A method for low temperature preservation of honey fungus strains

Abstract

The present invention relates to the field of microbial preservation, and in particular to a method for cryopreserving Armillaria strains. The method comprises the following steps: inoculating Armillaria into a culture medium for culture to obtain a culture substrate; mixing the culture substrate with a cryoprotectant, and then performing a balancing treatment to obtain a balanced product; and cryopreserving the balanced product. The method for cryopreserving Armillaria strains provided by the present invention can maintain the excellent properties of Armillaria strains and extend the storage life of strains; the method is simple to operate, time-saving and labor-saving, and has a long storage time, and the storage time is up to 120 days. It can be seen that the method can achieve the purpose of long-term preservation of Armillaria strains, and the experimental results show that the method does not cause changes in DNA sequences and genetic characteristics. And the experimental results also prove that the method can be widely applied to Armillaria from different sources.

Description

Technical Field

[0001] The invention relates to the field of microbial preservation, and in particular to a method for low-temperature preservation of Armillaria mellea strains. Background Art

[0002] Microbial strains are an important part of biological resources, and Armillaria (Fr.: Fr.) Staude is an indispensable biological resource in the production of Gastrodia elata. Armillaria is a facultative saprophytic and parasitic fungus of the genus Armillaria, belonging to the class Hymenomycetes, order Agaricales, family Tricholomataceae, phylum Basidiomycota. Some species of this genus are important pathogens that cause root rot of trees, and some species have high economic value because they can be used in the cultivation of Gastrodia elata and Polyporus umbellatus.

[0003] Southwest Hubei is one of the important production centers of Gastrodia elata planted with Armillaria mellea for many years. In the cultivation history of nearly 60 years, due to the frequent cross-regional introduction of Armillaria mellea, the quality of Armillaria mellea strains is uneven. At the same time, it is often encountered that the variation and degradation of Armillaria mellea strains and the improper use of Armillaria mellea species cause the reduction of Gastrodia elata yield or the generation of empty nests. Therefore, it is very urgent to strengthen the research of Armillaria mellea resources, and the preservation and management of strains directly affect the accuracy of experimental results. The preservation methods of most Armillaria melleas adopt the subculture method, which requires regular subculture inoculation, and not only the workload is large but also the genetic traits of strains are easily varied by repeated subculture. It can be seen from this that there is no better preservation method to keep the excellent properties of Armillaria strains so far. Therefore, it is of great significance to find a preservation method suitable for Armillaria melleas for keeping the excellent properties of Armillaria melleas and extending the storage life of strains. Summary of the invention

[0004] The purpose of the present invention is to provide a method for low temperature preservation of Armillaria melleae strains to solve the problems existing in the above prior art. The method for low temperature preservation of Armillaria melleae strains provided by the present invention can maintain the excellent characteristics of Armillaria melleae strains and extend the storage life of strains.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a method for low-temperature preservation of honey fungus species, comprising the following steps:

[0007] Inoculating honey fungus into a culture medium for culturing to obtain a culture substrate;

[0008] After mixing the culture substrate and the cryoprotectant, performing equilibrium treatment to obtain an equilibrium product;

[0009] The equilibrium product is stored at low temperature.

[0010] Preferably, the culture medium is wheat culture medium.

[0011] Preferably, the method for preparing the wheat culture medium is: after mixing wheat with water and soaking them, sterilizing the wheat seeds obtained after soaking to obtain the wheat culture medium.

[0012] Preferably, the culture temperature is 24-26°C; and the culture method is dark culture.

[0013] Preferably, the volume ratio of the culture substrate to the cryoprotectant is 6:1.8 mL.

[0014] Preferably, the cryoprotectant is 5 wt.% glycerol.

[0015] Preferably, the temperature of the equilibration treatment is 4° C. and the time is 2 days.

[0016] Preferably, the cryopreservation temperature is -80°C.

[0017] The present invention discloses the following technical effects:

[0018] The present invention provides a method for low-temperature preservation of Armillaria mellea, comprising the following steps: inoculating Armillaria mellea into a culture medium for culture to obtain a culture substrate; mixing the culture substrate with a cryoprotectant, and performing a balancing treatment to obtain a balanced product; and low-temperature preservation of the balanced product. The method for low-temperature preservation of Armillaria mellea provided by the present invention can maintain the excellent characteristics of Armillaria mellea and extend the storage life of the strain; the method is simple to operate, time-saving and labor-saving, and has a long storage time, and the storage time is up to 120 days. It can be seen that the method can achieve the purpose of long-term preservation of Armillaria mellea, and the experimental results show that the method does not cause changes in the DNA sequence and does not cause changes in genetic characteristics. And the experimental results also prove that the method can be widely applied to Armillaria mellea from different sources.

[0019] The main significant advantage of the present invention is that the strains can be stored for a long time by simply placing them in a preservation tube with a cryoprotectant, without the need for repeated subculture operations. The method can achieve the purpose of long-term preservation of Armillaria strains, will not cause damage to the strains, and is relatively reliable in application.

[0020] At the same time, the present invention uses wheat culture medium as the culture matrix before freezing, and has a high recovery rate of 99.3% for honey fungus after low-temperature storage; using 5% glycerol as a cryoprotectant, balancing in a 4°C refrigerator for 2 days has a better preservation effect in terms of germination time, growth rate, colony area and bacterial biomass of honey fungus after recovery compared to other treatments, and the method does not change the DNA sequence before and after low-temperature storage. In addition, the cryoprotectant is easy to prepare and can be used for the preservation of honey fungus species for a long time. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 It is the ungerminated Armillaria mellea in malt extract agar medium;

[0023] Figure 2 The growth characteristics of Armillaria mellea under different low temperature storage methods;

[0024] Figure 3 This is the gel electrophoresis of the PCR product of Armillaria mellea CBS M, where S1 indicates before cryopreservation, S2 indicates after cryopreservation, and M indicates maker;

[0025] Figure 4-Figure 7 This is a comparison of the CBS M sequences of Armillaria mellea before and after cryopreservation;

[0026] Figure 8-Figure 9 This is the peak diagram of the sequencing of the CBS M part of Armillaria mellea before cryopreservation;

[0027] Figure 10-11 This is the peak diagram of the sequencing of the CBS M part of Armillaria mellea after cryopreservation;

[0028] Fig.12 The difference in growth rate between biological species (A) and commercial strains (B and C) before and after cryopreservation; the asterisk (*) indicates the significant difference before and after cryopreservation (ns, no significant; *, P≤0.1; **, P≤0.01; ***, P≤0.001); C6 is C6, WF is Wufeng I;

[0029] Fig.13The difference in biomass between biological species (A) and commercial strains (B and C) before and after cryopreservation; the asterisk (*) indicates the significant difference before and after cryopreservation (ns, no significant; *, P≤0.1; **, P≤0.01; ***, P≤0.001); C6 is C6, WF is Wufeng I;

[0030] Fig.14 The difference in colony area between biological species (A) and commercial strains (B and C) before and after cryopreservation; the asterisk (*) indicates the significant difference before and after cryopreservation (ns, no significant; *, P≤0.1; **, P≤0.01; ***, P≤0.001); C6 is C6, WF is Wufeng I;

[0031] Fig.15 This is the peak diagram of CBS A sequencing of Armillaria mellea before cryopreservation

[0032] Fig.16 This is the peak diagram of the sequencing of Armillaria CBSA after low-temperature storage. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Example 1 Screening of culture medium

[0039] 1. Experimental design

[0040] In order to screen out the culture medium suitable for low-temperature preservation of Armillaria mellea, three levels of malt extract agar medium, corn medium and wheat medium were set up, and the strain CBS M was cultured in the three culture media respectively and kept in the dark at 25±1℃ for use. A 5mm puncher was used to punch holes in the agar medium respectively, and the disc was taken out from the agar medium, and the corn particles or wheat particles in the corn medium or wheat medium were taken out and placed in a low-temperature preservation tube containing 9 kinds of protective agents, and were placed in a 4℃ refrigerator for 1d, 2d or 3d, respectively, for a total of 3×3×9=81 treatments, each treatment was repeated five times (because the uppermost particles in the low-temperature preservation tube usually stay between the bubbles and the solution of the low-temperature protective agent, only 5 particles were considered in each tube, for a total of 5 repetitions), a total of 405 test units, and placed in a -80℃ refrigerator for low-temperature preservation for 120d.

[0041] 2. Experimental Materials

[0042] (1) Preparation of bacterial strains

[0043] The Armillaria borealis strain used in this experiment was Armillaria borealis (CBS M, Armillaria borealis Marxm & Korhonen), which was obtained from the National Culture Collection Center of the Chinese Academy of Forestry. After purification, it was inoculated and cultured for later use.

[0044] (2) Preparation of culture substrate

[0045] Agar culture substrate: 20 g glucose, 1.0 g peptone, 20 g malt extract, 20 g agar, 1000 mL distilled water, natural pH, autoclave at 121°C for 20 min to obtain a basal medium (malt extract agar medium, Malt Extract Ager). The strain was inoculated into the basal medium and kept in the dark at 25±1°C for later use.

[0046] Corn culture substrate: corn kernels and water were mixed in a mass ratio of 1:3, and sterilized by high pressure at 121°C for 20 min to obtain corn culture medium. The strain was inoculated into the corn culture medium and maintained at 25±1°C in the dark for later use.

[0047] Wheat culture substrate: The wheat grains were washed with running water and then with ultrapure water; next, they were immersed in ultrapure water and kept at 90°C for 60 min, the soaked wheat grains were transferred to a 50 mL conical flask, filling 75% of the volume of the conical flask, and then they were autoclaved at 121°C for 20 min to obtain wheat culture medium. The strains were inoculated in the wheat culture medium and kept at 25±1°C in the dark until 90% of the wheat culture medium was colonized, and the wheat used for low temperature storage was the wheat in the middle part of the conical flask, because the wheat in the upper part had no colonization vitality, and the wheat in the lower part might not have completely colonized the grain itself.

[0048] (3) Configuration of cryoprotectant

[0049] The cryoprotectants used are 6% dimethyl sulfoxide (DMSO), 5%, 8%, 10%, 12%, 15% and 60% glycerol (Gly), 4% glucose (Glu) and distilled water; DMSO and GO can penetrate the cell wall and cell membrane; GU, only penetrates the cell wall. Glycerol preparation: Taking 5% glycerol as an example, take 5g glycerol and dissolve it in 95g water, and other glycerol concentrations are similar; 6% DMSO configuration: take 6g DMSO and dissolve it in 95g water; 4% glucose configuration: take 4g glucose and dissolve it in 96g water; the prepared cryoprotectants are sterilized at 121℃ for 20min, except for 6% DMSO, which is sterilized by filtering through a 0.22μm filter membrane.

[0050] 3. Experimental methods

[0051] (1) Low temperature storage method

[0052] The substrates used before cryopreservation were agar, corn and wheat. For cryopreservation, the cryoprotectants used were glycerol, dimethyl sulfoxide (DMSO), glucose and distilled water at different concentrations. Each sterilized cryopreservation tube was placed with 1.8 mL of cryoprotectant under sterile conditions, and then 5 agar discs, corn particles containing growing mycelium or wheat particles containing growing mycelium were added, and then placed in a 4°C refrigerator for 1d, 2d or 3d of equilibration. After the equilibration was completed, it was placed in a -80°C refrigerator for low temperature storage.

[0053] (2) Thawing procedure

[0054] The thawing procedure followed the method of Bertéli: after 120 days of cryopreservation, the cryopreservation tubes were thawed in a water bath at 30°C for 15 min. They were first washed with 70% alcohol and then with 96% alcohol, and the cryopreservation tubes were opened to remove the cryoprotectant.

[0055] 4. Data determination

[0056] Determination of recovery rate: Inoculate agar discs, corn particles containing growing mycelium, or wheat particles containing growing mycelium into MEA medium and culture in the dark at 25±1°C. When at least 75% of the agar discs, corn particles containing growing mycelium, or wheat particles containing growing mycelium are filled with mycelium or have uniform mycelial growth within 30 days, the mycelium is considered to be alive.

[0057] 5. Data Analysis

[0058] In this study, three-way ANOVA was used to analyze the response of the recovery rate to different culture substrates, different equilibrium days and different types of protective agents. Duncan's significance test was used for analysis. Excel 2010 and SPSS Statistics 24.0 were used to organize and summarize the data and the mean and standard deviation of each treatment.

[0059] 6. Results and Analysis

[0060] The responses of the recovery rate to different culture substrates, different equilibrium days and different types of protective agents are shown in Tables 1-3 and Figure 1 .

[0061] Table 1 Variance analysis of different factors on the recovery rate of Armillaria mellea

[0062] factor sum of squares df F p Culture matrix 58419.753 2 50.340 <0.001 Protective agent type 100641.975 8 21.681 <0.001 Balance days 9827.160 2 8.468 <0.001 Culture medium × protective agent type 62913.580 16 6.777 <0.001 Culture medium × equilibrium days 9283.951 4 4.000 0.004 Protectant type × equilibrium days 19506.173 16 2.101 0.008 Culture medium × protective agent type × equilibrium days 26716.049 32 1.439 0.063

[0063] Table 2 Effect of culture medium on recovery rate

[0064]

[0065]

[0066] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different culture substrates (P<0.05).

[0067] Table 3 Effect of balance days on recovery rate

[0068] Serial number Balance days Recovery rate (%) 1 1d 83.7±37.1b 2 2d 93.3±25.0a 3 3d 82.2±38.4b

[0069] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences in different equilibrium days (P<0.05).

[0070] Table 4 Effect of protective agent type on recovery rate

[0071] Serial number Protective agent type Recovery rate (%) 1 Sterile water 91.1±28.8ab 2 5% Glycerol 91.1±28.8ab 3 8% Glycerin 91.1±28.8ab 4 10% Glycerin 97.8±14.9a 5 12% Glycerin 100.0±0.0a 6 15% Glycerin 80.0±40.1b 7 60% Glycerin 44.4±50.2c 8 4% Glucose 93.3±25.2a 9 6% DMSO 88.9±31.8ab

[0072] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different types of protective agents (P<0.05).

[0073] The results showed that the culture medium, equilibrium days and protective agent type had a significant effect on the recovery rate of Armillaria mellea, and there was a significant interaction between each two factors (Table 1).

[0074] (1) As shown in Table 2, the use of different culture substrates before cryopreservation had a significant effect on the recovery rate of Armillaria mellea. The recovery rate of wheat as the culture substrate was significantly higher than that of agar and corn as the culture substrate. The recovery rate of wheat as the culture substrate was the highest, at 99.3%. The average recovery rate of corn as the culture substrate was 89.6%. However, a large number of Armillaria melleae did not recover when agar was used as the culture substrate ( Figure 1 ), which had the lowest average recovery rate of 71.1%.

[0075] (2) As shown in Table 3, the number of days of equilibration also has a significant effect on the recovery rate of Armillaria mellea. Specifically, the recovery rate of equilibration for 2 days in a 4°C refrigerator was 93.3%, which was significantly higher than the recovery rates of equilibration for 1 day and 3 days, while the recovery rates of equilibration for 1 day and 3 days were 83.7% and 82.2%, respectively, with no significant difference between the two.

[0076] (3) As shown in Table 4, except for the low temperature protective agent 60% glycerol, the recovery rate of Armillaria mellea was lower, which was 44.4%. There was no significant difference in the recovery rate of Armillaria mellea among other protective agents.

[0077] In general, agar is widely used as a culture substrate for cryopreservation of fungi, but the results show that no matter what kind of protective agent and balance days, the recovery rate of Armillaria mellea is as high as 99.3% when wheat is used as the culture substrate. Wheat particles can effectively preserve the mycelial vitality of Armillaria mellea when used as a culture substrate before cryopreservation, that is, cryopreservation with wheat as a culture substrate has more potential in the preservation of Armillaria mellea. However, since there is no significant difference between cryopreservatives and balance days, specific protective agents and balance days need to be further screened.

[0078] Example 2 Screening of cryoprotectants and equilibrium days

[0079] 1. Experimental design

[0080] In order to screen the cryoprotectants and equilibrium days for low-temperature storage of Armillaria mellea, this experiment adopted a two-factor completely randomized design, with the experimental factors being the type of protectant and the equilibrium days. Nine levels of cryoprotectants were set (sterile water, 5%, 8%, 10%, 12%, 15%, 60% glycerol, 4% glucose and 6% DMSO), and three levels of equilibrium days were set (1d, 2d and 3d). Experimental units: 9×3=27 treatments, 5 biological replicates for each treatment, totaling 135 experimental units. After being stored at -80℃ for 120 days, they were inoculated into MEA medium and cultured under constant temperature in the dark for 35 days. The biological characteristics, growth rate, colony area and biomass of the strains under different treatments were measured. Among them, the control group (CK) refers to the indicators measured without freezing and under the optimal growth conditions. After comprehensive evaluation, the most suitable cryopreservation method for Armillaria mellea was selected.

[0081] 2. Experimental Materials

[0082] (1) Preparation of bacterial strains

[0083] The Armillaria borealis strain used in this experiment was Armillaria borealis (CBS M, Armillaria borealis Marxm & Korhonen), which was obtained from the National Culture Collection Center of the Chinese Academy of Forestry. After purification, it was inoculated and cultured for later use.

[0084] (2) Preparation of culture substrate

[0085] Same as Example 1.

[0086] (3) Configuration of cryoprotectant

[0087] Same as Example 1.

[0088] 3. Experimental methods

[0089] (1) Low temperature storage method

[0090] Same as Example 1.

[0091] (2) Thawing procedure

[0092] Same as Example 1.

[0093] 4. Data determination

[0094] (1) Growth characteristics

[0095] The growth of each strain at different temperatures was observed and recorded every day. After the culture was completed, the honey ring strains under each treatment were photographed to record the mycelial morphology under different temperature culture conditions.

[0096] (2) Colony morphology

[0097] The scoring standard for mycelium growth is: 5 points, mycelium grows densely and evenly; 4 points, mycelium grows relatively densely and evenly; 3 points, mycelium grows relatively densely and unevenly; 2 points, mycelium grows sparsely and evenly; 1 point, mycelium grows sparsely and unevenly.

[0098] Mycelium density: + represents sparse mycelium, which is scored as 1 point; ++ represents dense mycelium and good growth, which is scored as 2 points; +++ represents thick and dense mycelium, which is scored as 3 points.

[0099] Mycelium uniformity: Uneven mycelium is assigned a value of 1; relatively uniform mycelium is assigned a value of 2; and uniform mycelium growth is assigned a value of 3.

[0100] The uniformity of mycelium edge: an irregular edge is assigned a value of 1; a uniform edge is assigned a value of 2.

[0101] Mycelium lodging situation: the mycelium lodging is assigned a value of 1; the mycelium upright growth is assigned a value of 2.

[0102] Hardness of the colony shell: 1 is assigned if the colony shell is thick and hard; 2 is assigned if the shell is thick but not hard, and 3 is assigned if a hard shell has not yet been formed.

[0103] (3) Method for determining germination time

[0104] The strains with different treatments were inoculated on sterilized MEA medium and cultured at a constant temperature of 25°C. The time required for the strains to germinate was calculated from the day of inoculation until fine villous hyphae appeared on the edge of the bacterial ball.

[0105] (4) Colony diameter measurement method

[0106] In this experiment, the colony diameter was measured by the cross method. The initial colony diameter was 5 mm. In the solid culture medium, the colony diameter was measured every 7 days, and its growth was observed and recorded. After the colony diameter was measured on the 35th day, the growth rate of each strain at different temperatures was calculated. The growth rate (R) = (35d colony diameter - initial colony diameter) / culture time. The average value of the hyphae growth rate repeated 5 times was used for comparison and analysis. The evaluation criteria for growth rate are:

[0107] Excellent: The growth rate is high, close to or higher than the average, the stability is high, and the variance of the data is small, and the score is 4; Good: The growth rate is medium, comparable to the average, the stability is high, and the variance of the data is moderate, and the score is 3; Fair: The growth rate is slightly lower, lower than the average, the variance of the data is large, but still within an acceptable range, and the score is 2; Poor: The growth rate is significantly lower than the average, the variance of the data is large, and it is not stable enough, and the score is 1.

[0108] (5) Colony area (S) determination method

[0109] The colony was copied with kraft paper, and the colony copy was scanned using the WinRhizo 2007 root analysis system to obtain the area of ​​the pattern, which is the colony area S. The evaluation criteria for the colony area are:

[0110] Excellent: colony area P≥30, assigned 4 points; Good: colony area between 20≤P<30, assigned 3 points.

[0111] Average: the colony area is between 10≤P<20, and the value is 2 points; Poor: the colony area P<10, and the value is 1 point.

[0112] (6) Determination of bacterial biomass (M)

[0113] Take out the strain after 35 days of culture, scrape off the agar on the lower surface with a knife, wash off the excess culture medium around it, dry it with filter paper, dry it at 60±1℃, and weigh it after cooling. The evaluation criteria for colony area are:

[0114] Excellent: the colony area is between 0.49-0.61, and the value is 4 points; good: the colony area is between 0.37-0.48, and the value is 3 points; average: the colony area is between 0.24-0.36, and the value is 2 points; poor: the colony area is between 0.11-0.23, and the value is 1 point.

[0115] 5. Data Analysis

[0116] This study used growth rate R, colony area S, and bacterial biomass M as dependent variables, and the type of cryoprotectant and equilibrium days as independent variables for variance analysis, and Duncan's significance test analysis. This experiment used Excel 2010 and SPSS Statistics 24.0 to organize and summarize data and the average and standard deviation of each treatment.

[0117] 6. Results and Analysis

[0118] (1) Changes in biological characteristics of Armillaria mellea under different treatments

[0119] The effectiveness of the cryopreservation method is demonstrated by the mycelium growth test. The revived strains germinate mycelium normally under appropriate culture conditions, indicating that the mycelium is active. The growth of Armillaria melleaf under different treatments is shown in Tables 5 and Figure 2 .

[0120] Table 5 Growth of honey fungus mycelium under different low temperature storage methods

[0121]

[0122]

[0123] Note: + represents sparse mycelium; ++ represents dense mycelium and good growth; +++ represents thick and dense mycelium. The mycelium color is compared with the national standard color card GSB05-1426-2001 paint film color standard sample card.

[0124] Depend on Figure 2 It can be seen that under different treatments, the biological growth of Armillaria melleaf varies. As can be seen from Table 5, under different low-temperature preservation methods, the fastest germination time of the fungus is 2 days, and the slowest is 4 days. However, with 60% glycerol as a low-temperature protective agent, the mycelium germinates slowly, and the fastest needs 3 days to germinate, and the latest needs 4 days to germinate. Growth of Armillaria melleaf mycelium under suitable temperature with different preservation methods. Under different preservation methods, the color of the mycelium of Armillaria melleaf did not change and was milky white, and there was no difference in uniformity; the mycelium growth under sterile water-2d, Gly-5%-2d, Gly-8%-2d, Gly-10%-2d and Glu-4%-2d treatments was not significantly different from that under normal conditions. Under other treatments, the growth was worse than normal.

[0125] (2) Effects of different treatments on the growth rate of Armillaria mellea

[0126] After the strains are revived, the growth rate of mycelium is an important indicator of the growth capacity of the strains. The survey results are shown in Table 6.

[0127] Table 6 Growth rate of Armillaria mellea under different low temperature storage methods

[0128]

[0129] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different treatments (P<0.05).

[0130] The results showed that with the extension of equilibrium time, the growth rate of Armillaria mellea reached the maximum when the equilibrium time was 2 days for most cryoprotectants, and the maximum growth rate of 5% glycerol equilibrium for 2 days was 1.35 mm·d -1 The slowest growth rate was 0.61 mm·d-1 when balanced with 60% glycerol for 1 day. -1, which is significantly lower than the growth rate of CBS M under normal conditions. The specific scores for each treatment are as follows: 4 points for Gly-5%-2d, sterile water-3d, Gly-10%-2d, Gly-10%-3d, Glu-4%-2d and Glu-4%-3d; 3 points for sterile water-1d, sterile water-2d, Gly-5%-3d, Gly-5%-1d, Gly-8%-2d, Gly-8%-3d, Gly-10%-1d and Glu-4%-1d ; Gly-8%-1d, Gly-12%-1d, Gly-12%-2d, Gly-15%-2d, Gly-15%-1d, DMSO-6%-3d, Gly-15%-3d and Gly-60%-3d were assigned 2 points; Gly-60%-1d, Gly-60%-2d, DMSO-6%-1d, DMSO-6%-2d and Gly-12%-3d were assigned 1 point (Table 6).

[0131] (3) Effects of different treatments on the colony area of ​​Armillaria mellea

[0132] The survey results of the colony area of ​​Armillaria mellea under different treatments are shown in Table 7.

[0133] Table 7 Colony area of ​​Armillaria melleaf under different low temperature storage methods

[0134]

[0135]

[0136] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different treatments (P<0.05).

[0137] The study showed that different treatments had significant differences in the effects on the colony area of ​​Armillaria mellea. Sterile water-2d, Gly-5%-2d and Gly-10%-3d had significantly higher colony areas than CBS M under normal conditions. At 1d of equilibrium, DMSO showed the largest colony area, which was significantly higher than other types of protective agents. At 2d of equilibrium, Gly-5%, sterile water and Glu-4% had larger colony areas, while DMSO significantly reduced them. At 3d of equilibrium, Gly-10% showed the largest colony area, and DMSO significantly reduced it. The specific scores for each treatment are as follows: sterile water-2d is assigned 4 points; sterile water-3d, Gly-5%-2d, Gly-8%-1d, Gly-8%-2d, Gly-8%-3d, Gly-10%-2d, Gly-10%-3d, Gly-60%-1d, Glu-4%-2d, Glu-4%-3d and DMSO-6%-1d are assigned 3 points; sterile water-1d, Gly-5%-1 d, Gly-5%-3d, Gly-10%-1d, Gly-12%-1d, Gly-12%-2d, Gly-12%-3d, Gly-15%-1d, Gly-15%-2d, Gly-15%-3d and Glu-4%-1d were assigned 2 points; Gly-60%-2d, Gly-60%-3d, DMSO-6%-2d and DMSO-6%-3d were assigned 1 point (Table 7).

[0138] (4) Effects of different treatments on the biomass of Armillaria mellea

[0139] The survey results of Armillaria biomass under different treatments are shown in Table 8.

[0140] Table 8 Biomass of Armillaria melleaf under different cryopreservation methods

[0141]

[0142] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different treatments (P<0.05).

[0143] The study showed that different treatments had significant differences in the effects on the biomass of Armillaria mellea. The maximum biomass of Armillaria mellea using Gly-10%-3d was 0.61g, significantly higher than the biomass of CBS M under normal conditions, while the minimum biomass of Armillaria mellea using DMSO-2d was 0.11g, significantly lower than the normal level. At 1d of equilibrium, Gly-10% showed the maximum biomass, and DMSO showed less biomass; at 2d of equilibrium, Gly-5% showed the maximum biomass, and DMSO showed less biomass; at 3d of equilibrium, Gly-10% showed the maximum biomass, and Gly-12% showed less biomass. The specific points for each treatment are as follows: 4 points for Gly-5%-2d, Gly-10%-1d, Gly-10%-3d and Glu-4%-3d; 3 points for sterile water-2d, sterile water-3d, Gly-5%-1d, Gly-8%-1d, Gly-8%-2d, Gly-10%-2d, Gly-12%-1d, Gly-15%-3d, Glu-4%-2d; Bacterial water-1d, Gly-5%-3d, Gly-8%-3d, Gly-12%-2d, Gly-12%-3d, Gly-15%-1d, Gly-15%-2d, Gly-60%-3d, Glu-4%-1d and DMSO-3d were assigned 2 points; Gly-60%-1d, Gly-60%-2d, DMSO-6%-1d and DMSO-2d were assigned 1 point (Table 8).

[0144] Combining the above results, we found (see Table 9) that the Gly-5%-2d treatment had the highest score after comprehensive evaluation, which was 23 points, indicating that the preservation effect of Armillaria mellea after resuscitation was good under this treatment, followed by Gly-10%-3d, with 22 points; the Gly-60%-2d treatment had the lowest score, which was 10 points, and the preservation effect of Armillaria mellea after resuscitation was poor.

[0145] Table 9 Comprehensive evaluation scores of different cryopreservation methods

[0146]

[0147] (5) Effects of cryopreservation methods on Armillaria DNA sequences

[0148] After comprehensive evaluation, the 2-day storage method of 5% glycerol balance at -80°C is most suitable for the survival of Armillaria mellea. Therefore, the DNA of Armillaria mellea CBS M after thawing for 120 days under this condition and before cryopreservation were amplified by PCR. The electrophoresis results of the DNA amplification products of the strains are as follows: Figure 3 As shown. In the BLAST homology comparison, it was found that the homology of the two sequences before and after cryopreservation was 100%, and the coverage of the same bases was 100% (as shown in Figure 2). Figure 4-Figure 7 The results show that the base sequence of the strain did not change before and after cryopreservation, indicating that the cryopreservation method will not cause gene mutations in the strain. Figure 8-Figure 9 As shown, the sequencing peak diagram of the CBS M part of Armillaria melleaf after thawing for 120 days after cryopreservation is as follows Figure 10-11 shown.

[0149] Combining the results of Example 1 and Example 2, it can be seen that using wheat culture medium as the culture substrate before freezing has a higher recovery rate of 99.3% for Armillaria after low-temperature storage; while using agar and corn as the culture substrate before freezing, the recovery rate after low-temperature storage is significantly lower than the recovery rate using wheat as the culture substrate. Using 5% glycerol as a cryoprotectant and balancing in a 4°C refrigerator for 2 days has a better preservation effect on the germination time, growth rate, colony area and bacterial biomass of Armillaria after recovery compared to other treatments, and this method does not change the DNA sequence before and after low-temperature storage. Based on the above results, a method suitable for low-temperature storage of Armillaria was screened out, namely, using wheat as the culture substrate before low-temperature storage, 5% glycerol as a cryoprotectant, and balancing in a 4°C refrigerator for 2 days.

[0150] Example 3 Applicability of cryopreservation method

[0151] 1. Experimental design

[0152] In order to verify the reliability of the cryopreservation method, a single-factor completely randomized design was adopted. The experimental factors were the 8 major classification units of Armillaria melleae in my country (Table 10) and the 18 major commercial strains in southwestern Hubei (Table 11). Each strain was set up with 5 replicates, for a total of 26×5=130 experimental units. The 26 Armillaria melleae strains were stored at -80℃ (i.e., cultured with wheat as the culture medium before freezing, with 5% glycerol as the cryoprotectant, and stored in a 4℃ refrigerator for 2 days. After cryopreservation for 120 days, they were inoculated into MEA medium and cultured under dark constant temperature conditions for 35 days. The recovery rate, biological characteristics, growth rate, colony area and biomass of the strains after freezing were measured.

[0153] 2. Data Analysis

[0154] In this experiment, growth rate R, colony area S, and bacterial biomass M were used as dependent variables, and cryoprotectant type and equilibrium days were used as independent variables for variance analysis, and Duncan's significance test was used for analysis. Excel 2010 and SPSS Statistics 24.0 were used to organize and summarize data and the mean and standard deviation of each treatment, and Origin 2018 was used for graphing.

[0155] Table 10 Taxonomic units of tested Armillaria

[0156]

[0157]

[0158] Note: CBS stands for Chinese biological species. The classification units of Armillaria mellea were introduced from the National Culture Collection Center of the Chinese Academy of Forestry. After purification, they were inoculated and cultured for later use.

[0159] Table 11 Commercial honey fungus strains tested

[0160] Serial number Origin Strain No. Is there a history of companion planting of Gastrodia elata? 1 Heze, Shandong M-6 yes 2 Wufeng, Yichang, Hubei JD-M yes 3 Wumengteng, Guizhou WU yes 4 Anhui Anqing Yuexi AH-JC yes 5 Shaotong, Yunnan YN-ST yes 6 Fang County, Shiyan, Hubei Save 6 yes 7 Wufeng, Yichang, Hubei Wufeng I yes 8 Shaanxi HY yes 9 Yunnan SW1 yes 10 Hubei Yichang Niuzhuang SW2 yes 11 Hubei Shennongjia SW3 yes 12 Hubei Shennongjia SW5 yes 13 Dalaoling, Yichang, Hubei SW6 yes 14 Hubei Yichang Niuzhuang SW7 yes 15 Yunnan SW10 yes 16 Fang County, Shiyan, Hubei SW11 yes 17 Fang County, Shiyan, Hubei SW13 yes 18 Fang County, Shiyan, Hubei SW14 yes

[0161] Note: Select commercial Armillaria species, purify them, inoculate and culture them for later use.

[0162] 3. Results and analysis

[0163] (1) Recovery rate of Armillaria strains from different sources under low temperature storage

[0164] The survey results of the recovery rate of Armillaria strains from different sources under low temperature storage are shown in Tables 12 and 13.

[0165] Table 12 Recovery rate of Armillaria taxa after freezing

[0166] Armillaria taxa Recovery rate (%) CBSA 100±0.0a CBSB 100±0.0a CBSD 100±0.0a CBSF 100±0.0a CBSH 100±0.0a CBSJ 100±0.0a CBSM 100±0.0a CBSN 60±54.7b

[0167] Note: CBS stands for Chinese biological species. The values ​​in the table are mean ± standard deviation. Different letters in the same column indicate significant differences among different treatments (P<0.05).

[0168] Table 13 Recovery rate of commercial strains after freezing

[0169] Commercial strains of Armillaria mellea from southwestern Hubei Recovery rate (%) M-6 100±0.0a JD-M 100±0.0a WU 100±0.0a AH-JC 100±0.0a YN-ST 100±0.0a Save 6 100±0.0a Wufeng I 100±0.0a HY 100±0.0a SW1 80±44.7a SW2 100±0.0a SW3 100±0.0a SW5 100±0.0a SW6 100±0.0a SW7 100±0.0a SW10 100±0.0a SW11 100±0.0a SW13 100±0.0a SW14 100±0.0a

[0170] Note: The values ​​in the table are mean ± standard deviation; different letters in the same column indicate significant differences among different treatments (P<0.05)

[0171] Within the range of 8 Armillaria taxa, the recovery rate of CBS N was 60%, significantly lower than that of other strains, while the recovery rates of the remaining Armillaria species were 100% (Table 12). Within the range of commercial strains, except for strain SW1 with a recovery rate of 80%, the recovery rates of the remaining strains were 100% (Table 13).

[0172] (2) Differences in growth rates of Armillaria melleae from different sources before and after cryopreservation

[0173] Growth rates of Armillaria melleae from different sources before and after cryopreservation Fig.12As shown. Fig.12 It can be seen that within the range of Armillaria species, taking growth rate as the recovery index, the growth rate of CBS N after cryopreservation is significantly lower than that before freezing, while the growth rates of CBS H and CBS J after freezing are significantly higher than those before freezing, and there is no significant difference in the growth rate of other species before freezing, indicating that this cryopreservation method is suitable for most Armillaria species. Within the range of Armillaria commercial strains, except for SW3, SW5 and JD-M strains whose growth rates after cryopreservation are significantly lower than those before cryopreservation, there is no significant difference in the growth rates of other strains before and after cryopreservation, among which the growth rates of SW7 and YN-ST strains after freezing are significantly higher than those before freezing.

[0174] (3) Differences in biomass of Armillaria melleae from different sources before and after cryopreservation

[0175] Biomass of Armillaria mellea from different sources before and after cryopreservation Fig.13 As shown. Fig.13 It can be seen that taking biomass as the recovery index, there was no significant difference in biomass before and after low-temperature storage among the 8 biological species of Armillaria mellea; among the 18 commercial strains, except for strains SW1, SW2 and YN-ST, whose biomass after freezing was significantly higher than that before freezing, there was no significant difference in the biomass of other commercial strains after freezing.

[0176] (4) Differences in colony area of ​​Armillaria mellea from different sources before and after cryopreservation

[0177] Colony area of ​​honey fungus from different sources before and after low temperature storage Fig.14 As shown. Fig.14 It can be seen that taking the colony area as the recovery index, among the 8 species of Armillaria mellea, except for CBSN whose colony area after freezing was significantly smaller than before freezing, there was no significant difference in the colony area of ​​the other species before and after low-temperature storage; among the 18 commercial strains, except for SW6 whose colony area after freezing was significantly larger than before freezing, there was no significant difference in the colony area of ​​other strains before and after low-temperature storage.

[0178] (5) Differences in DNA sequences of honeysuckle strains from different sources before and after cryopreservation

[0179] The DNA sequences of Armillaria strains from different sources were compared before and after cryopreservation. The results showed that for the low-temperature cryopreservation of 26 Armillaria strains, the storage method with wheat as the culture medium and 5% glycerol as the cryoprotectant for 2 days would not change the gene sequence of the Armillaria strains, indicating that this cryopreservation method would not cause genetic variation of the strains. Fig.15 and 16 The middle is the sequencing peak diagram of CBS A before and after low-temperature storage. Fig.15This is the peak diagram of the sequencing of CBS A before low-temperature freezing. Fig.16 This is the sequencing peak graph of CBS A after cryopreservation. There is no change in the nucleotide sequence of CBS A before and after cryopreservation. The partial nucleotide sequence in CBS A is specifically TTATCGCTGGTGGAACTGGTGAGTTCGAAGCCGGTATCTCCAAGGACGGCCCAGACCCGAGAGCACGCCCTCCTTGCCTTCACCCTCGGTGTCAGGCAGCTCATTGTCGCTGTCAACAAGATGGACACCACCAAGGTACGAGATCTACTGTTTTACTTTTTCCTTGGGCAAATTTGACTGGTATGTCAGTGGAGCGAGGACCGGTTCAACGAAATCGTCAAGGAAACCTCCACCTT CATCAAGAAGGTCGGTTACAACCCCAAGGCCGTTGCGTTCGTCCCCATCTCTGGATGGCACGGTGATAACATGTTGGAGGAGTCCGCCAAGTAAGTCTTTACCCAACTATGATCAGTGCTGCCTCTTAACGTTCTCTGTAGCATGCCATGGTACAAGGGTTGGACCAAGGAGAATAAGGCCGGTGTCGTCAAGGGCAAGACTCTCCTCGATGCCATTGACGCCATTGAGCCCCCTGTCCGTCCCTCCGACAA (SEQ ID NO.1). Sequencing of the remaining strains before and after cryopreservation revealed that their nucleotide sequences also did not change.

[0180] In general, the comprehensive recovery indexes of Armillaria melleae after freezing, such as recovery rate, growth rate, biomass and colony area (Table 12), showed that the cryopreservation method had a very good preservation effect on the vast majority of Armillaria melleae taxa and commercial strains preserved in the laboratory, of which 85% were adapted to the cryopreservation method, 12% were relatively adapted, and the only strain that was not adapted was the CBS N strain, accounting for 3%. In addition, the DNA sequence did not change before and after cryopreservation, which once again verified the reliability of the cryopreservation method.

[0181] Table 12 Adaptability of Armillaria subunits and commercial strains

[0182]

[0183]

[0184] Note: ns means no significant difference, “>” and “<” mean significantly greater than or significantly less than.

[0185] This example adopts the cryopreservation method screened in Example 1 and Example 2, and cryopreserves 8 major honey fungus taxa in my country and 18 commercial honey fungus strains from southwestern Hubei, and observes the recovery rate of individual strains and the growth rate after recovery, whether there are differences in bacterial biomass and colony area before and after cryopreservation, and the effect on DNA sequence after freezing. The results show that among the honey fungus taxa, except CBS N, which is not suitable for this method, the other taxa are suitable for this method; within the range of 18 commercial strains, SW3, SW5 and JD-M strains are more suitable, and the other strains are suitable for this method. At the same time, the DNA sequences of 26 honey fungus strains did not change before and after cryopreservation, which once again verifies the reliability of the cryopreservation method. The results of Comprehensive Example 1-Example 3 show that wheat is used as the culture matrix before freezing, 5% glycerol is used as the cryoprotectant, and 4°C refrigerator balance for 2d is reliable for the preservation of honey fungus.

[0186] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for low temperature preservation of honey fungus species, characterized in that: The following steps are involved: Inoculating honey fungus into a culture medium for cultivation to obtain a culture substrate; the culture medium is a wheat culture medium; After mixing the culture substrate and the cryoprotectant, performing equilibrium treatment to obtain an equilibrium product; The cryoprotectant is 5wt.% glycerol; The equilibrium product is cryopreserved; the temperature of the equilibrium treatment is 4°C and the time is 2 days; the cryopreservation temperature is -80°C.

2. The method according to claim 1, characterized in that The preparation method of the wheat culture medium comprises the following steps: mixing wheat with water and soaking the mixture, sterilizing the wheat seeds obtained after the soaking, and obtaining the wheat culture medium.

3. The method according to claim 1, characterized in that The culture temperature is 24-26° C. and the culture method is dark culture.

Images