Grape flavonol synthase regulatory gene VvbZIP7 and its applications

Abstract

The present invention relates to the technical field of genetic engineering, and specifically relates to the grape flavonol synthesis regulatory gene VvbZIP7 and its application. The nucleotide sequence of the grape flavonol synthesis regulatory gene VvbZIP7 is shown in SEQ ID NO.1. The present invention identifies a transcription factor VvbZIP7, which can promote the expression of genes related to flavonol synthesis and the synthesis of flavonols. It is indicated that VvbZIP7 can be used as a candidate gene for creating new grape varieties with high flavonol content in the future.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the grape flavonol synthesis regulatory gene VvbZIP7 and its application. Background Art

[0002] Grapes are fruit trees with important economic value and are widely cultivated worldwide. Grape fruits can be eaten fresh, used for making wine, juice and dried fruits, with a wide range of uses. Flavonols are important secondary metabolites in grape fruits. Research shows that flavonols can effectively scavenge free radicals and play an important role in improving human immunity and preventing cardiovascular and cerebrovascular diseases, which is beneficial to human health. Therefore, it is of great significance to cultivate new grape varieties with high flavonol content. At present, the research on grape flavonols is only limited to the identification of synthases, and there are few reports on the upstream transcriptional regulation. Summary of the Invention

[0003] Aiming at the above deficiencies in the prior art, the purpose of the present invention is to provide the grape flavonol synthesis regulatory gene VvbZIP7 and its application.

[0004] In order to achieve the above invention purpose, the technical scheme adopted by the present invention is as follows:

[0005] In the first aspect, there is provided the grape flavonol synthesis regulatory gene VvbZIP7, whose nucleotide sequence is shown as SEQ ID NO.1.

[0006] In the second aspect, there is provided the encoded protein of the grape flavonol synthesis regulatory gene VvbZIP7, whose amino acid sequence is shown as SEQ ID NO.2.

[0007] In the third aspect, there is provided a recombinant vector containing the grape flavonol synthesis regulatory gene VvbZIP7.

[0008] Further, the recombinant vector is a vector overexpressing the VvbZIP7 gene.

[0009] In the fourth aspect, there is provided a recombinant strain or recombinant cell containing the grape flavonol synthesis regulatory gene VvbZIP7.

[0010] In the fifth aspect, there is provided the application of the grape flavonol synthesis regulatory gene VvbZIP7 in promoting flavonol synthesis.

[0011] In the sixth aspect, there is provided the application of the grape flavonol synthesis regulatory gene VvbZIP7 in cultivating new grape varieties rich in flavonols.

[0012] The beneficial effects of the present invention are as follows:

[0013] The present invention has identified a transcription factor VvbZIP7, which can promote the expression of genes related to flavonol synthesis and the synthesis of flavonols. It is indicated that VvbZIP7 can be used as a candidate gene for creating new grape varieties with high flavonol content in the future. Brief Description of the Drawings

[0014] Figure 1 Expression of VvbZIP7 gene in different tissues of grape;

[0015] Figure 2 Subcellular localization of VvbZIP7 gene;

[0016] Figure 3 Transcriptional activity analysis of VvbZIP7 protein;

[0017] Figure 4 Phenotype observation of VvbZIP7 overexpressing cells; wherein, A are cells transformed with empty vector 2300-EV and target gene 2300-VvbZIP7 under ultraviolet light; B is the phenotype of transformed 41B cells;

[0018] Figure 5 Overexpression of VvbZIP7 in 41B cells promotes the expression of flavonol synthesis gene VvFLS1;

[0019] Figure 6 VvbZIP7 binds to the promoter of VvFLS1. Detailed Embodiments

[0020] The following describes the specific embodiments of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions created using the concept of the present invention are within the scope of protection.

[0021] Example 1. Obtaining of Grape Ripening-related Transcription Factor VvbZIP7

[0022] Obtain the transcriptome data of various tissues of grape from the database (http: / / bar.utoronto.ca / efp_grape / cgi-bin / efpWeb.cgi). After a large amount of sequence analysis and function verification, find the transcription factor gene VvbZIP7 that is closely related to grape fruit ripening. The expression results of this gene in different tissues of grape are as Figure 1As shown, the VvbZIP7 gene is expressed in multiple tissues of grapes, such as buds, leaves, roots, stems, tendrils, flowers, seeds, pericarp, and pulp. Among them, the expression level is the highest in seeds before fruit maturity, and the expression in seeds decreases with fruit maturity, but the expression in pericarp and pulp gradually increases during the ripening process.

[0023] Example 2. Construction of the VvbZIP7 recombinant expression vector

[0024] (1) Total RNA of Pinot Noir grapes was extracted using the Aike Rui plant RNA extraction kit (AG21019) and reverse transcribed into cDNA (Nanjing Novoprotein Biological, R312-02). Using this cDNA as a template, a primer pair consisting of primer PreVvbZIP7-F and primer PreVvbZIP7-R was used for PCR amplification with the high-fidelity enzyme KOD (KOD OneTM PCR Master Mix, Toyobo, CodeNo.KMM-101) to obtain a PCR amplification product with a length of 1222 bp.

[0025] PreVvbZIP7-F: GGATCTGGGCAGTTGTGGAG

[0026] PreVvbZIP7-R: GGCAACCCTATTTTTACAGACCA

[0027] The PCR reaction system was: 100 ng cDNA template, 2 μL of 10 μM primer PreVvbZIP7-F, 2 μL of 10 μM primer PreVvbZIP7-R, 25 μL of KOD OneTM PCR Master Mix, and water was added to make up to 50 μL.

[0028] The PCR reaction program was set as: pre-denaturation at 94°C for 2 min; 98°C for 10 sec, 60°C for 10 sec, 68°C for 10 sec, for a total of 33 cycles; final extension at 68°C for 7 min.

[0029] The PCR amplification product was detected by 1% agarose gel electrophoresis, and the band with the correct size was recovered.

[0030] (2) The PCR amplification product obtained in step (1) was recovered and purified (micro-column concentrated DNA gel recovery kit, Zhuangmeng Biological, Code No.ZPV202). The purified product was ligated with the pLB vector (pLB zero-background rapid cloning kit, Tiangen Biochemical, Code No.VT205-01) to construct the pLB-VvbZIP7 vector, which was verified by sequencing to obtain the pLB-VvbZIP7 vector.

[0031] Ligation system: 35 ng of pLB vector, 100 ng of PCR product, 5 μL of 2× Reaction Solution, 1 μL of T4 DNA Ligase, make up to 10 μL with water.

[0032] Ligation conditions: React at 25 °C for 5 min.

[0033] (3) Using the pLB-VvbZIP7 vector obtained in step (2) as a template, perform PCR amplification with the primer pair consisting of primer 2300-VvbZIP7-F and primer 2300-VvbZIP7-R using the high-fidelity enzyme KOD (KOD OneTM PCR Master Mix, Toyobo, Code No. KMM-101) to obtain a PCR amplification product with a length of 474 bp.

[0034] 2300-VvbZIP7-F: ggacgagctcggtacccggggatccATGGCTTCCTCCAGTGGCAC

[0035] 2300-VvbZIP7-R: tcgcccttgctcaccatggtgtcgacTCAGTACTGAAAGATATCAG

[0036] The PCR reaction system is: 100 ng of pLB-VvbZIP7 plasmid as a template, 2 μL of 10 μM primer 2300-VvbZIP7-F, 2 μL of 10 μM primer 2300-VvbZIP7-R, 25 μL of KOD OneTM PCR Master Mix, make up to 50 μL with water.

[0037] The PCR reaction program is set as: Pre-denature at 94 °C for 2 min; 98 °C for 10 sec, 60 °C for 10 sec, 68 °C for 10 sec, a total of 33 cycles; final extension at 68 °C for 7 min.

[0038] Detect the PCR amplification product by 1% agarose gel electrophoresis, and there is a target band near the 500 bp band. Recover and purify the obtained PCR amplification product (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Biotech, CodeNo. ZPV202).

[0039] (4) Digest the 2300 vector with BamHI-HF (NEB, R3136S) and SalI-HF (NEB, R3138S) double digestion, detect the enzyme digestion product by 1% agarose gel electrophoresis, and recover and purify the target fragment (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Biotech, Code No. ZPV202).

[0040] The restriction digestion system is as follows: 1 μg of plasmid 2300, 1 μl of BamHI-HF, 1 μl of SalI-HF, 5 μl of 10X rCutSmart TM Buffer, and add water to make up to 50 μL.

[0041] The restriction digestion condition is: react at 37 °C for 2 h.

[0042] (5) Recombine the purified products obtained in steps (3) and (4) using a homologous recombinase (Clone Express II OneStep Cloning Kit, Novoprotein, C112-02). After sequencing verification, the 2300-VvbZIP7 overexpression vector is obtained. The constructed 2300-VvbZIP7 vector contains the DNA sequence shown in SEQ ID NO.1.

[0043] The recombination system: 200 ng of linearized vector, 40 ng of PCR product, 4 μl of 5×CE II Buffer, 2 μl of ExnaseII, and add water to make up to 20 μL.

[0044] The recombination condition: react at 37 °C for 30 min; cool down to 4 °C.

[0045] Example 3. Subcellular localization of the VvbZIP7 gene

[0046] Transform the 2300-VvbZIP7 vector obtained in Example 2 into Agrobacterium tumefaciens GV3101 by the freeze-thaw method, and positive clones are obtained by PCR amplification detection. Inoculate into 20 ml of LB liquid medium (100 mg / ml kanamycin + 50 mg / ml rifampicin), shake the bacteria overnight at 28 °C and 200 rpm. Centrifuge the cells at 5000 rpm for 10 min at room temperature, discard the supernatant, add 20 ml of resuspension solution (resuspend the cells with 10 mM MgCl2 and 20 mM MES pH 5.6), repeat this step 3 times, add 20 ml of resuspension solution (10 mM MgCl2, 20 mM MES pH 5.6, 200 μM acetosyringone), and adjust the OD 600 to 0.6. Place the bacterial solution in an incubator at 28 °C and let it stand for 3 hours, then inject it into tobacco leaves. After 72 hours, tear off the lower epidermis of the tobacco leaves, place it on a glass slide, smear 100 mM DAPI (DAPI is a specific dye for the nucleus), and observe under a super-resolution microscope ( Figure 2 ), and it is found that VvbZIP7 is localized in the nucleus, which is consistent with the subcellular localization of transcription factors.

[0047] Example 4. Transcriptional activity analysis of the VvbZIP7 protein

[0048] (1) Using the pLB-VvbZIP7 vector obtained in Example 2 as a template, a primer pair consisting of primer GAL4BD-VvbZIP7-F and primer GAL4BD-VvbZIP7-R was used for PCR amplification with the high-fidelity enzyme KOD (KOD OneTM PCR Master Mix, Toyobo, Code No. KMM-101) to obtain a PCR amplification product with a length of 474 bp.

[0049] GAL4BD-VvbZIP7-F:

[0050] ttgactgtatcgccgtctagaactagtggatccATGGCTTCCTCCAGTGGCAC

[0051] GAL4BD-VvbZIP7-R:

[0052] gtcgacggtatcgataagcttgatatcgaattcTCAGTACTGAAAGATATCAG

[0053] The PCR reaction system was as follows: 100 ng of pLB-VvbZIP7 plasmid as a template, 2 μL of 10 μM primer GAL4BD-VvbZIP7-F, 2 μL of 10 μM primer GAL4BD-VvbZIP7-R, 25 μL of KOD OneTM PCR Master Mix, and water was added to make up to 50 μL.

[0054] The PCR reaction program was set as follows: pre-denaturation at 94 °C for 2 min; 98 °C for 10 sec, 60 °C for 10 sec, 68 °C for 10 sec, for a total of 33 cycles; final extension at 68 °C for 7 min.

[0055] The PCR amplification product was detected by 1% agarose gel electrophoresis, and there was a target band near the 500 bp band. The obtained PCR amplification product was recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Biotech, Code No. ZPV202).

[0056] (2) The GAL4BD vector was double-digested with BamHI (NEB, R3136S) and EcoRI (NEB, M0211S). The digested product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Biotech, Code No. ZPV202).

[0057] The digestion system was as follows: 1 μg of GAL4BD plasmid, 1 μl of BamHI, 1 μl of EcoRI, 5 μl of 10XrCutSmartTM Buffer, make up to 50 μL with water.

[0058] The digestion condition is: react at 37 °C for 2 h.

[0059] (3) Recombine the purified products obtained in steps (1) and (2) using a homologous recombination enzyme (Clone Express II OneStep Cloning Kit, Novoprotein, C112-02), and obtain the GAL4BD-VvbZIP7 vector after sequencing verification. The constructed GAL4BD-VvbZIP7 vector contains the DNA sequence shown in SEQ ID NO.1.

[0060] Recombination system: 200 ng linearized vector, 40 ng PCR product, 4 μl 5×CE II Buffer, 2 μl ExnaseII, make up to 20 μL with water.

[0061] Recombination condition: react at 37 °C for 30 min; cool to 4 °C.

[0062] (4) Transform the GAL4BD-VvbZIP7 vector obtained in step (3) into maize protoplasts, and detect the relative activity of the LUC value ( Figure 3 ), and it is found that compared with the control GAL4BD-EV, the relative activity of LUC / REN is significantly increased after transforming the GAL4BD-VvbZIP7 plasmid, indicating that the transcription factor VvbZIP7 has transcriptional activation ability and can activate the transcription of downstream regulatory genes.

[0063] Example 5. Phenotypic analysis of positive materials of 2300-VvbZIP7 overexpression vector transformed into 41B cells

[0064] (1) Transform the 2300-VvbZIP7 vector obtained in Example 2 into Agrobacterium tumefaciens EHA105 by the freeze-thaw method, and obtain positive clones by PCR amplification detection. Inoculate into 20 ml of LB liquid medium (100 mg / ml kanamycin + 50 mg / ml rifampicin), shake the bacteria overnight at 28 °C and 200 rpm, centrifuge at 5000 rpm for 10 min at 4 °C to collect the bacteria, and transform grape 41B cells. The specific method is: first add 10 ml of GM medium to a sterile Erlenmeyer flask, add 1 ml of 41B cells, add the Agrobacterium suspension, co-culture at 28 °C in the dark for 2 days, and then screen in the selection medium (GM + 200 mg / l Timentin + 5 mg / l Kana), change the medium every week until positive cells are obtained.

[0065] GM medium preparation: 4.6 g glycerol, 18 g maltose, 1 g acid hydrolysate of casein, 2.18 g MS (Duchefa, M0232), 1 mg / L NOA, adjust the pH to 5.8, make up the volume to 1 L, add 7 g / L agar to prepare solid medium, sterilize at 121 °C for 20 min.

[0066] (2) Since the 2300 vector carries a GFP tag, it can be detected by ultraviolet light irradiation to determine whether the transformation is successful. Under ultraviolet light, compared with the wild type, the cells transformed with the empty vector 2300-EV and the target gene 2300-VvbZIP7 showed significant green fluorescence, indicating that the successfully transformed 41B cells were obtained after 3 months of screening ( Figure 4 A), and the cells became significantly yellowish ( Figure 4 B), which was presumably due to the increased content of flavonols.

[0067] (3) Samples of the positive cells detected in step (2) were taken, total RNA was extracted and reverse transcribed into cDNA. Using this cDNA as a template, the expression changes of the VvbZIP7 gene were detected by fluorescence quantitative reagent (AceQ qPCR SYBR Green Master Mix (Without ROX), Novoprotein, Q121-03) in a fluorescence quantitative PCR instrument (CFX Maestro System, Bio-Rad, USA). It was found that the expression level of the VvbZIP7 gene increased by 78 times compared with the control transformed with the 2300 empty vector, and the flavonol synthesis-related gene FLS1 increased by 12 times. These results indicate that the expression of the key gene FLS1 in flavonol synthesis increased significantly after overexpression of VvbZIP7. Thus, it is speculated that VvbZIP7 may directly regulate the expression of the FLS1 gene, as Figure 5 shown.

[0068] The primers used for fluorescence quantitative PCR are:

[0069] qPCR-VvbZIP7-F: GCACTATCCAGAGATGAGCTTC

[0070] qPCR-VvbZIP7-R: GAAGGGCAACAAATTGAAAATTCC

[0071] qPCR-VvFLS1-F: GCACTATCCAGAGATGAGCTTC

[0072] qPCR-VvFLS1-R: GAAGGGCAACAAATTGAAAATTCC

[0073] The internal reference is the VvEF1 gene, and the primers are:

[0074] qPCR-VvEF1-F: CAAGAGAAACCATCCCTAGCTG

[0075] qPCR-VvEF1-R: TCAATCTGTCTAGGAAAGGAAG

[0076] The reaction system of quantitative fluorescence PCR is as follows: 2 μL of template, 10 μL of SYBR Mix, 1 μL of each forward and reverse primer, and sterilized double-distilled water is added to make up to 20 μL.

[0077] The reaction program of quantitative fluorescence PCR is as follows: 98 °C for 10 min; 95 °C for 15 s, 60 °C for 30 s, 40 cycles; 72 °C for 5 min; 95 °C for 1 min, and the melting curve analysis is the default setting of the system.

[0078] Example 6. Yeast one-hybrid detection found that VvbZIP7 can directly bind to the promoter of VvFLS1

[0079] (1) The genomic DNA of grape 41B cells was extracted using the Zhuangmeng Biology Plant DNA Extraction Kit (ZP309-3). Using this DNA as a template, a primer pair consisting of primer PreFLS1pro-F and primer PreFLS1pro-R was used for PCR amplification with the high-fidelity enzyme KOD (KOD OneTM PCR Master Mix, Toyobo, CodeNo.KMM-101) to obtain a PCR amplification product with a length of 2000 bp.

[0080] PreFLS1pro-F: TGAAAAATCCAAAAATGATT

[0081] PreFLS1pro-R: ACTGCTTCCCTCTCTCTCTT

[0082] The PCR reaction system is as follows: 100 ng cDNA template, 2 μL of 10 μM primer PreFLS1pro-F, 2 μL of 10 μM primer PreFLS1pro-R, 25 μL of KOD OneTM PCR Master Mix, and water is added to make up to 50 μL.

[0083] The PCR reaction program is set as follows: pre-denaturation at 94 °C for 2 min; 98 °C for 10 sec, 60 °C for 10 sec, 68 °C for 10 sec, a total of 33 cycles; final extension at 68 °C for 7 min.

[0084] The PCR amplification product was detected by 1% agarose gel electrophoresis, and there was a target band between the 2000 bp bands.

[0085] (2) Recover and purify the PCR amplification product obtained in step (1) (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Biotech, Code No. ZPV202). Ligate the purified product with the pLB vector (pLB Zero Background Rapid Cloning Kit, Tiangen Biochemical, Code No. VT205-01) to construct the pLB-FLS1pro vector. After sequencing verification, the pLB-FLS1pro vector was successfully constructed.

[0086] Ligation system: 35 ng of pLB vector, 100 ng of PCR product, 5 μL of 2×Reaction Solution, 1 μL of T4 DNA Ligase, make up to 10 μL with water.

[0087] Ligation condition: React at 25 °C for 5 min.

[0088] (3) Using the pLB-FLS1pro plasmid obtained in step (2) as a template, perform PCR amplification with the primer pair consisting of primer plaZ-FLS1pro-F and primer plaZ-FLS1pro-R using the high-fidelity enzyme KOD (KOD OneTM PCR Master Mix, Toyobo, Code No. KMM-101) to obtain a PCR amplification product with a length of 2000 bp.

[0089] plaZ-FLS1pro-F: ggacgagctcggtacccggggatccTGAAAAATCCAAAAATGATT

[0090] plaZ-FLS1pro-R: tcgcccttgctcaccatggtgtcgacACTGCTTCCCTCTCTCTCTT

[0091] The PCR reaction system is: 100 ng of pLB-FLS1pro plasmid as a template, 2 μL of 10 μM primer plaZ-FLS1pro-F, 2 μL of 10 μM primer plaZ-FLS1pro-R, 25 μL of KOD OneTM PCR Master Mix, make up to 50 μL with water.

[0092] The PCR reaction program is set as: Pre-denature at 94 °C for 2 min; 98 °C for 10 sec, 60 °C for 10 sec, 68 °C for 10 sec, a total of 33 cycles; Final extension at 68 °C for 7 min.

[0093] The PCR amplification products were detected by 1% agarose gel electrophoresis, and there was a target band near the 2000bp band. The obtained PCR amplification products were recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Bio, CodeNo.ZPV202).

[0094] (4) The plaZ vector was double digested with EcoRI (NEB, M0211S) and XHOI (NEB, R0146V). The enzyme digestion products were detected by 1% agarose gel electrophoresis, and the target fragments were recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Bio, Code No.ZPV202).

[0095] The enzyme digestion system was: 1μg plaZ plasmid, 1μl EcoRI, 1μl XHOI, 5μl 10X rCutSmart TM Buffer, made up to 50μL with water.

[0096] The enzyme digestion condition was: react at 37°C for 2h.

[0097] (5) The purified products obtained in steps (3) and (4) were recombined using a homologous recombinase (Clone Express II OneStep Cloning Kit, Novoprotein, C112-02), and the plaZ-FLS1pro overexpression vector was obtained through sequencing verification.

[0098] The recombination system: 200ng linearized vector, 40ng PCR product, 4μl 5×CE II Buffer, 2μl ExnaseII, made up to 20μL with water.

[0099] The recombination condition: react at 37°C for 30min; cool down to 4°C.

[0100] (6) Using the pLB-VvbZIP7 plasmid as a template, the pB42AD-VvbZIP7 vector was constructed with primers pB42AD-VvbZIP7-F and pB42AD-VvbZIP7-R. The specific steps were referred to Example 4.

[0101] pB42AD-VvbZIP7-F:

[0102] atgatagtgccagattatgcctctcccgaattcATGGCTTCCTCCAGTGGCAC

[0103] pB42AD-VvbZIP7-R:

[0104] ccaaacctctggcgaagaagtccaaagcttctcgagTCAGTACTGAAAGATATCAG

[0105] The PCR reaction system was as follows: 100 ng of pLB-VvbZIP7 plasmid as the template, 2 μL of 10 μM primer pB42AD-VvbZIP7-F, 2 μL of 10 μM primer pB42AD-VvbZIP7-R, 25 μL of KOD OneTM PCR Master Mix, and made up to 50 μL with water.

[0106] The PCR reaction program was set as follows: pre-denaturation at 94 °C for 2 min; 98 °C for 10 sec, 60 °C for 10 sec, 68 °C for 10 sec, for a total of 33 cycles; final extension at 68 °C for 7 min.

[0107] The PCR amplification products were detected by 1% agarose gel electrophoresis, and there was a target band near the 2000 bp band. The obtained PCR amplification products were recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Bio, CodeNo.ZPV202).

[0108] (7) The pB42AD vector was double-digested with EcoRI (NEB, M0211S) and XHOI (NEB, R0146V). The digestion products were detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified (Microcolumn Concentrator DNA Gel Recovery Kit, Zhuangmeng Bio, Code No.ZPV202).

[0109] The digestion system was: 1 μg of pB42AD plasmid, 1 μl of EcoRI, 1 μl of XHOI, 5 μl of 10XrCutSmart TM Buffer, and made up to 50 μL with water.

[0110] The digestion condition was: reaction at 37 °C for 2 h.

[0111] (8) The purified products obtained in steps (3) and (4) were recombined using a homologous recombinase (Clone Express II OneStep Cloning Kit, Novoprotein, C112-02), and the pB42AD-VvbZIP7 vector was obtained after sequencing verification.

[0112] The recombination system: 200 ng of linearized vector, 40 ng of PCR product, 4 μl of 5×CE II Buffer, 2 μl of ExnaseII, and made up to 20 μL with water.

[0113] The recombination condition: reaction at 37 °C for 30 min; cooled to 4 °C.

[0114] (9) Transform the constructed pB42AD-VvbZIP7 and plaZ-VvFLS1pro plasmids into the yeast competent cell EGY48. The specific method is as follows: Streak the EGY48 yeast strain on the full-nutrient YPD solid medium (it is also possible to use the plate coating method instead of streaking), invert it in an incubator at 28 °C, and grow for 2 - 3 days; Pick monoclonal colonies into 10 ml of YPD liquid medium, culture overnight at 28 °C and 200 rpm; Centrifuge at 3000 rpm for 3 min to precipitate the yeast; Discard the supernatant, add 10 ml of ddH2O to resuspend; Centrifuge at 3000 rpm for 3 min to precipitate the yeast; Add water to resuspend the yeast, wash 2 - 3 times, then add 1 ml of one-step solution and resuspend by shaking; Aliquot into 1.5 ml centrifuge tubes, 100 μl per tube; Add 6 - 10 μl of salmon sperm DNA to each tube, add 1 μg of pB42AD-VvbZIP7 and plaZ-VvFLS1pro plasmids respectively, and co-transform into the EGY48 competent cells, shake and mix well; Incubate in a 45 °C water bath for 30 min, and resuspend by shaking every 10 min; Centrifuge at 3000 rpm for 3 min, add 100 ul of ddH2O to resuspend; Spread evenly on the amino acid-deficient SD solid medium (SD-Trp / Ura), invert it in an incubator at 28 °C, and grow for 2 - 3 days; Use a pipette tip to pick an appropriate amount of yeast, pick 6 - 10 monoclonal colonies (the number of picked colonies depends on the situation) from each plate into 1 ml of the corresponding amino acid-deficient SD liquid medium (SD-Trp / Ura), and culture at 28 °C and 200 rpm for 8 - 10 hours; Take out 50 ul for standby of bacterial liquid PCR, centrifuge the remaining at 3000 rpm for 3 min, discard the supernatant, leave <50 ul, and spot it onto the corresponding amino acid-deficient SD solid medium (SD-Trp / Ura) with a pipette tip, and grow for 1 - 3 days; Use a pipette tip to pick an appropriate amount of yeast onto the SC-Gal / Raf-X-gal plate; After 24 h, observe that the transformed pB42AD-VvbZIP7 and plaZ-FLS1pro plaques turn blue. As Figure 6 shown, this result indicates that VvbZIP7 directly binds to the FLS1 promoter.

[0115] Preparation of related media:

[0116] YPD medium (1 L): 50 g of YPD (cooler), make up the volume to 1 L, add 18 g / L of agar to prepare the solid medium, and sterilize at 121 °C for 15 min.

[0117] One step solution (10 ml): 2 ml of 10×LiAc, 8 ml of 50% PEG3350, 76.9 ul of β-mercaptoethanol

[0118] SD-Gal / Raf-X-gal (1L): 800 ml of SD-Trp-Ura, 100 ml of 10×BU salts, 50 ml of 20% galactose, 25 ml of 20% raffinose, 4 ml of 20 mg / ml X-gal. Add 18 g / L agar to prepare solid medium and sterilize at 121 °C for 15 min.

[0119] It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present invention.

[0120] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. Application of grape flavonol synthase regulatory gene VvbZIP7 in promoting the synthesis of grape flavonol, characterized in that Grape flavonol synthesis regulatory gene VvbZIP7 The nucleotide sequence thereof is shown in SEQ ID NO.

1.

2. Use of the gene for regulating the synthesis of grape flavonol according to claim 1 VvbZIP7 in the cultivation of grapes rich in flavonols.

Images