stage, and the result is reliable. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1Schematic diagram of GC-MS measurement results of β-caryophyllene content in the material '345' with high β-caryophyllene content (about 871 μg / g) and 'MH' with low β-caryophyllene content (about 5.44 μg / g) in the embodiment of the present invention.

[0025] Figure 2 This is a statistical chart of the β-caryophyllene content in the F2 generation of plants for BSA sequencing in the present invention:

[0026] Among them: a is a single plant with high β-caryophyllene content; b is a single plant with low β-caryophyllene content.

[0027] Figure 3 Schematic diagram of the preliminary positioning interval of BSA in the present invention.

[0028] Figure 4 This is the amplification diagram of InDel-52 in Dianthus chinensis in Example 2 of the present invention.

[0029] Figure 5 The amplification map of InDel-52 in Example 3 of the present invention is published in the Dianthus species. DETAILED DESCRIPTION

[0030] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. The technical solutions of the present invention, unless otherwise specified, are conventional solutions in the art, and the reagents or materials, unless otherwise specified, are all from commercial channels.

[0031] Embodiment 1:

[0032] Development of molecular markers related to floral aroma traits in Dianthus

[0033] 1. Experimental Materials

[0034] The parent materials selected in this experiment are the fragrant Dianthus superbus '345', the fragranceless Chinese Dianthus chinensis 'MH', and the F2 generation segregation population obtained by '345'×'MH'. Both parent materials are high-generation inbred lines with diploid ploidy (2n=30), and the parents have significant differences in floral fragrance traits: the female parent is '345', whose floral fragrance is of the fragrant type, and the main floral fragrance component is β-caryophyllene, which has a very high content (about 871μg / g); the male parent is 'MH', which has no floral fragrance or very light floral fragrance, and β-caryophyllene is almost absent (about 5.44μg / g). All materials were planted in the flower base of Huazhong Agricultural University in Hongshan District, Wuhan City, Hubei Province, and strict fertilizer and water management was carried out.

[0035] 2. Whole-genome resequencing using the mixed population separation method (BSA)

[0036] According to the content of β-caryophyllene in the F2 population, DNA of 15 individuals with the highest and lowest β-caryophyllene content in the F2 generation was extracted and mixed in equal amounts to construct two progeny mixed pools with high β-caryophyllene content (β-caryophyllene>400μg / g) (HP) and low β-caryophyllene content (β-caryophyllene<5μg / g) (LP). After the sample genomic DNA was qualified, the DNA was fragmented by mechanical shearing (ultrasound), and then the fragmented DNA was purified, end-repaired, 3'-end A was added and connected to the sequencing adapter, and then agarose gel electrophoresis was used for fragment size selection, and PCR amplification was performed to form a sequencing library. The constructed library was first subjected to library quality inspection, and the qualified library was sequenced using the Illumina platform with a sequencing depth of 30×. After sequencing, low-quality bases were removed to obtain high-quality data for subsequent analysis.

[0037] 3. BSA Analysis

[0038] The filtered data were aligned to the reference genome of 'MH', and 89,730 SNPs and 479,031 InDel variant sites were obtained after analysis. The sites with homozygous differences between the parents were screened, and the parent 'MH' was selected as the reference parent. The SNP-index of the marker sites between the parents in the two mixed pools was analyzed and calculated, and then △(SNP-index) was calculated. At the end of chromosome 14, △(SNP-index) exceeded 0.5 and was higher than the 95% confidence interval, indicating that it may be closely related to the β-caryophyllene trait of Dianthus, so it was determined as a candidate interval.

[0039] 4. Development of InDel markers within the localization interval

[0040] There are 8,330 InDel sites in the candidate interval, and 55 sites with InDel base differences greater than 20 bp between the two parents were randomly selected for initial screening of primers. Using the genome of the parent 'MH' as a reference, the selected sites were located on the genome, and 200 bp of base sequences upstream and downstream of the InDel site were taken to design primers on the Primer 5 software. The primer length was 19-25 bp, the annealing temperature was around 55°C, the GC content was 40%-60%, and the product length was between 250-380 bp.

[0041] The materials used for the initial screening of InDel primers were the parents 'MH' and '345', as well as the mixed pool of the F2 generation of '345'×'MH' with high β-caryophyllene content (β-caryophyllene>400μg / g) and low β-caryophyllene content (β-caryophyllene<5μg / g), and their DNA was extracted for PCR amplification. During PCR amplification, the PCR amplification system included: 0.5μL DNA template (50ng / μL), 1μL of upstream and downstream primers (10μM), 10μL 2×Taq Plus Master Mix II, 7.5μL ddH2O. The PCR reaction program was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 55℃ annealing for 20s, 72℃ extension for 30s, 32 cycles; 72℃ final extension for 10min, and storage at 4℃. The PCR amplification products were detected by 8% polyacrylamide gel electrophoresis, and primers for polymorphic sites with differences between high and low β-caryophyllene contents were screened. Finally, all 28 pairs of primers could amplify clear, stable and different target bands.

[0042] Embodiment 2:

[0043] Verification of InDel molecular markers related to high and low β-caryophyllene content in caryophylle:

[0044] 1. Experimental Materials

[0045] The materials used in this experiment were F2 plants of the '345'×'MH' population, including 24 plants with high β-caryophyllene content (β-caryophyllene>300μg / g) and 24 plants with low β-caryophyllene content (β-caryophyllene<10μg / g). All materials were planted in the flower base of Huazhong Agricultural University in Hongshan District, Wuhan City, Hubei Province.

[0046] 2. Experimental Methods

[0047] Extract genomic DNA from the above materials. Using genomic DNA as a template, PCR amplification was performed to verify the 28 pairs of InDel primers obtained in the initial screening. The PCR amplification system included: 0.5μL DNA template (50ng / μL), 1μL of upstream and downstream primers (10μM), 10μL 2×Taq Plus Master Mix II, and 7.5μL ddH2O. The PCR reaction procedure was: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 55℃ annealing for 30s, 72℃ extension for 30s, 32 cycles; 72℃ final extension for 10min, and storage at 4℃. The PCR amplification product was detected by 8% polyacrylamide gel electrophoresis.

[0048] 3. Experimental results

[0049] After verification, an InDel molecular marker highly associated with the β-caryophyllene floral aroma trait of Dianthus chinensis was obtained, which is Indel-52. Located at 47,321,163~47,321,205bp on chromosome 14 of Dianthus chinensis with the genome version of MH_V1, when 47,321,163~47,321,205bp on chromosome 14 of Dianthus chinensis is AAT, the corresponding β-caryophyllene content of Dianthus chinensis floral aroma component is high (β-caryophyllene>300μg / g), and when 47,321,163~47,321,205bp on chromosome 14 of Dianthus chinensis is GTACATGTAGAAGGCCACCATACAATATCAGAGAGTAAACC, the corresponding β-caryophyllene content of Dianthus chinensis floral aroma component is low or absent (β-caryophyllene<10μg / g).

[0050] Design primers for this molecular marker:

[0051] Forward primer Indel-52 F: 5′-CTCTTAGGCACACGATTTTGTTTTG-3′

[0052] Reverse primer Indel-52 R: 5′-AAGGCATTGTGCTTGCTTACAGATA-3′

[0053] When the Indel-52 F / R primers were used to test 48 plants, 24 plants with high β-caryophyllene content (β-caryophyllene>300μg / g) all amplified bands at the 306bp position, and 24 plants with low or no β-caryophyllene content (β-caryophyllene<10μg / g) all had a 341bp product fragment after amplification. The β-caryophyllene content of heterozygotes ranged from 10 to 300μg / g.

[0054] In summary, the accuracy of Indel-52 F / R primers in identifying high (β-caryophyllene>300 μg / g), low or no (β-caryophyllene<10 μg / g) β-caryophyllene content in 48 caryophyllene plants was 100%, which was a high accuracy rate.

[0055] Embodiment 3:

[0056] Application of InDel molecular markers related to high and low β-caryophyllene content in caryophylle:

[0057] 1. Experimental Materials

[0058] The materials used in this experiment were 11 publicly published varieties of dianthus and superbus. All materials were purchased online from a certain treasure platform and planted in the flower base of Huazhong Agricultural University in Hongshan District, Wuhan City, Hubei Province.

[0059] Table 1 Publicly published information on dianthus varieties

[0060]

[0061] 2. Experimental Methods

[0062] Extract genomic DNA from the above materials. Use genomic DNA as template and perform PCR amplification verification with Indel-52 primers. The PCR amplification system includes: 0.5μL DNA template (50ng / μL), 1μL of upstream and downstream primers (10μM), 10μL 2×TaqPlus Master Mix II, 7.5μL ddH2O. The PCR reaction program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 55℃ annealing for 30s, 72℃ extension for 30s, 32 cycles; 72℃ final extension for 10min, and storage at 4℃. The PCR amplification product was detected by 8% polyacrylamide gel electrophoresis.

[0063] 3. Experimental results

[0064] It has been verified that Indel-52 is highly associated with the floral aroma trait of β-caryophyllene in caryophylle. When using Indel-52 F / R primers to detect 11 caryophylle varieties, plants with high β-caryophyllene content (β-caryophyllene>300μg / g) in two caryophylle varieties all amplified bands at the 306bp position; plants with low or no β-caryophyllene content (β-caryophyllene<10μg / g) in seven caryophylle varieties all had a 341bp product fragment after amplification; plants with medium β-caryophyllene content (10μg / g<β-caryophyllene<300μg / g) in two caryophylle varieties had product fragments of 306bp and 341bp after amplification.

[0065] In summary, Indel-52 F / R primers identified 2 plants with high β-caryophyllene content (β-caryophyllene>300μg / g), 7 plants with low or no β-caryophyllene content (β-caryophyllene<10μg / g), and 2 plants with intermediate β-caryophyllene content (10μg / g≤β-caryophyllene≤300μg / g) among 11 publicly published dianthus plants, with an accuracy rate of 100%, which is relatively high.

[0066] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A specific sequence related to the floral fragrance trait of Dianthus, as shown in SEQ ID NO.

1.

2. Application of a reagent for detecting the specific sequence shown in SEQ ID NO.1 in determining the content of β-caryophyllene, a floral aroma component in carnations.

3. The use according to claim 2, wherein the determination method in the said use is: if the caryophylle contains the specific sequence shown in SEQ ID NO.1, then the β-caryophyllene in the caryophylle is < 10 μg / g.

4. A primer designed for an InDel molecular marker related to the floral fragrance trait of the genus Dianthus, the primer being: Forward primer Indel-52 F: 5'-CTCTTAGGCACACGATTTTGTTTTG-3' Reverse primer Indel-52 R: 5′-AAGGCATTGTGCTTGCTTACAGATA-3′.

5. Use of the reagent for detecting the specific sequence according to claim 1 or the primer according to claim 4 in breeding for floral fragrance-related traits of the genus Dianthus.

6. The use according to claim 5, when the reference is used to determine the breeding of carnation flower fragrance-related traits, if the product fragment size amplified by the primer is 306 bp, the content of β-caryophyllene, the flower fragrance component of the carnation to be tested, is high, that is, β-caryophyllene> 300 μg / g; if the product fragment size is 341 bp, the content of β-caryophyllene, the flower fragrance component of the carnation to be tested, is low or absent, that is, β-caryophyllene< 10 μg / g.

Images