Multiplex fluorescent PCR reaction system, kit and detection method for single-tube detection of mutations of multiple gene loci

Abstract

The invention belongs to the technical field of gene detection, and particularly relates to a multiple fluorescent PCR reaction system, a kit and a detection method for detecting mutation of multiple gene loci in a single tube. The invention provides a multiple fluorescent PCR reaction system for detecting mutation of a plurality of gene loci (especially 10 common mutation loci of G6PD genes in Chinese population, and the loci cover 98.5% or more of the mutation frequency of the G6PD genes in the Chinese population) by a one-tube method, and a kit comprising the reaction system. The reaction system and the kit can distinguish homozygous mutation, heterozygous mutation and wild type, and have the characteristics of high sensitivity (10 copies / reaction), simplicity in operation, low cost, high flux and the like. The genotypes of a plurality of gene loci of a sample can be detected only through one-time PCR amplification reaction and one-time melting curve analysis in the single-tube PCR reaction. Uncovering is not needed in the whole process, and the possibility of aerosol pollution is reduced.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a multiplex fluorescent PCR reaction system, kit, and detection method for single-tube detection of mutations at multiple gene loci. Background Technology

[0002] Glucose-6-phosphate dehydrogenase deficiency (G6PD deficiency) is a common X-linked incomplete dominant genetic disorder, primarily caused by mutations in the G6PD gene leading to reduced G6PD protease activity. G6PD gene mutations are predominantly missense mutations involving single base substitutions. More than 40 mutation types have been reported in the Chinese population, with c.1376 G>T, c.1388 G>A, c.95 A>G, c.871 G>A, and c.1024 C>T accounting for approximately 95%; c.392 G>T, c.487 G>A, c.517 T>C, c.592 C>T, and c.1004 C>A accounting for approximately 3.5%; other types are sporadic. Most patients do not exhibit significant differences in their daily lives compared to healthy individuals, only developing corresponding clinical symptoms under certain triggering conditions. Therefore, avoiding relevant triggers and receiving timely treatment can greatly protect patients' quality of life and health, necessitating reliable and effective diagnostic methods for G6PD deficiency.

[0003] Currently, clinical diagnostic methods for G6PD deficiency can be mainly divided into biochemical detection methods and molecular biological detection methods.

[0004] Biochemical testing methods primarily screen for potential carriers or patients by measuring G6PD enzyme activity. This method is inexpensive and commonly used in traditional diagnosis. However, it has certain limitations. First, it cannot determine the specific gene mutation site; second, it cannot accurately detect heterozygous female patients, leading to missed diagnoses; and third, this method is highly susceptible to interference from laboratory environment and operator technique, resulting in poor quality control.

[0005] Currently, the diagnosis of G6PD deficiency is increasingly shifting towards molecular biology testing methods. Common methods include multicolor melting curve analysis (MMCA), gene chip technology, PCR-SSCP, Sanger sequencing, and high-throughput sequencing. Compared to biochemical testing methods, these methods can better address the issue of heterozygote detection and identify mutation sites. However, each detection technique also has its own limitations. For example, MMCA requires the design of a large number of target sequence-specific fluorescent probes, leading to increased fluorescence background and probe synthesis costs; gene chip technology products are expensive; PCR-SSCP technology is complex to operate, has poor reproducibility, and struggles to accurately locate mutation sites; Sanger sequencing and high-throughput sequencing technologies have expensive equipment and lengthy procedures, hindering their clinical application. Summary of the Invention

[0006] The purpose of this invention is to supplement existing detection technologies by providing a low-cost, rapid, and single-tube method for detecting ten high-frequency mutation sites (c.1376 G>T, c.1388 G>A, c.95A>G, c.871 G>A, c.1024 C>T, c.392 G>T, c.487 G>A, c.517 T>C, c.592 C>T, c.1004 C>A) in the Chinese population using fluorescent PCR.

[0007] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a multiplex fluorescent PCR reaction system for detecting mutations at multiple gene loci in a single tube, the reaction system comprising: (1) Primer set used to amplify the gene locus to be tested; (2) MP probe set that specifically recognizes mutant gene sites and corresponding wild-type gene sites; (3) A general probe set containing specific berth sequences; The primer set includes an upstream primer located upstream of the gene locus to be tested and a downstream primer located downstream of the gene locus to be tested. The MP probe includes a mediator subsequence at the 5' end and a complementary sequence to the recognition site at the 3' end. The universal probe contains a fluorescent group and a quenching group; During PCR amplification, the MP probe hybridizes with the corresponding recognition site and is cleaved by polymerase extension, releasing the mediator sequence corresponding to each recognition site (preferably one-to-one). The mediator sequence pairs with and extends a specific mooring sequence on a universal probe to form a fluorescent double-stranded DNA product with a specific melting temperature (Tm value). By analyzing the melting curve of the fluorescent double-stranded DNA product, the genotype of each gene locus can be determined based on the combination characteristics of the fluorescence signal and the Tm value.

[0008] In a preferred embodiment, the multiplex fluorescent PCR reaction system is used to detect common mutation sites in the glucose-6-phosphate dehydrogenase (G6PD) gene in the Chinese population.

[0009] Therefore, in some embodiments, the plurality of gene loci include ten high-frequency mutation sites of the G6PD gene in the Chinese population: cDNA1376, cDNA1388, cDNA95, cDNA871, cDNA1024, cDNA392, cDNA487, cDNA517, cDNA592, and cDNA1004.

[0010] In some implementations, the primer set includes: The upstream primer F1 and the downstream primer R1 used to amplify the mutant site cDNA95, the sequence of F1 is shown in SEQ ID NO: 1, and the sequence of R1 is shown in SEQ ID NO: 2; The upstream primer F2 and the downstream primer R2 used to amplify the mutant site cDNA392, the sequence of F2 is shown in SEQ ID NO: 3, and the sequence of R2 is shown in SEQ ID NO: 4; The upstream primer F3 and the downstream primer R3 are used to amplify the mutant sites cDNA487, cDNA517, and cDNA592. The sequence of F3 is shown in SEQ ID NO: 5, and the sequence of R3 is shown in SEQ ID NO: 6. The upstream primer F4 and the downstream primer R4 are used to amplify the mutant sites cDNA871, cDNA1004, and cDNA1024. The sequence of F4 is shown in SEQ ID NO: 7, and the sequence of R4 is shown in SEQ ID NO: 8. The upstream primer F5 and the downstream primer R5 used to amplify the mutant sites cDNA1376 and cDNA1388 are shown in SEQ ID NO: 9 and the sequence of R5 is shown in SEQ ID NO: 10.

[0011] In some implementations, the MP probe set includes: The probe MP1 specifically recognizes the wild-type site 95A, and the sequence of MP1 is shown in SEQ ID NO: 11; The probe MP2 specifically recognizes the mutation site A95G, and the sequence of MP2 is shown in SEQ ID NO: 12; The probe MP3 specifically recognizes the wild-type site 392G, and the sequence of MP3 is shown in SEQ ID NO: 13; The probe MP4 specifically recognizes the mutation site G392T, and the sequence of MP4 is shown in SEQ ID NO: 14; The probe MP5 specifically recognizes the wild-type site 487G, and the sequence of MP5 is shown in SEQ ID NO: 15; The probe MP6 specifically recognizes the mutation site G487A, the sequence of which is shown in SEQ ID NO: 16; The probe MP7 specifically recognizes the wild-type site 517T, and the sequence of MP7 is shown in SEQ ID NO: 17; The probe MP8 specifically recognizes the mutation site T517C, and the sequence of MP8 is shown in SEQ ID NO: 18; The probe MP9 specifically recognizes the wild-type site 592C, and the sequence of MP9 is shown in SEQ ID NO: 19; The probe MP10 specifically recognizes the mutation site C592T, and the sequence of MP10 is shown in SEQ ID NO: 20; The probe MP11 specifically recognizes the wild-type site 871G, and the sequence of MP11 is shown in SEQ ID NO: 21; The probe MP12 specifically recognizes the mutation site G871A, and the sequence of MP12 is shown in SEQ ID NO: 22; The probe MP13 specifically recognizes the wild-type site 1004C, and the sequence of MP13 is shown in SEQ ID NO: 23; The probe MP14 specifically recognizes the mutation site C1004A, and the sequence of MP14 is shown in SEQ ID NO: 24; The probe MP15 specifically recognizes the wild-type site 1024C, and the sequence of MP15 is shown in SEQ ID NO: 25; The probe MP16 specifically recognizes the mutation site C1024T, and the sequence of MP16 is shown in SEQ ID NO: 26; The probe MP17 specifically recognizes the wild-type site 1376G, and the sequence of MP17 is shown in SEQ ID NO: 27; The probe MP18 specifically recognizes the mutation site G1376T, and the sequence of MP18 is shown in SEQ ID NO: 28; The probe MP19 specifically recognizes the wild-type site 1388G, and the sequence of MP19 is shown in SEQ ID NO: 29; The probe MP20 specifically recognizes the mutation site G1388A, and the sequence of MP20 is shown in SEQ ID NO: 30.

[0012] Those skilled in the art will understand that by changing the target sequence of the MP probe, it is possible to adapt it to the detection of other gene mutation sites. Therefore, the MP PCR design used in the reaction system and kit of the present invention has great potential for expansion.

[0013] In some embodiments, the universal probe comprises a fluorescent group and a quenching group, wherein the fluorescent group includes, but is not limited to, any one or more of FAM, HEX, ROX, and CY5; and the quenching group includes, but is not limited to, any one or more of BHQ1, BHQ2, and BHQ3.

[0014] When the universal probe is complementary to its corresponding mediator sequence and extends, the fluorescent group and quenching group on it separate, causing the extended double-stranded DNA product to fluoresce.

[0015] In embodiments of the present invention, double-stranded DNA products formed by pairing and extending universal probes containing the same fluorescent group with different mediator sequences have different Tm values, which allows for the detection of mutations at multiple gene sites by combining fluorescence signals with Tm values.

[0016] In some implementations, the universal probe set includes: The universal probe P1 contains the FAM fluorescent group and contains the station sequences corresponding to probes MP3, MP4, and MP17; The universal probe P2 contains the FAM fluorescent group and includes the station sequences corresponding to probes MP9, MP19, and MP20; The universal probe P3 contains the Cy5 fluorescent group and contains the station sequences corresponding to probes MP1, MP2, MP6, and MP14. The universal probe P4 contains the Cy5 fluorescent group and includes the station sequences corresponding to probes MP7, MP8, and MP13; The universal probe P5 contains the ROX fluorescent group and includes the station sequences corresponding to probes MP5, MP12, and MP18; The universal probe P6 contains the ROX fluorescent group and includes the station sequences corresponding to probes MP11, MP15, and MP16. The universal probe P7 contains the HEX fluorescent group and includes the poise sequence corresponding to probe MP10.

[0017] In some implementations, the fluorescent double-stranded DNA products corresponding to probes MP3, MP4, MP17, MP9, MP19, and MP20 have different Tm values ​​from each other; The fluorescent double-stranded DNA products corresponding to probes MP1, MP2, MP6, MP14, MP7, MP8, and MP13 have different Tm values. The fluorescent double-stranded DNA products corresponding to probes MP5, MP12, MP18, MP11, MP15, and MP16 have different Tm values.

[0018] As used herein, the specific sequences of the mediator sequence and the mooring sequence can be conventionally designed by those skilled in the art according to actual needs, as long as the double-stranded DNA products formed by pairing and extending a universal probe containing the same fluorescent group with different mediator sequences have different Tm values.

[0019] In some embodiments, the multiplex fluorescent PCR reaction system further includes an intrusion probe 1 and an intrusion probe 2 for auxiliary signal enhancement, the sequence of the intrusion probe 1 being shown in SEQ ID NO: 31 and the sequence of the intrusion probe 2 being shown in SEQ ID NO: 32.

[0020] In some embodiments, the multiplex fluorescent PCR reaction system further includes a reaction buffer, dNTPs, and DNA polymerase.

[0021] In a second aspect, the present invention provides a kit for detecting mutations at multiple gene sites using a single-tube method, the kit comprising a multiplex fluorescent PCR reaction system as described herein.

[0022] In a third aspect, the present invention provides a method for detecting mutations at multiple gene loci using a multiplex fluorescent PCR reaction system or kit as described herein, characterized by comprising the following steps: (1) Extract genomic DNA from the sample to be tested; (2) The genomic DNA was amplified by multiplex PCR using the multiplex fluorescent PCR reaction system as described herein, wherein MP probe cleavage, mediator release and universal probe extension reaction were completed during the amplification process; (3) Perform melting curve analysis on the reaction products; (4) Determine the genotype of the multiple gene loci based on the obtained fluorescence signal and Tm value combination.

[0023] In a preferred embodiment, the method is used to detect common mutation sites of the G6PD gene in the Chinese population, such as ten high-frequency mutation sites of the G6PD gene in the Chinese population: cDNA1376, cDNA1388, cDNA95, cDNA871, cDNA1024, cDNA392, cDNA487, cDNA517, cDNA592, and cDNA1004.

[0024] Beneficial effects of the present invention 1. Simple and convenient operation: This invention is a single-tube PCR detection system that can simultaneously detect multiple samples in each reaction. Genotyping of samples can be completed through PCR amplification and melting curve analysis. The entire operation can be completed in about 3 hours. The detection only requires a fluorescence PCR instrument and basic equipment, with few operational steps.

[0025] 2. Multiple detection sites and high mutation coverage: This invention can simultaneously detect mutations at 10 sites of the G6PD gene and can distinguish between homozygous mutations, heterozygous mutations and wild-type mutations. The mutation coverage of these 10 sites in the Chinese population is about 98.5%.

[0026] 3. High detection sensitivity, strong stability, good specificity, and easy interpretation of results: This invention uses MP PCR and melting curve analysis technology to identify mutations by the presence or absence of melting peaks. The sensitivity can reach 10 copies / reaction. The Tm value of the melting peak corresponding to the same site is stable, the detection results are obvious, and the interpretation is not prone to errors.

[0027] 4. Low detection cost and strong scalability: This experiment adopts a universal fluorescent probe design, which eliminates the need to design specific fluorescent probes for each detection site, thus saving the cost of fluorescent probe synthesis; the MP probe can be divided into a mediator part and a target sequence binding part. By changing only the target sequence binding part, it can be used to detect other gene sites. The system has good scalability and reduces the development and design costs of other kits. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of the detection results of the detection system of the present invention on the FAM channel for four wild-type loci: 1376G, 392G, 1388G, and 592C.

[0029] Figure 2 This is a schematic diagram of the detection results of the detection system of the present invention for the three wild-type sites 487G, 1024C, and 871G on the ROX channel.

[0030] Figure 3 This is a schematic diagram of the detection results of the detection system of the present invention on the Cy5 channel for the three wild-type sites 95A, 517T, and 1004C.

[0031] Figure 4 This is a schematic diagram of the detection results of the detection system of the present invention on the HEX channel for wild-type genome samples.

[0032] Figure 5 This is a schematic diagram of the detection results of the detection system of the present invention for the two mutant sites 392T and 1388A on the FAM channel.

[0033] Figure 6 This is a schematic diagram of the detection results of the detection system of the present invention on the ROX channel for the three mutant sites of 1376T, 871A and 1024T.

[0034] Figure 7 This is a schematic diagram of the detection results of the detection system of the present invention on the Cy5 channel for four mutant sites: 487A, 1004A, 95G, and 517C.

[0035] Figure 8 This is a schematic diagram of the detection results of the detection system of the present invention targeting the 592T mutant site on the HEX channel. Detailed Implementation

[0036] In some embodiments, this invention relates to a multiplex fluorescent PCR reaction system and kit applicable to ten high-frequency mutation sites of the G6PD gene in the Chinese population. This invention employs the principle of MP-PCR melting array. First, common mutation sites of the G6PD gene are amplified using amplification primers. As the primers extend on the template, the MP probes bound to the detection sites are cleaved, releasing specific mediator sequences. These mediator sequences pair with specific sites on corresponding universal probes and extend, producing fluorescent double-stranded DNA of a certain length. Analysis of the melting curve yields specific combinations of fluorescence color and Tm values, allowing for the identification of the genotype at the corresponding sites.

[0037] In one specific embodiment, the multiplex fluorescent PCR reaction system and kit of the present invention include: (1) Primers for amplifying 10 G6PD gene loci, a total of five pairs, Among them, the F1 and R1 amplification gene locus c.95 (common mutation is A>G). Among them, the F2 and R2 amplification gene site c.392 (common mutation is G>T). Among them, the F3 and R3 amplification gene sites are c.487 (common mutation is G>A), c.517 (common mutation is T>C), and c.592 (common mutation is C>T). Among them, the F4 and R4 amplification gene sites are c.871 (common mutation is G>A), c.1004 (common mutation is C>A), and c.1024 (common mutation is C>T). Among them, F5 and R5 amplify two mutation sites c. 1376 (common mutation is G>T) and c. 1388 (common mutation is G>A). The sequences of each primer are shown in Table 1.

[0038] Table 1: Primers used for amplifying 10 G6PD gene loci Serial Number Primer name Primer sequence (5' → 3') SEQ ID NO1 F1 CGATGCCTTCCATCAGTC SEQ ID NO2 R1 CTGGGAGATACTCACCGA SEQ ID NO3 F2 GCTGGAGGACTTCTTTGC SEQ ID NO4 R2 GTGAATGTTCTTGGTGACG SEQ ID NO5 F3 AGGGCGTCTGAATGATG SEQ ID NO6 R3 GGTGAGGCTCCTGAGT SEQ ID NO7 F4 AACTCAACACCCAAGGA SEQ ID NO8 R4 CCAGTTCTGCCTTGCT SEQ ID NO9 F5 AGTGGCATCAGCAAGAC SEQ ID NO10 R5 CTTTCCTCACCTGCCAT (2) MP probes were used to detect 10 common mutation sites of the G6PD gene. Each site was divided into wild-type probes and mutant probes, for a total of 10 pairs. The 3' end of each MP probe was modified with amino groups.

[0039] Table 2: Exemplary MP Probes Wild-type probe mutant probes WMP95A MMP95G WMP392G MMP392T WMP487G MMP487A WMP517T MMP517C WMP592C MMP592T WMP871G MMP871A WMP1004C MMP1004A WMP1024C MMP1024T WMP1376G MMP1376T WMP1388G MMP1388A The sequences of the MP probes are shown in Table 3.

[0040] Table 3: Sequence information of MP probes Serial Number Probe Name Probe sequence (5' → 3') SEQ ID NO11 WMP95A ATTCTTGGGCACACATATTCATCATCATGGGTG SEQ ID NO12 MMP95G CGCGTCTGTACACGCATATTCATCATCATGG SEQ ID NO13 WMP392G TCACTCTGATCTGGGGTCACAGGCCAA SEQ ID NO14 MMP392T CTGTCTCCTCACCTGGTGTCACAGGCC SEQ ID NO15 WMP487G CCTCTCACAAACGGTTCCAGCCTCTGCT SEQ ID NO16 MMP487A CTGTCTATTCTTGCTTCTGCTGGGAGCCC SEQ ID NO17 WMP517T GACAGTGCTGCGAAGGGCTTCTCCACGA SEQ ID NO18 MMP517C GTGCTGGCTGACGAGGGGCTTCTCCACG SEQ ID NO19 WMP592C TGCCGTGCTCACCGCATCGACCACCTACC SEQ ID NO20 MMP592T CTCACAAACTTACCGCATCGACCACCTACC SEQ ID NO21 WMP871G GCCTGCTGCGCTTTCTCTCAGGTCAAGGTG SEQ ID NO22 MMP871A GAGCTCATCACAAAGTGTGAAATGCATCTCAGA SEQ ID NO23 WMP1004C ACCTGGGACCTGGCGGTGGTGGACCC SEQ ID NO24 MMP1004A TACTCTCTGACTGTGTCGGTGGTGGACCC SEQ ID NO25 WMP1024C GAGACGTGGGCCGTCGTCCTCTATGTGG SEQ ID NO26 MMP1024T GTCCACACTGTCGTGTCGTTCTATGTGGAG SEQ ID NO27 WMP1376G ATCTGTTTGCTCACGGAGCTCGTCGCT SEQ ID NO28 MMP1376T TCACACCTCTCACAAGGAGCTCGTCGCT SEQ ID NO29 WMP1388G TGCTCACCTGTGAAAATACGCCAGGCCTCA SEQ ID NO30 MMP1388A CCCTCCTGCCTGCATATTTTCACCCACTGC (3) Auxiliary signal enhancement sequence Table 4: Information on Auxiliary Signal Enhancement Sequences Serial Number Probe Name Probe sequence (5' → 3') SEQ ID NO31 Intrusion probe 517 AGAGCTCTGCAGGTCCCTCCG SEQ ID NO32 Intrusion probe 592 CTGTTCCGTGAGGACCAGATCTT (4) Seven general fluorescent probes containing MP probe FLAG sequence sites. These fluorescent probes are linear in structure and contain fluorophores and quencher groups. in P1, UR1-FAM, contains the MP probe FLAG sequence positions corresponding to sites 1376G, 392G, and 392T; P2, UR2-FAM, contains the MP probe FLAG sequence positions corresponding to sites 1388G, 592C, and 1388A; P3, UR1-Cy5, contains the MP probe FLAG sequence positions corresponding to sites 95A, 487A, 1004A, and 95G; P4, UR2-Cy5, contains the MP probe FLAG sequence positions corresponding to sites 517T, 1004C, and 517C; P5, UR1-ROX, contains the MP probe FLAG sequence positions corresponding to sites 487G, 1376T, and 871A; P6, UR2-ROX, contains the MP probe FLAG sequence anchorages corresponding to sites 1024T, 1024C, and 871G; P7, UR-HEX, contains the MP probe FLAG sequence berth corresponding to site 592T.

[0041] In a more specific implementation, the detection system of the present invention is a single-tube PCR reaction system, each single-tube PCR reaction containing: 2 μL of 10X SSP buffer (pH 8.8), 0.4 μL of 10 mM dNTP, 1.6-4 μL of 25 mM MgSO4 (preferably 2.4 μL); five pairs of amplification primers SEQ ID NO: 1-10, 20 MP probes SEQ ID NO: 11-30, two auxiliary signal enhancement sequences SEQ ID NO: 31-32, and seven universal fluorescent probes P1~P7, with specific concentrations as shown in Table 6 below; 0.4 μL of HS Taq DNA polymerase; and ultrapure water to a final volume of 19 μL.

[0042] Table 5: Composition of the single-tube PCR reaction system of the present invention

[0043] Table 6: Concentration of each MP probe Probe Name Final concentration WMP95A 100 nM MMP95G 100 nM WMP392G 80 nM MMP392T 80 nM WMP487G 160 nM MMP487A 160 nM WMP517T 100 nM MMP517C 50 nM WMP592C 15 nM MMP592T 15 nM WMP871G 80 nM MMP871A 100 nM WMP1004C 160 nM MMP1004A 100 nM WMP1024C 100 nM MMP1024T 100 nM WMP1376G 80 nM MMP1376T 80 nM WMP1388G 100 nM MMP1388A 100 nM When performing the test, take 19 μL of the test reagent mixture into a PCR tube, add 1 μL of genomic sample (the sample concentration should be around 5-50 ng / μL), vortex to mix, and centrifuge.

[0044] The PCR amplification and melting curve detection procedures for the above detection system are shown in Table 7 below.

[0045] Table 7: PCR amplification and melting curve detection procedures

[0046] Fluorescence signals from the FAM, HEX, ROX, and Cy5 channels were collected during the melting process (6).

[0047] The present invention will be further illustrated below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0048] Example 1: Genotyping of ten high-frequency mutant loci of the G6PD gene using the multiplex fluorescent PCR reaction system of the present invention. Develop a testing system Each single-tube PCR reaction contains: 10X SSP buffer (pH 8.8) 2 μL, 10 mM dNTP 0.4 μL, 25 mM MgSO4 2.4 μL; five pairs of amplification primers SEQ ID NO: 1~10, 20 MP probes SEQ ID NO: 11~30, two auxiliary signal enhancement sequences SEQ ID NO31 and SEQ ID NO32, seven universal fluorescent probes P1~P7, with specific concentrations shown in Table 9; HS Taq DNA polymerase 0.4 μL; ultrapure water to a final volume of 19 μL.

[0049] Table 8: Composition of PCR reaction per tube

[0050] Table 9: Concentration used for each MP probe Probe Name Final concentration WMP95A 100 nM MMP95G 100 nM WMP392G 80 nM MMP392T 80 nM WMP487G 160 nM MMP487A 160 nM WMP517T 100 nM MMP517C 50 nM WMP592C 15 nM MMP592T 15 nM WMP871G 80 nM MMP871A 100 nM WMP1004C 160 nM MMP1004A 100 nM WMP1024C 100 nM MMP1024T 100 nM WMP1376G 80 nM MMP1376T 80 nM WMP1388G 100 nM MMP1388A 100 nM When performing the test, take 19 μL of the test reagent mixture into a PCR tube and add 1 μL (10) 3 1 μL (copy number / μL) wild-type genome sample or 1 μL (10 3 Mix the mutant plasmid standard sample (copy number / μL) with ddH2O as a blank control. Vortex to mix and centrifuge.

[0051] The PCR amplification and melting curve detection procedures for the above detection system are shown in Table 10 below.

[0052] Table 10: Procedures for PCR amplification and melting curve detection

[0053] During the melting process (6), fluorescence signals from the FAM, HEX, ROX, and Cy5 channels were collected.

[0054] Figure 1-4 The results of the detection system on wild-type genome samples are shown in the FAM, ROX, Cy5, and HEX channels. Specifically, the FAM channel shows four melting peaks corresponding to c.1376G, c.392G, c.1388G, and c.592C; the ROX channel shows three melting peaks corresponding to c.487G, c.1024C, and c.871G; the Cy5 channel shows three melting peaks corresponding to c.95A, c.517T, and c.1004C; and the HEX channel shows no melting peaks corresponding to wild-type sites.

[0055] Figure 5-8The results of the detection system on the FAM, ROX, Cy5, and HEX channels for mixed mutant samples are shown below. Specifically, the FAM channel shows two melting peaks corresponding to c.392T and c.1388A; the ROX channel shows three melting peaks corresponding to c.1376T, c.871A, and c.1024T; the Cy5 channel shows four melting peaks corresponding to c.487A, c.1004A, c.95G, and c.517C; and the HEX channel shows one melting peak corresponding to c.592T.

[0056] It should be noted that while the preferred embodiments of the present invention are given in the specification and accompanying drawings, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are not intended to impose additional limitations on the content of the present invention; their purpose is to provide a more thorough and comprehensive understanding of the disclosure of the present invention. Furthermore, the above-described technical features can be combined with each other to form various embodiments not listed above, all of which are considered to be within the scope of the present invention specification. Moreover, those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A multiplex fluorescent PCR reaction system for detecting mutations at multiple gene loci in a single tube, characterized in that, The reaction system comprises: (1) Primer set used to amplify the gene locus to be tested; (2) MP probe set that specifically recognizes mutant gene sites and corresponding wild-type gene sites; (3) A general probe set containing specific berth sequences; The primer set includes an upstream primer located upstream of the gene locus to be tested and a downstream primer located downstream of the gene locus to be tested. The MP probe includes a mediator subsequence at the 5' end and a complementary sequence to the recognition site at the 3' end. The universal probe contains a fluorescent group and a quenching group; During PCR amplification, the MP probe hybridizes with the corresponding recognition site and is cleaved by polymerase extension, releasing the mediator sequence corresponding to each recognition site. The mediator sequence pairs with and extends a specific mooring sequence on a universal probe to form a fluorescent double-stranded DNA product with a specific melting temperature (Tm value). By analyzing the melting curve of the fluorescent double-stranded DNA product, the genotype of each gene locus can be determined based on the combination characteristics of the fluorescence signal and the Tm value.

2. The multiplex fluorescent PCR reaction system according to claim 1, characterized in that, The multiple gene loci include ten high-frequency mutation gene loci of the G6PD gene in the Chinese population: cDNA1376, cDNA1388, cDNA95, cDNA871, cDNA1024, cDNA392, cDNA487, cDNA517, cDNA592, and cDNA1004.

3. The multiplex fluorescent PCR reaction system according to claim 1, characterized in that, The primer set includes: The upstream primer F1 and the downstream primer R1 used to amplify the mutant site cDNA95, the sequence of F1 is shown in SEQ ID NO: 1, and the sequence of R1 is shown in SEQ ID NO: 2; The upstream primer F2 and the downstream primer R2 used to amplify the mutant site cDNA392, the sequence of F2 is shown in SEQ ID NO: 3, and the sequence of R2 is shown in SEQ ID NO: 4; The upstream primer F3 and the downstream primer R3 are used to amplify the mutant sites cDNA487, cDNA517, and cDNA592. The sequence of F3 is shown in SEQ ID NO: 5, and the sequence of R3 is shown in SEQ ID NO:

6. The upstream primer F4 and the downstream primer R4 are used to amplify the mutant sites cDNA871, cDNA1004, and cDNA1024. The sequence of F4 is shown in SEQ ID NO: 7, and the sequence of R4 is shown in SEQ ID NO:

8. The upstream primer F5 and the downstream primer R5 used to amplify the mutant sites cDNA1376 and cDNA1388 are shown in SEQ ID NO: 9 and the sequence of R5 is shown in SEQ ID NO:

10.

4. The multiplex fluorescent PCR reaction system according to claim 1, characterized in that, The MP probe set includes: The probe MP1 specifically recognizes the wild-type site 95A, and the sequence of MP1 is shown in SEQ ID NO: 11; The probe MP2 specifically recognizes the mutation site A95G, and the sequence of MP2 is shown in SEQ ID NO: 12; The probe MP3 specifically recognizes the wild-type site 392G, and the sequence of MP3 is shown in SEQ ID NO: 13; The probe MP4 specifically recognizes the mutation site G392T, and the sequence of MP4 is shown in SEQ ID NO: 14; The probe MP5 specifically recognizes the wild-type site 487G, and the sequence of MP5 is shown in SEQ ID NO: 15; The probe MP6 specifically recognizes the mutation site G487A, and the sequence of MP6 is shown in SEQ ID NO: 16; The probe MP7 specifically recognizes the wild-type site 517T, and the sequence of MP7 is shown in SEQ ID NO: 17; The probe MP8 specifically recognizes the mutation site T517C, and the sequence of MP8 is shown in SEQ ID NO: 18; The probe MP9 specifically recognizes the wild-type site 592C, and the sequence of MP9 is shown in SEQ ID NO: 19; The probe MP10 specifically recognizes the mutation site C592T, and the sequence of MP10 is shown in SEQ ID NO: 20; The probe MP11 specifically recognizes the wild-type site 871G, and the sequence of MP11 is shown in SEQ ID NO: 21; The probe MP12 specifically recognizes the mutation site G871A, and the sequence of MP12 is shown in SEQ ID NO: 22; The probe MP13 specifically recognizes the wild-type site 1004C, and the sequence of MP13 is shown in SEQ ID NO: 23; The probe MP14 specifically recognizes the mutation site C1004A, and the sequence of MP14 is shown in SEQ ID NO: 24; The probe MP15 specifically recognizes the wild-type site 1024C, and the sequence of MP15 is shown in SEQ ID NO: 25; The probe MP16 specifically recognizes the mutation site C1024T, and the sequence of MP16 is shown in SEQ ID NO: 26; The probe MP17 specifically recognizes the wild-type site 1376G, and the sequence of MP17 is shown in SEQ ID NO: 27; The probe MP18 specifically recognizes the mutation site G1376T, and the sequence of MP18 is shown in SEQ ID NO: 28; The probe MP19 specifically recognizes the wild-type site 1388G, and the sequence of MP19 is shown in SEQ ID NO: 29; The probe MP20 specifically recognizes the mutation site G1388A, and the sequence of MP20 is shown in SEQ ID NO:

30.

5. The multiplex fluorescent PCR reaction system according to claim 1, characterized in that, The universal probe set includes: The universal probe P1 contains the FAM fluorescent group and includes the station sequences corresponding to probes MP3, MP4, and MP17; The universal probe P2 contains the FAM fluorescent group and includes the station sequences corresponding to probes MP9, MP19, and MP20; The universal probe P3 contains the Cy5 fluorescent group and contains the station sequences corresponding to probes MP1, MP2, MP6, and MP14. The universal probe P4 contains the Cy5 fluorescent group and includes the station sequences corresponding to probes MP7, MP8, and MP13; The universal probe P5 contains the ROX fluorescent group and includes the station sequences corresponding to probes MP5, MP12, and MP18; The universal probe P6 contains the ROX fluorescent group and includes the station sequences corresponding to probes MP11, MP15, and MP16. The universal probe P7 contains the HEX fluorescent group and includes the poise sequence corresponding to probe MP10.

6. The multiplex fluorescent PCR reaction system according to claim 5, characterized in that, The fluorescent double-stranded DNA products corresponding to probes MP3, MP4, MP17, MP9, MP19, and MP20 have different Tm values. The fluorescent double-stranded DNA products corresponding to probes MP1, MP2, MP6, MP14, MP7, MP8, and MP13 have different Tm values. The fluorescent double-stranded DNA products corresponding to probes MP5, MP12, MP18, MP11, MP15, and MP16 have different Tm values.

7. The multiplex fluorescent PCR reaction system according to any one of claims 1-6, characterized in that, The multiplex fluorescent PCR reaction system also includes an intrusion probe 1 and an intrusion probe 2 for auxiliary signal enhancement. The sequence of the intrusion probe 1 is shown in SEQ ID NO: 31, and the sequence of the intrusion probe 2 is shown in SEQ ID NO:

32.

8. The multiplex fluorescent PCR reaction system according to any one of claims 1-6, characterized in that, The multiplex fluorescent PCR reaction system also includes reaction buffer, dNTPs, and DNA polymerase.

9. A kit for detecting mutations at multiple gene loci using a single-tube method, characterized in that, The kit comprises a multiplex fluorescent PCR reaction system according to any one of claims 1-8.

10. A method for detecting mutations at multiple gene loci using the multiplex fluorescent PCR reaction system according to any one of claims 1-8 or the kit according to claim 9, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) The genomic DNA is amplified by multiplex PCR using the multiplex fluorescent PCR reaction system according to any one of claims 1-8, wherein MP probe cleavage, mediator release and universal probe extension reaction are completed during the amplification process; (3) Perform melting curve analysis on the reaction products; (4) Determine the genotype of the multiple gene loci based on the obtained fluorescence signal and Tm value combination.

Images