A kit and method for detecting mutations in the NRAS gene
By combining CRISPR/Cas12a with RPA isothermal amplification, specific crRNA and primer pairs were designed to solve the problems of complexity and low accuracy in existing NRAS p.G12V mutation detection, achieving efficient and simple NRAS p.G12V mutation detection with a sensitivity of 10-17M and high specificity.
Patent Information
- Application Number
- CN202411130072.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-16
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2044-08-16
AI Technical Summary
Existing NRAS p.G12V mutation detection methods are complex to operate, expensive to use, have long detection cycles, and low accuracy, making it difficult to efficiently and easily detect low-abundance mutation samples.
By combining CRISPR/Cas12a technology with RPA isothermal amplification, and designing specific crRNA and primer pairs, we can achieve efficient detection of NRAS p.G12V mutations. By performing RPA amplification and Cas cleavage in the same tube, combined with single-stranded DNA fluorescent probes, the results can be observed with the naked eye.
It achieves NRAS p.G12V mutation detection with simple operation, low cost, short detection cycle, high sensitivity and strong specificity, and can detect low abundance mutations of 10-17M, accurately distinguishing between wild type and mutant type.
Smart Images

Figure CN118745469B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene mutation detection technology, specifically relating to a kit and detection method for detecting NRAS gene mutations. Background Technology
[0002] The NRAS gene belongs to the RAS family of proto-oncogenes and encodes the N-Ras protein. It participates in regulating the activity of downstream proteins RAF and PI3K, playing a crucial role in the EGFR-RAS-RAF-MEK-ERK and PI3K-AKT-mTOR signaling pathways. The NRAS gene also plays an important role in life processes such as cell proliferation, migration, and differentiation. When the NRAS gene undergoes gain-of-function mutations, it continuously activates its downstream pathways, leading to uncontrolled cell proliferation and ultimately tumorigenesis. In hematologic malignancies, according to the COSMIC database, NRAS mutations are found in 23.1% of JMML, 9.1-16.0% of ALL, 9.5-13.2% of AML, 12.3% of CMML, and approximately 5% of MDS, and are rarely seen in other myeloid tumors (<5%). In MDS, especially in low-risk MDS patients, NRAS mutations are associated with poor prognosis. In adult AML, mutations are seen in CBFB-MYH11, CEBPA double mutations, GATA2, MECOM, MLLt(x;11), NPM1, and spliceosomal subtypes, but have no significant impact on clinical outcomes. In pediatric AML patients, NRAS gene mutations suggest a worse prognosis. NRAS p.G12V (c.35G>T) is a hotspot mutation with strong clinical significance.
[0003] Currently, common methods for detecting NRAS p.G12V mutations include first-generation / second-generation sequencing, allele-based PCR (AS-PCR), and quantitative real-time PCR. Sequencing methods suffer from drawbacks such as operational complexity, expensive equipment, long detection cycles, and the need for specialized personnel training. Compared to sequencing, AS-PCR electrophoresis offers a shorter detection cycle; however, this method, relying on electrophoresis, can easily lead to misinterpretations in samples with low mutation levels. Traditional real-time quantitative PCR depends on reference materials or standards, and in practice, inhibitors in nucleic acid samples or environmental factors can significantly interfere with the detection, reducing its accuracy. Therefore, a simple, short-cycle, highly sensitive, and highly specific method for detecting NRAS p.G12V mutations is needed. Summary of the Invention
[0004] The purpose of this invention is to provide a kit for detecting NRASp.G12V mutations that is simple to operate, has a short detection cycle, and is highly sensitive and specific.
[0005] The following technical solutions are used to achieve the above objectives.
[0006] The first aspect of the present invention provides a kit for detecting NRAS gene mutations, the kit comprising amplification reagents and CRISPR / Cas12a cleavage reaction reagents;
[0007] The amplification reagent includes primer pairs for RPA isothermal amplification of the NRAS p.G12V mutant gene;
[0008] The CRISPR / Cas12a cleavage reaction reagent includes crRNA, Cas12a protein, and a single-stranded DNA fluorescent probe; wherein the sequence of the crRNA is shown in SEQ ID NO:6.
[0009] In some embodiments, the primer pair includes a forward primer with a sequence as shown in SEQ ID NO:9 and a reverse primer with a sequence as shown in SEQ ID NO:12.
[0010] In some embodiments, the single-stranded DNA fluorescent probe is a single-stranded DNA with a fluorescent group attached to the 5' end and a quencher group attached to the 3' end, and the nucleotide sequence of the single-stranded DNA is 5-15 random bases.
[0011] In some embodiments, the fluorescent group is one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE, and Texas Red, and the quenching group is one of TAMRA, DABCYL, MGB, BHQ-1, BHQ-2, and BHQ-3.
[0012] In some embodiments, the working concentration of the forward primer is 200 nM to 300 nM, and the working concentration of the reverse primer is 200 nM to 300 nM; preferably, the working concentration of the forward primer is 240 nM to 260 nM, and the working concentration of the reverse primer is 240 nM to 260 nM.
[0013] In some embodiments, the working concentration of the crRNA is 40 nM to 400 nM; preferably, the working concentration of the crRNA is 40 nM to 100 nM; more preferably, the working concentration of the crRNA is 40 nM to 80 nM.
[0014] In some embodiments, the working concentration of the Cas12a protein is 20 nM to 200 nM; preferably, the working concentration of the Cas12a protein is 20 nM to 100 nM; more preferably, the working concentration of the Cas12a protein is 20 nM to 40 nM.
[0015] In some embodiments, the working concentration of the single-stranded DNA fluorescent probe is 500 nM to 1000 nM; preferably, the working concentration of the single-stranded DNA fluorescent probe is 780 nM to 820 nM.
[0016] In some embodiments, the molar ratio of the Cas12a protein to the crRNA is 1:2 to 3.
[0017] A second aspect of the present invention provides the application of the kit for detecting NRAS gene mutations as described above in the preparation of tumor detection products; specifically, the tumor is a hematologic malignancy.
[0018] A third aspect of the present invention provides a method for detecting NRAS gene mutations, the method comprising the following steps:
[0019] Preparation of amplification reagent system: Mix primer pairs, isothermal reaction lyophilized powder, buffer solution and nuclease-free water to obtain the amplification reagent system;
[0020] Preparation of CRISPR / Cas12a cleavage reaction reagent system: crRNA, Cas12a protein, single-stranded DNA fluorescent probe and RNase inhibitor were added to buffer to obtain the CRISPR / Cas12a cleavage reaction reagent system.
[0021] The obtained amplification reagent system and the CRISPR / Cas12a shearing reaction reagent system were mixed to obtain a mixed reaction system;
[0022] The sample to be tested, the mixed reaction system and the activator are mixed, centrifuged and incubated to obtain the reaction product, and the obtained reaction product is detected by fluorescence detection.
[0023] In some embodiments, the activator is a magnesium acetate solution, and the working concentration of the magnesium acetate solution is 15 mM to 25 mM.
[0024] This invention provides a kit that combines CRISPR / Cas12a technology and RPA technology for detecting NRAS mutant genes. Specifically, it uses a designed crRNA targeting the NRAS p.G12V mutation combined with RPA isothermal amplification technology to detect the NRAS p.G12V mutation. This allows RPA amplification and Cas cleavage to occur in the same tube, and the results can be observed visually. This kit effectively distinguishes between wild-type and mutant genes, with a detection limit as low as 10. -17 M can detect low-abundance mutant samples with a mutation frequency of 0.1%, and features simple operation, low cost, short testing cycle, high sensitivity, and strong specificity. Attached Figure Description
[0025] Figure 1This image shows the results of agarose gel electrophoresis detection of amplification products obtained by pre-amplifying the NRAS p.G12V site region with different RPA isothermal amplification primers.
[0026] Figure 2 The images show the fluorescence results of three crRNAs in the WT and MT groups for detecting the NRAS p.G12V mutation.
[0027] Figure 3 The image shows the results of detecting the NRAS p.G12V mutation using three crRNAs in the WT and MT groups under blue light.
[0028] Figure 4 This is a graph showing the fluorescence results of crRNA-W detection of different concentrations of NRAS(p.G12V) wild-type linearized plasmids.
[0029] Figure 5 This is a graph showing the fluorescence results of crRNA-M detection of different concentrations of NRAS(p.G12V) mutant linearized plasmids.
[0030] Figure 6 The crRNA-M assay detected a MT concentration of 10 in a mixed plasmid of wild-type and mutant NRAS (p.G12V). -17 Fluorescence detection results of M.
[0031] Figure 7 The crRNA-M assay detected a MT concentration of 10 in a mixed plasmid of wild-type and mutant NRAS (p.G12V). -15 Fluorescence detection results of M.
[0032] Figure 8 The crRNA-M assay detected a MT concentration of 10 in a mixed plasmid of wild-type and mutant NRAS (p.G12V). -13 Fluorescence detection results of M.
[0033] Figure 9 The crRNA-M assay detected a MT concentration of 10 in a mixed plasmid of wild-type and mutant NRAS (p.G12V). -11 Fluorescence detection results of M.
[0034] Figure 10 This is a graph showing the results of crRNA-M detection of a mixed plasmid of wild-type and mutant NRAS(p.G12V) under blue light.
[0035] Figure 11 This is a graph showing the fluorescence detection results of a clinical sample.
[0036] Figure 12 This is a diagram showing the results of observing clinical samples under blue light. Detailed Implementation
[0037] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0038] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0039] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0040] This invention provides a kit that combines CRISPR / Cas12a technology and RPA technology for detecting NRAS mutant genes. The kit uses specifically designed crRNA targeting the NRAS p.G12V mutation and RPA amplification primers to detect the NRAS p.G12V mutation, allowing RPA amplification and Cas cleavage to occur in the same tube. The results are visually observable, enabling efficient differentiation between wild-type and mutant genes, with a detection limit as low as 10. -17 M can detect low-abundance mutant samples with a mutation frequency of 0.1%, and features simple operation, low cost, short testing cycle, high sensitivity, and strong specificity.
[0041] The kit for detecting NRAS gene mutations includes amplification reagents and CRISPR / Cas12a cleavage reaction reagents.
[0042] The amplification reagent includes primer pairs for RPA isothermal amplification of the NRAS p.G12V mutant gene;
[0043] The CRISPR / Cas12a cleavage reaction reagent includes crRNA, Cas12a protein, and a single-stranded DNA fluorescent probe; wherein the sequence of the crRNA is shown in SEQ ID NO:6.
[0044] In some embodiments, the primer pair includes a forward primer with a sequence as shown in SEQ ID NO:9 and a reverse primer with a sequence as shown in SEQ ID NO:12.
[0045] The present invention will now be described in conjunction with specific embodiments.
[0046] Example 1
[0047] 1. Synthesis of target recombinant plasmids
[0048] Based on the NCBI database, the NRAS gene sequence was located, and the mutation site was identified. Sangon Biotech Co., Ltd. synthesized plasmids containing both wild-type and mutant gene fragments of NRAS (p.G12V). The gene fragment sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.
[0049] NRAS1(WT, SEQ ID NO:1)
[0050] 5′-ctccagaagtgtgaggccgatattaatccggtgtttttgcgttctctagtcactttaagaaccaaatggaaggtc acactagggttttcatttccattgattatagaaagctttaaagtactgtagatgtggctcgccaattaaccctgattactggtttccaacaggttcttgctggtgtg aaatgactgagtacaaactggtggtggttggagcagGtggtgttgggaaaagcgcactgacaatccagctaatccagaaccactttgtagatgaatatgatcccacc atagaggtgaggcccagtggtagcccgctgacctgatcctgtctctcacttgtcggatcatctttacccatattctgtattaaaggaataagaggagagaaagtaaa aagttattttgggtatacattcagttatgcaataagcttaacgtgtttatagagaacagttcatttttattagctgctgaagtttctaaaacctgtccagtttt-3′.
[0051] NRAS2(MT, SEQ ID NO:2)
[0052] 5′-ctccagaagtgtgaggccgatattaatccggtgtttttgcgttctctagtcactttaagaaccaaatggaaggtc acactagggttttcatttccattgattatagaaagctttaaagtactgtagatgtggctcgccaattaaccctgattactggtttccaacaggttcttgctggtgtg aaatgactgagtacaaactggtggtggttggagcagTtggtgttgggaaaagcgcactgacaatccagctaatccagaaccactttgtagatgaatatgatcccacc atagaggtgaggcccagtggtagcccgctgacctgatcctgtctctcacttgtcggatcatctttacccatattctgtattaaaggaataagaggagagaaagtaaa aagttattttgggtatacattcagttatgcaataagcttaacgtgtttatagagaacagttcatttttattagctgctgaagtttctaaaacctgtccagtttt-3′.
[0053] 2. Design of NRAS wild-type and mutant sequence crRNAs
[0054] (1) Three crRNA sequences were designed to identify wild-type and mutant types for the gene sequence of NRAS (p.G12V) mutation site. The crRNAs have an introduced mismatch base, and the sequences are shown in Table 1 as SEQ ID NO:3-8.
[0055] Table 1 shows the sequence of crRNA.
[0056]
[0057] (2) In vitro transcription of crRNA: The crRNA expression plasmid was synthesized using conventional methods. The crRNA transcription template was obtained by PCR amplification of the synthesized crRNA expression plasmid, followed by in vitro transcription and purification to obtain the crRNA required for detection.
[0058] The method for in vitro transcription of crRNA is as follows: react at 37°C for 16 hours in the following system: 1.5 μL each of NTPs, 1.5 μL of 10× Reactionbuffer, 1 μg of DNA template, 1.5 μL of T7 RNA Polymerase Mix, and Nuclease-free water to a final volume of 20 μL.
[0059] The purification method for crRNA transcripts is as follows: after treating the transcripts with DNase I (TaKaRa) for 15 min, the transcribed crRNA is purified using the NEBRNA Cleanup Kit.
[0060] (3) Design and Synthesis of Isothermal Amplification Primers: Isothermal amplification (RPA) primers were designed for the NRAS (p.G12V) site. Three sets of RPA amplification primers were designed, as shown in Table 2 below. These primers were used to amplify the WT template and BC template, respectively. The isothermal amplification reaction system included 10 μL of Abuffer, 500 nM Primer-F / R, and the template, with water added to a final volume of 20 μL. The mixture was incubated at 37°C for 30 min, followed by agarose gel electrophoresis. The results are shown below. Figure 1 As shown, Primer3 has two bands, indicating non-specific amplification, while Primer2 has only one band, but its brightness is low, indicating low amplification efficiency. Primer1 has a bright band, indicating high amplification efficiency. Therefore, Primer1 was selected for subsequent experiments.
[0061] Table 2 RPA amplification primer sequences
[0062] Primer Sequence SEQ ID NO:9 Forward primer1 GCCAATTAACCCTGATTACTGGTTTCCAAC SEQ ID NO:10 Forward primer2 ATTAACCCTGATTACTGGTTTCCAACAGGT SEQ ID NO:11 Forward primer3 TAACCCTGATTACTGGTTTCCAACAGGTTC SEQ ID NO:12 Reverse primer1 TCTATGGTGGGATCATATTCATCTACAAAGTG SEQ ID NO:13 Reverse primer2 TCTATGGTGGGATCATATTCATCTACAAAGT SEQ ID NO:14 Reverse primer3 CTCTATGGTGGGATCATATTCATCTACAAAGT
[0063] 4. Synthesize single-stranded DNA fluorescent probe FQ-ssDNAreporter
[0064] The fluorescent probe has a nucleotide sequence of 5-15 random bases. The 5' end of the probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quencher group BHQ-1.
[0065] 5. One-tube testing
[0066] Prepare the isothermal amplification reaction reagent system (component 1): Add 29.5 μL of Abuffer, 2 μL of 10 μM Primer-F, 2 μL of 10 μM Primer-R, and 14.1 μL of nuclease-free water to the isothermal amplification lyophilized powder, and mix thoroughly until the lyophilized powder is completely dissolved. Prepare the CRISPR / Cas12a cleavage reaction reagent system (component 2): Contain 20 nM LbaCas12a, 40 nM crRNA-W or crRNA-M, 800 nM single-stranded DNA fluorescent probe (5'-FAM, 3'-BHQ), 1 U RNase inhibitor (TaKaRa), and 1×NEBbuffer 2.1. The concentrations of each component in component 2 are the concentrations in the final reaction system. Mix components 1 and 2. The final 25 μL mixture contains 15 μL of component 1, 6 μL of component 2, 2 μL of nucleic acid sample, and 20 mM magnesium acetate solution. The reaction conditions were 37℃ for 60 min. Fluorescence values were read using QuantStudio 5, and the cells could be observed under a blue light after incubation.
[0067] 6. crRNA screening
[0068] The obtained WT-crRNA and MT-crRNA were used to detect MT template, WT template, and BC (blank control), respectively. A 25 μL reaction mixture contained 20 nM LbaCas12a, 40 nM WT crRNA (or MT crRNA), 800 nM single-stranded DNA fluorescent probes (5'-FAM, 3'-BHQ1), 10 U RNase inhibitor (TaKaRa), 5 nM linearized double-stranded DNA, and 1×NEBbuffer 2.1. The reaction conditions were 37℃ for 60 min, with continuous fluorescence collection during the reaction. The results are shown below. Figure 2 As shown, crRNA-W detected a gradually increasing fluorescence signal in the WT template, but no significant signal was detected in the MT template, with signal intensity close to that of BC. This indicates that crRNA-W can clearly distinguish between WT and MT templates. Similarly, crRNA-M detected a gradually increasing fluorescence signal in the MT template, but no significant signal was detected in the WT template, with signal intensity close to that of BC. This indicates that crRNA-M can clearly distinguish between WT and MT templates. After incubation, the results can be observed under blue light. Figure 3As shown, crRNA-W recognizes the WT template with a clear signal, but hardly recognizes the MT template, and shows no clear signal for BC. crRNA-M recognizes the MT template with a clear signal, but shows no clear signal for either the WT template or BC. Therefore, it can effectively distinguish between WT and MT templates. Comparing the three crRNAs in the WT and MT groups respectively, NRAS-WT-crRNA1-1 and NRAS-MT-crRNA1-1 showed high cleavage efficiency, achieving a clear signal in a short time and detecting low-frequency mutations, demonstrating excellent performance. Therefore, these two crRNAs were selected for the subsequent detection system.
[0069] Example 2 Sensitivity Detection
[0070] The NRAS(p.G12V) mutant and wild-type linearized plasmids were serially diluted 10-fold to a concentration of 10. -13 M~10 -18 M. The mixed reaction system prepared in Example 1 (containing NRAS-WT-crRNA1-1) was added to the NRAS(p.G12V) wild-type linearized plasmid template, and the mixed reaction system (containing NRAS-MT-crRNA1-1) was added to the NRAS(p.G12V) mutant linearized plasmid, followed by the addition of an activator. The mixture was incubated at 37°C for 1 hour, and the fluorescence values were read. The results are as follows: Figures 4-5 As shown, the detection sensitivity of wild-type crRNA-W can reach 10. -14 M( Figure 4 The detection sensitivity of mutant crRNA-M can reach 10. -17 M( Figure 5 ).
[0071] Example 3 Sensitivity Detection
[0072] This embodiment uses a mixed plasmid sample of wild-type and mutant NRAS(p.G12V) for detection. A certain concentration of MT template was taken and mixed with different amounts of WT template to obtain mixed samples containing MT:WT = 1:1, 1:10, 1:100, 1:1000, and 1:1000. The mixed sample was then added to the mixed reaction system prepared in Example 1 (the crRNA in the system was NRAS-MT-crRNA1-1) for detection.
[0073] The results showed that the MT concentration was 10. -17 At M, a 1:1 ratio (WT concentration of 10) can be detected. -16 Mixed samples of M) Figure 6 ). MT concentration is 10 -15 When M, a ratio of 1:10 can be detected (WT is 10). -13 Mixed samples of M) Figure 7); MT concentration is 10 -13 At M, a detection ratio of 1:1000 (WT is 10) can be achieved. -11 Mixed samples of M) Figure 8 ); MT concentration is 10 -11 At M, a detection ratio of 1:100 (WT is 10) can be achieved. -9 Mixed samples of M) Figure 9 In summary, this detection system can detect samples containing 0.1% mutations.
[0074] Example 4: Fluorescence Visualization Detection
[0075] This embodiment uses a mixed plasmid sample of wild-type and mutant NRAS(p.G12V) for detection. Take 10... -13 The MT template of M was mixed with different amounts of WT template to obtain mixed templates containing 1% mutation, mixed templates containing 0.1% mutation, and mixed templates containing 10% mutation. -13 The WT template of M was added to the mixed reaction system prepared in Example 1 (the crRNA in the system was NRAS-MT-crRNA1-1) for detection. After incubation, the images were taken under a blue light spectrometer. The results were observed visually as follows. Figure 10 As shown, samples with 1% mutations exhibited obvious fluorescent signals visible to the naked eye.
[0076] Example 5: Clinical Sample Testing
[0077] In this embodiment, bone marrow aspiration samples were collected from 10 patients (positive for NRAS (p.G12V) mutation) and 6 patients (negative for NRAS (p.G12V) mutation) at Yantai University Yuhuangding Hospital. Nucleic acid was extracted using conventional methods, and the next-generation sequencing results of the 16 samples are shown in Table 3. 100 ng of nucleic acid was added to the mixed reaction system prepared in Example 1 for detection. Fluorescence results were read using QuantStudio 5, and the results are as follows. Figure 11 As shown. Compared with the 6 negative samples, the 10 positive samples produced obvious fluorescence signals, and the positive and negative samples could be distinguished by visual observation under a blue light spectrometer, such as... Figure 12 As shown in the figure. The detection results of this method are consistent with those of next-generation sequencing.
[0078] Table 3. Next-generation sequencing results of clinical samples
[0079]
[0080]
[0081] In summary, detecting the NRAS p.G12V mutation using specific sequence crRNA and RPA isothermal amplification primers allows RPA amplification and Cas cleavage to react in the same tube, achieving a clear signal in a short time. The results are also visually observable, enabling efficient differentiation between wild-type and mutant strains, and detecting low-frequency mutations. The detection limit can reach as low as 10. - 17 M can detect low-abundance mutant samples with a mutation frequency of 0.1%.
[0082] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0083] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A kit for detecting NRAS p.G12V gene mutation, characterized in that, The kit comprises amplification reagents and CRISPR / Cas12a cleavage reaction reagents; The amplification reagents comprise a primer pair for isothermal amplification of the NRAS p.G12V mutant gene by RPA; The CRISPR / Cas12a cleavage reaction reagents comprise crRNA, Cas12a protein and single-stranded DNA fluorescent probe; wherein the sequence of the crRNA is shown as SEQ ID NO: 6; The primer pair comprises a forward primer with a sequence shown as SEQ ID NO: 9 and a reverse primer shown as SEQ ID NO: 12; The single-stranded DNA fluorescent probe is a single-stranded DNA with a fluorescent group connected to the 5' end and a quencher group connected to the 3' end, and the nucleotide sequence of the single-stranded DNA is 5-15 random bases.
2. The kit of claim 1, wherein The fluorescent group is one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red, and the quencher group is one of TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 and BHQ-3.
3. The kit of any one of claims 1-2, wherein, The working concentration of the forward primer is 200nM-300nM, and the working concentration of the reverse primer is 200nM-300nM.
4. The kit of any one of claim 3, wherein The working concentration of the forward primer is 240nM-260nM, and the working concentration of the reverse primer is 240nM-260nM.
5. The kit of any one of claims 1-2, wherein, The working concentration of the crRNA is 40nM-400nM.
6. The kit of claim 5, wherein The working concentration of the crRNA is 40nM-80nM.
7. The kit of any one of claims 1-2, wherein The working concentration of the Cas12a protein is 20nM-200nM.
8. The kit of any one of claim 7, wherein The working concentration of the Cas12a protein is 20nM-40nM.
9. The kit of any one of claims 1-2, wherein, The working concentration of the single-stranded DNA fluorescent probe is 500nM-1000nM.
10. The kit of claim 9, wherein The working concentration of the single-stranded DNA fluorescent probe is 780nM-820nM.
11. The kit of any one of claims 1-2, wherein, The molar ratio of the Cas12a protein to the crRNA is 1:2-3.
12. Use of the kit for detecting NRAS p.G12V gene mutation according to any one of claims 1-11 in the preparation of a product for detecting tumors.
Citation Information
Patent Citations
crRNA, detection kit and detection method for gene mutation of colon cancer related molecular marker
CN110894530A