SNP molecular markers associated with cotton fiber length and their application

Abstract

The present invention discloses SNP molecular markers related to cotton fiber length and applications thereof, and belongs to the field of cotton biotechnology. The SNP molecular markers are located on chromosome 26 of the cotton genome, including SNP1 and SNP2. The chr26_48541290 and chr26_52313534 provided by the present invention can assist in identifying the length of the fiber, and the fiber length of cotton plants with a genotype of CCCC is significantly higher than that of individuals with a genotype of GGTT and CGTC. The molecular markers disclosed by the present invention have a very significant application value for the identification of excellent traits of cotton, and are of great significance for accelerating the breeding of new varieties of high-quality cotton and improving the economic benefits of cotton.

Description

Technical Field

[0001] The invention relates to the field of cotton biotechnology, in particular to a SNP molecular marker related to cotton fiber length and an application thereof. Background Art

[0002] Cotton is the most important natural fiber crop in the world and an important cash crop in my country. It has a significant impact on the development of the national economy and the increase of farmers' production and income. In recent years, with the continuous improvement of the requirements for fiber quality in textile machinery and high-quality cotton fiber products, high quality and high price have become the popular model for cotton purchase. Fiber quality has gradually become the main factor limiting the benefits of cotton planting. Cultivating high-quality new varieties has become the key research target of current cotton production.

[0003] Fiber quality mainly includes five traits: fiber length, specific strength, micronaire value, uniformity and elongation, and they are all controlled by micro-effect genes, and the molecular genetic mechanism is complex (Han et al. Genomic signatures and candidate genes of lint yield and fiber quality improvement in Upland cotton in Xinjiang. Plant Biotechnology Journal, 2020, 1-3). The requirements for high-quality fiber are longer fiber length, stronger specific strength, higher uniformity, better elongation, and smaller micronaire value. Among them, for every 1mm increase in fiber length, the purchase price of lint cotton increases by 200 yuan / ton. Therefore, cultivating varieties with longer fiber length will become an important way to increase cotton farmers' income. However, due to the negative correlation between traits, especially the difficulty in improving yield and fiber quality simultaneously, traditional breeding methods can hardly break the linkage relationship of unfavorable genes, and there is an urgent need to use molecular marker technology to assist breeding selection (Liu et al. GWAS analysis and QTL identification of fiber quality traits and yield components in Upland cotton using enriched high-density SNP markers. Frontiers in Plant Science, 2018, 9: 1067).

[0004] The development of molecular markers is conducive to the genetic selection of traits at the chromosome level, especially single nucleotide polymorphism (SNP) markers, which are numerous and rich in polymorphism. In recent years, with the continuous advancement of sequencing technology, the detection cost, reliability, and timeliness of SNPs have continued to develop in a direction that is conducive to research, making it possible for breeding technology to break gene linkage and improve multiple traits simultaneously. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to cotton fiber length and its application to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a SNP molecular marker related to cotton fiber length, wherein the SNP molecular marker is located on chromosome 26 of the cotton genome, including SNP1 and SNP2;

[0008] The SNP 1 is chr26_48541290, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphic site C / G;

[0009] The SNP 2 is chr26_52313534, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.2, and has a base polymorphic site C / T.

[0010] The second technical solution of the present invention is the application of the SNP molecular marker in cotton breeding.

[0011] The third technical solution of the present invention is a method for identifying the quality of cotton fiber using the SNP molecular marker, extracting the genomic DNA of the cotton to be tested, detecting the genotype of the SNP molecular marker, and the fiber length of the cotton plant with the genotype CCCC is significantly longer than that of the individuals with the genotypes GGTT and CGTC.

[0012] A fourth technical solution of the present invention is a method for breeding cotton varieties with excellent fiber length, which comprises extracting genomic DNA of the cotton to be tested, detecting the genotype of the SNP molecular marker, and selecting cotton plants with a genotype of CCCC for breeding.

[0013] Based on the above technical solution, the present invention has the following technical effects:

[0014] The chr26_48541290 and chr26_52313534 provided by the present invention can assist in identifying the length of the fiber. The fiber length of the cotton plant with the genotype CCCC is significantly longer than that of the individuals with the genotypes GGTT and CGTC. The molecular markers disclosed by the present invention have a very important application value for the identification of excellent traits of cotton, and are of great significance for accelerating the breeding of new high-quality cotton varieties and improving the economic benefits of cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 The QTL is located in multiple generations of populations;

[0017] Figure 2 To verify the significance of differences in fiber quality traits among groups. DETAILED DESCRIPTION

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0020] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0021] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0022] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0023] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0024] The embodiment of the present invention provides SNP molecular markers associated with cotton fiber length, wherein the SNP molecular markers are located on chromosome 26 of the cotton genome, including SNP1 and SNP2;

[0025] The SNP 1 is chr26_48541290, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphic site C / G;

[0026] The SNP 2 is chr26_52313534, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.2, and has a base polymorphic site C / T.

[0027] The embodiment of the present invention also provides the application of the SNP molecular marker in cotton breeding.

[0028] The embodiment of the present invention also provides a method for identifying cotton fiber quality using the SNP molecular marker, extracting the cotton genomic DNA to be tested, detecting the genotype of the SNP molecular marker, and the fiber length of cotton plants with the genotype CCCC is significantly longer than that of individuals with the genotypes GGTT and CGTC.

[0029] In some specific embodiments, the cotton includes Jifeng 1271, Jifeng 4, or offspring bred with the two as parents.

[0030] The embodiment of the present invention also provides a method for breeding cotton varieties with excellent fiber length, which comprises extracting genomic DNA of the cotton to be tested, detecting the genotype of the SNP molecular marker, and selecting cotton plants with a genotype of CCCC for breeding.

[0031] In some specific embodiments, the cotton includes Jifeng 1271, Jifeng 4, or offspring bred with the two as parents.

[0032] Example 1

[0033] Discovery of SNPs

[0034] 1. A cotton F2 segregating population (experimental population) was constructed with Jifeng 1271 as the female parent and Jifeng 4 as the male parent. The population contained 317 individual plants. The fiber quality traits of the parents, 317 F2 individual plants and offspring lines were investigated. After the cotton bolls were naturally opened, they were harvested manually. After ginning, 20 grams of fiber samples were weighed from each material (Cotton Research Institute, Chinese Academy of Agricultural Sciences, Anyang, Henan Province) to test the specific strength and micronaire value of the fiber.

[0035] 2. Extract DNA from young leaves of 200 cotton plants according to the CTAB method (Paterson AH, Brubaker CL, Wendel JF. A rapid method for extraction of cotton (Gossypiums pp.) genomie DNA suitable for RFLP and PCR analysis. Plant MOl Rep, 1993, 11: 122-127).

[0036] 3. GBTS develops SNP tags. SNP detection was performed on DNA according to the method of Xu et al. (Xu Y, Yang QN, Zheng HJ, et al. Genotyping by target sequencing (GBTS) and its applications [J]. Sci Agric Sin, 2020, 53: 2983-3004.).

[0037] 4. Construct a high-density genetic map. Select SNPs with polymorphism between parents and populations, and use MSTMap (the minimum spanning tree map, version update 2015) software to construct a genetic map with an LOD value of 4.0-20.0.

[0038] 5. QTL positioning. Combining genetic maps and fiber quality data, the ICIM program of QTLIciMapping 4.0 software was used to locate QTL, with parameters of Step=1cM, PIN=0.001, and LOD value determined by 1000 iterations. The results showed that qFL-D13-1 was stably expressed, with a contribution rate of more than 10%.

[0039] 6. Determination of key SNPs. Based on the QTL positioning results, select sites with higher LOD values ​​and better contribution rates, determine the genotypes of the SNPs within the sites in the parents and populations, and perform a significance analysis of the differences between different genotypes in combination with the fiber quality data.

[0040] 7. There were 213,825 SNPs between parents, of which 40,229 SNPs were polymorphic between parents and populations, and a high-density genetic map containing 12,084 SNPs was constructed. A fiber length QTL qFL-D13-1 was located at the 40 cM position on chromosome 26. The contribution rate of this QTL to the phenotypic variation in different generations was 3.94%-11.39% (Table 1; Figure 1 ).

[0041] Table 1 Detailed information on the QTL location results in multi-generation populations

[0042]

[0043] 8. Two SNP markers, namely chr26_48541290 and chr26_52313534, were found in the located QTL interval. chr26_48541290 is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1, and the base at this position is C or G. The genotype of the parent Jifeng 1271 is GG, and the genotype of the parent No. 4 is CC; chr26_52313534 is located at the 51st position of the nucleotide sequence shown in SEQ ID NO.2, and the base at this position is C or T. The genotype of the parent Jifeng 1271 is TT, and the genotype of the parent No. 4 is CC.

[0044] SEQ ID NO.1: GATGCTATACGCTTCATATTTTTCTCATTTCTGCTCATTCCTGCA AATAC[C / G]CAACTTGAATCCAACCAAAAAGGATACATATCTGCTGTTATATCCACT AA;

[0045] SEQ ID NO.2: ACTGAGAGGCCCCAATTCACGCCAATTCCTATGTCATACAGG GAACTATA[T / C]CGAAATTTATTTGACGCACACGTAGTTTCCCCTTTCTATCTGAAG CCATT.

[0046] Table 2 Base types of SNP sites in parents

[0047]

[0048] 9. The genotype of the SNP marker in Jifeng No. 4 was recorded as group A, and the genotype in Jifeng 1271 was recorded as group B. The population was divided into homozygous genotype group A (genotype of the SNP marker in Jifeng No. 4) and group B (genotype of the SNP marker in Jifeng 1271), as well as heterozygous genotype group H, and the phenotypes of the three groups were analyzed for significant differences (Table 3). It can be seen that the fiber length of group A is significantly higher than that of group B (the difference is about 1.5 mm). This shows that the SNP markers (chr26_48541290 and chr26_52313534) in the qFL-D13-1 interval are effective in identifying fiber length. When these two SNP sites are the same as the genotype of Jifeng No. 4, it is CCCC, and the fiber length of the material is longer and the quality is better; when these two SNP sites are the same as the genotype of Jifeng 1271, it is GGTT, and the fiber length of the material is shorter and the quality is worse.

[0049] Table 3 Differences in fiber specific strength and micronaire value among different genotype groups

[0050]

[0051] Note: a, b, and c are significantly different at the 0.05 level.

[0052] Example 2

[0053] 1. SNP verification:

[0054] The DNA of the remaining 117 plants in the F2 population was extracted, and SNP markers were developed using the GBTS technology. The SNP genotypes at the chr26_48541290 and chr26_52313534 positions were counted, and the plants were grouped according to the genotypes to analyze the significance of the differences in fiber quality between materials with different genotypes. The results showed that among the remaining 117 plants, there were 28 plants with CCCC homozygous genotypes, 32 plants with GGTT homozygous genotypes, 50 plants with CGTC heterozygous genotypes, and 7 plants with base deletions at the chr26_48541290 and chr26_52313534 loci. The fiber quality data of the three genotype strains were analyzed, and the results showed that the fiber length of the CCCC homozygous genotype group was significantly better than that of the GGTT homozygous genotype group (Table 4, Figure 2 ), similar to the results in Table 3, demonstrating that chr26_48541290 and chr26_52313534 play a significant role in identifying fiber length.

[0055] Table 4 SNP validation data difference significance analysis

[0056]

[0057] Note: a, b, and c indicate significant differences at the 0.05 level.

[0058] 2. The value of SNP. Improving fiber length is an urgent task for cotton breeding and production, and it is also the bottleneck technology of existing breeding methods. The chr26_48541290 and chr26_52313534 provided by the present invention can assist in identifying the length of fiber. The fiber length of cotton plants with the genotype CCCC is significantly longer than that of individuals with the genotypes GGTT and CGTC. The molecular markers disclosed in the present invention have a very significant application value for the identification of excellent traits of cotton, and are of great significance for accelerating the breeding of new high-quality cotton varieties and improving the economic benefits of cotton.

[0059] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of a reagent for detecting SNP molecular markers in cotton fiber length related breeding, characterized in that: The SNP molecular markers are located on chromosome 26 of the cotton genome, including SNP1 and SNP2; The SNP 1 is chr26_48541290, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphic site C / G; The SNP 2 is chr26_52313534, located at the 51st position of the nucleotide sequence shown in SEQ ID NO.2, and has a base polymorphic site C / T; The fiber length of cotton plants with CCCC genotype was significantly longer than that of individuals with GGTT and CGTC genotypes. The cotton is Jifeng 1271, Jifeng No. 4 or the offspring bred with the two as parents.

2. A method for identifying cotton fiber quality using the SNP molecular markers described in claim 1, characterized in that: Extracting the genomic DNA of the cotton to be tested, detecting the genotype of the SNP molecular marker, the fiber length of cotton plants with the genotype CCCC is significantly longer than that of individuals with the genotypes GGTT and CGTC; The cotton is Jifeng 1271, Jifeng No. 4 or the offspring bred with the two as parents.

3. A method for breeding cotton varieties with excellent fiber length, characterized in that: Extracting genomic DNA of the cotton to be tested, detecting the genotype of the SNP molecular marker described in claim 1, and selecting cotton plants with a genotype of CCCC for breeding; The cotton is Jifeng 1271, Jifeng No. 4 or the offspring bred with the two as parents.

Images