Tobacco NtGLK gene and its use

Abstract

The present invention relates to the technical field of plant genetic engineering, and discloses a tobacco NtGLK gene and its use, wherein the amino acid sequence of the tobacco NtGLK gene is shown in SEQ ID NO. 1. The present invention identifies that the NtGLK gene can be used to improve the photosynthesis of tobacco and regulate the tolerance of tobacco plants to drought and low temperature stress. Improving the expression of the NtGLK gene can not only enhance the photosynthetic capacity of tobacco, but also regulate the stress resistance of tobacco, such as improving drought resistance and cold resistance at the same time; through drought stress treatment, it is found that the water loss rate of the overexpression strain is significantly lower than that of the wild type; at the same time, the protein expression level and the phosphorylation modification level of the protein encoded by the NtGLK gene are significantly improved after low temperature induction, which lays a certain theoretical foundation for people to deeply study the molecular mechanism of tobacco response to low temperature stress. The gene can improve existing tobacco varieties so that they can maintain good survival ability when encountering drought and cold stress, and can also improve the photosynthetic capacity of tobacco, and has potential application value.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a tobacco NtGLK gene and its application. Background Art

[0002] For all terrestrial plants and many aquatic algae, photosynthesis is the key factor in their growth and development, and plant growth is closely related to various environmental factors. When factors that are not conducive to plant growth appear, plants will suffer from stress. Due to climate change caused by factors such as the greenhouse effect, extreme climate has caused serious damage to plant growth and development, among which drought and low temperature are very important environmental factors that limit plant growth and development.

[0003] Tobacco (Nicotiana tabacum L.) is an annual or limited perennial plant belonging to the genus Nicotiana of the Solanaceae family. It is one of the important economic crops in my country. It is a tropical and subtropical thermophilic crop introduced to China from South America. It is sensitive to temperature and water. Drought stress and low temperature stress will affect the development of tobacco, thereby limiting its growth and yield.

[0004] When tobacco is subjected to extreme drought or low temperature, a series of changes will occur in the physiological, biochemical and molecular aspects of tobacco in the process of resisting stress. For example, tobacco photosynthesis will be affected or even terminated, leading to metabolic disorders of tobacco itself, and severe cases will cause death. In summary, enhancing photosynthesis can affect the growth and development of tobacco, while drought stress and cold stress will affect the yield and quality of tobacco. These two environmental factors are real problems faced by tobacco production and are also important factors that limit the growth and distribution of tobacco. Summary of the invention

[0005] In view of this, the main purpose of the present invention is to provide a tobacco NtGLK gene and its use.

[0006] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0007] The embodiment of the present invention provides a tobacco NtGLK gene, and the amino acid sequence of the tobacco NtGLK gene is shown as SEQ ID NO.1.

[0008] The DNA molecule encoding the tobacco NtGLK gene described in the above scheme is shown as SEQ ID NO.2.

[0009] The embodiment of the present invention also provides a method for improving the photosynthetic efficiency of tobacco plants, wherein the method is to overexpress the DNA molecule described in the above scheme in tobacco plants by means of transgenic means.

[0010] The embodiment of the present invention also provides a method for improving the drought stress resistance of tobacco plants, wherein the method is to overexpress the DNA molecule as described in the above scheme in tobacco plants by means of transgenic means.

[0011] The embodiment of the present invention also provides a method for improving the resistance of tobacco plants to low temperature stress, wherein the method is to overexpress the DNA molecule as described in the above scheme in tobacco plants by means of transgenic means.

[0012] In the above scheme, during the construction of the recombinant vector, an enhancing, constitutive, tissue-specific and / or inducible promoter is added before the transcription start nucleotide, or the stop codon is removed.

[0013] In the above scheme, an enhancer is used in the process of constructing a recombinant vector.

[0014] In the above scheme, in the process of constructing the recombinant vector, a gene for an enzyme or luminescent compound that can produce color change in plants, an antibiotic resistance marker or a chemical resistance marker gene is added.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The tobacco NtGLK gene of the present invention is used to improve the photosynthesis of tobacco and simultaneously regulate the tolerance of tobacco plants to drought and low temperature stress, and is also conducive to people's in-depth study of the application of tobacco stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The drawings described herein are used to disclose a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0018] Figure 1 This is a diagram for identifying NtGLK knockout transgenic tobacco plants in Example 1 of the present invention;

[0019] Figure 2 is the relative mRNA expression level of NtGLK in the root and aerial part of tobacco plants at the seedling stage in Comparative Example 2 of the present invention;

[0020] Figure 3 is the relative mRNA expression level of NtGLK in various tissues of tobacco plants at the topping stage in Comparative Example 2 of the present invention;

[0021] Figure 4 This is a phenotype diagram of the NtGLK transgenic tobacco plant at the seedling stage in Example 2 of the present invention;

[0022] Figure 5are photosynthetic indices such as net photosynthetic rate, stomatal conductance, intercellular CO2 concentration and transpiration rate of the NtGLK transgenic tobacco plants at the seedling stage in Example 2 of the present invention;

[0023] Figure 6 Comparison of plant growth under normal planting conditions in Example 3 of the present invention;

[0024] Figure 7 Comparison of plant growth under drought stress conditions in Example 3 of the present invention;

[0025] Figure 8 The method is to measure the water loss rate of plants in vitro under normal planting conditions in Example 3 of the present invention;

[0026] Fig. 9 This is a graph showing the relative protein expression of NtGLK protein in the control and 24h cold stress in Example 4 of the present invention;

[0027] Fig.10 is the difference in phosphorylation abundance of NtGLK protein in the control and 24 h cold stress in Example 4 of the present invention;

[0028] Fig.11 Comparison of plant growth under normal planting conditions in Example 5 of the present invention;

[0029] Fig.12 Comparison of plant growth under recovery conditions after cold stress in Example 5 of the present invention;

[0030] Fig.13 This is the relative conductivity measurement before and after cold stress in Example 5 of the present invention. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0032] The embodiment of the present invention provides a tobacco NtGLK gene, and the amino acid sequence of the tobacco NtGLK gene is shown as SEQ ID NO.1.

[0033] Furthermore, the DNA molecule encoding the tobacco NtGLK gene is shown as SEQ ID NO.2.

[0034] The tobacco NtGLK gene of the present invention can enhance the photosynthesis of tobacco plants;

[0035] The invention of the tobacco NtGLK gene regulates the tolerance of tobacco plants to drought and low temperature, and also provides an important theoretical basis and rich genetic resources for breeding new tobacco varieties with wide adaptability.

[0036] The invention can not only improve the photosynthesis of tobacco leaves, but also enhance the stress resistance (drought, low temperature) of tobacco plants. On the one hand, it can solve the yield problem affected by drought and low temperature in tobacco-growing areas, and on the other hand, it can promote planting in more areas, expand the planting area, provide guarantee for the safe production of tobacco leaves, and has important value for cultivating new tobacco varieties with wide adaptability.

[0037] Example 1

[0038] Wild-type tobacco, namely the main tobacco variety K326 (Nicotiana tobacum L.cv. K326) in China, was used to construct the NtGLK overexpression strain (OE), and the specific steps were as follows:

[0039] The stop codon was removed from the coding region sequence of the NtGLK gene and connected to the plant expression vector pRI101-AN-eGFP (purchased from Beijing Bomade Gene Technology Co., Ltd., catalog number CL499-01) through NdeⅠ and EcoRⅠ to construct the recombinant vector pRI101-AN-eGFP-NtGLK. The pRI101-AN-eGFP-NtGLK recombinant plasmid was then transformed into Agrobacterium LBA4404 by the freeze-thaw method, and genetic transformation was carried out by the leaf disc transformation method.

[0040] By Kan + The PCR method was used to continue screening to obtain T2 stable strain materials, and three independent overexpression transgenic strains (OE#3, #13 and #15) were selected for subsequent experiments.

[0041] NtGLK is mainly expressed in the aboveground part and is a leaf tissue-specific expression gene. Figure 1 and 2 As shown. This provides a biochemical basis for NtGLK to regulate the gene function and application of tobacco plants.

[0042] Comparative Example 1

[0043] Wild tobacco, the main cultivated tobacco variety in China K326 (Nicotiana tobacum L.cv. K326).

[0044] Comparative Example 2

[0045] Wild-type tobacco, namely the main tobacco variety K326 (Nicotiana tobacum L.cv. K326) in China, was used to construct the NtGLK knockout strain by CRISPR. The specific construction method is as follows:

[0046] Use the online target site identification software CRIPSR Multi Targeter

[0047] The target site sequence was designed as AGAGAGTTGTTTAAGAAAAG (SEQ ID NO. 3), and primers were synthesized according to the target site (CRISPR-F: GAGAATTTGCTCGACAGTAT (SEQ ID NO. 4), CRISPR-R: TAGGATTTGTAGACACCCAC (SEQ ID NO. 5)).

[0048] Knockout vector construction: Single-stranded Oligo DNA was annealed to form double-stranded DNA, and the two synthesized single-stranded primers were diluted to 50 μM and then annealed.

[0049] The annealing reaction system is 50 μL: including 10 μL Annea ling Buffer for DNA Oligos (5×), 10 μL of upstream and downstream primers, and 20 μL of ddH2O.

[0050] Annealing reaction was carried out on Dongsheng (ETC-811) instrument, and the reaction conditions were: 95°C pre-denaturation for 2 min, -0.1°C / 8s, cooling to 25°C, and storage at 4°C.

[0051] Transform competent cells, detect positive clones, and transform Agrobacterium LBA4404 after sequencing verification. Genetic transformation was performed using the leaf disc transformation method. + After resistance screening combined with PCR method (forward primer GAGAATTTGCTCGACAGTAT (SEQ ID NO.4), reverse primer TAGGATTTGTAGACACCCAC (SEQ ID NO.5)), and sequencing verification, stable homozygous strain materials were obtained, and two independent knockout transgenic strains (CRISPR#9 and #13) of tobacco were selected for subsequent experiments. The identification of the knockout transgenic tobacco strains is shown in the figure Figure 3 shown.

[0052] Enzyme digestion of expression vector: The expression vector pORE-Cas9 / gRNA was digested with BsaⅠ. The digestion reaction system was 50μL: 5μL 10×CutSmart buffer, 1μL BsaⅠ (NEB), 30μL vector plasmid, 14μL ddH2O. Enzyme digestion reaction conditions: digest at 37℃ for 1h and run on a gel to recover the digestion product.

[0053] Example 2

[0054] like Figure 4As shown, under normal planting conditions, the overexpression transgenic tobacco strains of Example 1, the wild-type tobacco of Comparative Example 1 and the knockout transgenic strains of Comparative Example 2 have differences in leaf color, and the leaves of the knockout strains are yellowish. The overexpression transgenic tobacco strains (OE#3, #13 and #15) of Example 1, the wild-type tobacco of Comparative Example 1 and the knockout transgenic tobacco strains (CRISPR#9 and #13) of Comparative Example 2 were tested for photosynthetic indicators. When the seedlings grew to the six-leaf stage, the photosynthetic indicators (net photosynthetic rate, stomatal conductance, intercellular CO2 concentration and transpiration rate) of each strain were measured using a photosynthetic meter (LI-COR6400XT portable photosynthetic measurement system). The results are shown in FIG. Figure 5 shown.

[0055] The experimental results showed that the loss of NtGLK function would reduce the photosynthetic capacity of tobacco, while overexpression of NtGLK could improve the photosynthetic capacity of tobacco, indicating that NtGLK can significantly improve the photosynthetic capacity of tobacco.

[0056] Example 3

[0057] The overexpression transgenic tobacco lines (OE#3, #13 and #15) of Example 1, the wild-type tobacco of Comparative Example 1 and the knockout transgenic tobacco lines (CRISPR#9 and #13) of Comparative Example 2 were tested for drought stress resistance. When the seedlings grew to the six-leaf stage, the tobacco seedlings, which were about 30 days old, were subjected to natural drought treatment for 10 days. The control conditions for the drought stress resistance test were the overexpression transgenic tobacco lines (OE#3, #13 and #15) of Example 1, the wild-type tobacco of Comparative Example 1 and the knockout transgenic tobacco lines (CRISPR#9 and #13) of Comparative Example 2 under normal planting conditions (normal watering). The results are shown in Figure 2. Figure 6 As shown, under normal planting conditions, there is no significant difference between the overexpression transgenic tobacco strain of Example 1, the wild-type tobacco of Comparative Example 1, and the knockout transgenic strain of Comparative Example 2; Figure 7 As shown in Figure 1, after 10 days of natural drought treatment, compared with the wild-type tobacco in Example 1, the overexpression transgenic tobacco strain in Example 1 was significantly more drought-resistant, while the knockout transgenic tobacco strain in Example 2 was more sensitive to drought. In addition, an in vitro water loss rate experiment was conducted to determine the drought resistance of each strain. The results are shown in Figure 1. Figure 8 As shown in the figure, the knockout strains showed a faster water loss rate. The experimental results showed that the loss of NtGLK function would make tobacco sensitive to drought stress, and overexpression of NtGLK could improve tobacco's drought resistance, indicating that NtGLK plays an important role in tobacco's response to drought stress.

[0058] Example 4

[0059] Total protein of wild-type tobacco (K326 tobacco seedlings) plants in Comparative Example 1 at 0h and 24h was extracted, and three biological replicates were performed at each time point:

[0060] Using antibodies, we detected the expression of NtGLK protein and found that low temperature stress strongly induced NtGLK protein. Compared with the control (0h), the expression level of NtGLK protein in low temperature stressed tobacco (24h) was upregulated by about 11 times ( Fig. 9 ).

[0061] The protein was subjected to phosphorylation modification signal detection. No phosphorylation modification of NtGLK protein was detected under control conditions (0h), but it was identified to be phosphorylated after 24h of cold stress, and the phosphorylation abundance value was high ( Fig.10 ). The phosphorylation level was significantly induced by cold stress, indicating that the phosphorylation modification level of tobacco NtGLK protein plays an important role in resistance to cold stress.

[0062] Example 5

[0063] The tobacco of overexpression transgenic strains (OE#3, #13 and #15) of Example 1, wild-type tobacco of Comparative Example 1 and knockout transgenic strains (CRISPR#9 and #13) of Comparative Example 2 were tested for cold stress resistance. When the seedlings grew to three leaves and one heart, the tobacco seedlings, which were about 30 days old, were subjected to cold stress (4°C) for 13 days. The results are shown in Figure 2. Fig.11 As shown, under normal planting conditions, there is no significant difference between the overexpression transgenic tobacco strain of Example 1, the wild-type tobacco of Comparative Example 1, and the knockout transgenic strain of Comparative Example 2; Fig.12 As shown, after 13 days of cold stress treatment and recovery at normal temperature (28°C) for 2 days, compared with the wild-type tobacco in Example 1, the leaves of the overexpression transgenic tobacco line in Example 1 were not obviously frozen, and the phenotype was more cold-resistant, while the leaves of the knockout transgenic tobacco line in Example 2 were obviously frozen, and therefore more sensitive to low temperatures.

[0064] In addition, the relative conductivity of the control (0 h) and 24 h low temperature treated samples was measured. Fig.13 As shown in the figure, there was no significant difference in the relative conductivity between the strains before cold stress, but after cold stress, the relative conductivity between the strains increased to varying degrees, among which the knockout strain was significantly higher than the wild type. The experimental results showed that the loss of NtGLK function would make tobacco sensitive to cold stress, and overexpression of NtGLK could improve the cold resistance of tobacco, indicating that NtGLK plays an important role in tobacco's response to cold stress.

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention.

Claims

1. A method for improving drought stress resistance of tobacco plants, the method comprising overexpressing a DNA molecule having a nucleotide sequence as shown in SEQ ID NO. 2 in tobacco plants by transgenic means.

2. A method for improving the low temperature stress resistance of tobacco plants, the method comprising overexpressing a DNA molecule having a nucleotide sequence as shown in SEQ ID NO. 2 in tobacco plants by transgenic means.

3. The method according to claim 1 or 2, characterized in that: In the process of constructing the recombinant vector, an enhancing, constitutive, tissue-specific and / or inducible promoter is added before the transcription start nucleotide, or the stop codon is removed.

4. The method according to claim 1 or 2, characterized in that: In the process of constructing recombinant vectors, enhancers are used.

5. The method according to claim 1 or 2, characterized in that: In the process of constructing the recombinant vector, a gene expressing an enzyme or a luminescent compound that produces a color change in the plant, an antibiotic marker having resistance, or a chemical agent resistance marker gene is added.

Images