Bifidobacterium animalis lactis bbm-19 and application thereof in regulating neurotransmitters

By screening animal Bifidobacterium lactis subspecies Bbm-19 from breast milk, the problem of lacking effective probiotic strains for regulating neurotransmitters and improving sleep in existing technologies has been solved. It has been shown to regulate serotonin and GABA levels in insomnia mice and has multiple probiotic effects.

CN118755620BActive Publication Date: 2026-03-24内蒙古科拓生物有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-16
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

There is a lack of probiotic strains in the current technology that can effectively regulate neurotransmitters and improve sleep quality, especially strains with excellent probiotic properties isolated from breast milk.

Method used

A strain of Bifidobacterium animalis subsp. lactis Bbm-19 was screened from 202 breast milk samples. After cultivation and identification, it was found that this strain can produce organic acids such as lactic acid, propionic acid, and butyric acid, and secrete GABA and serotonin. It has good acid and bile salt resistance characteristics and can be applied to probiotic fermented dairy products and live bacteria preparations.

Benefits of technology

Bifidobacterium animalis subsp. lactis Bbm-19 can regulate serotonin and GABA levels in insomnia mice, exhibiting antibacterial, nervous system-regulating, and sleep-improving effects, making it suitable for the production of functional active substances.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118755620B_ABST
    Figure CN118755620B_ABST
Patent Text Reader

Abstract

The application provides an animal bifidobacterium lactis Bbm-19 and application of the animal bifidobacterium lactis Bbm-19 in regulating neurotransmitters, and belongs to the technical field of probiotics; the animal bifidobacterium lactis Bbm-19 is isolated from breast milk of a healthy woman, and is preserved in the China General Microbiological Culture Collection Center, with a preservation number of CGMCC No.25080. The extracellular of the animal bifidobacterium lactis Bbm-19 can synthesize functional active substances such as short-chain fatty acids, organic acids and derivatives thereof, amino acids and derivatives thereof and brain-gut axis regulating substances. The animal bifidobacterium lactis Bbm-19 has the ability to regulate the levels of serotonin and gamma-aminobutyric acid (GABA) in the body. The application provides a brand-new idea for the in-depth research and utilization of mental probiotics with functional active substances and the ability to improve nervous system disorders, and has great research and application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of probiotic technology, specifically relating to Bifidobacterium animalis subsp. lactis Bbm-19 and its applications. Background Technology

[0002] For decades, breast milk has been widely recognized as the normal and optimal dietary starting point for infants, with its nutrients and bioactive components working together to produce unparalleled biological effects. The positive impact of breastfeeding on infants has been proven from nutritional, physiological, and developmental perspectives. In addition to its numerous nutritional and health benefits, breast milk also boasts a rich microbiome, a vital source of gut microbiota for infants. Therefore, isolating and culturing probiotics directly from breast milk will inject new momentum into the probiotic industry.

[0003] In 2013, Dinan and colleagues defined "psychoprobiotics" as a new class of probiotics that may be used to treat mental illnesses. Psychoprobiotics can regulate neurotransmitters and proteins, including GABA, serotonin, glutamate, and brain-derived neurotrophic factor, which play important roles in controlling the excitation-inhibition balance, mood, cognitive function, learning, and memory.

[0004] Bifidobacteria, as one of the major members of the human gut microbiota, play a crucial role in regulating the development of the host's innate and adaptive immunity, metabolic regulation, and bidirectional regulation of the gut-brain axis. In fact, the use of Bifidobacteria as a potential live bacteria dietary supplement has become a global trend. Therefore, through the evaluation and development of active metabolites, more precise targeting of regulatory sites can be achieved, specifically improving host health and enhancing the utilization effect of probiotics. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a strain of Bifidobacterium animalis subsp. lactis and its applications. This strain was isolated, screened, and identified from 202 breast milk samples in 2017 and is a strain with excellent probiotic properties. This strain can metabolize and produce organic acids such as lactic acid, propionic acid, and butyric acid, and can produce and secrete GABA and serotonin. It has important potential application value in the fields of antibacterial activity, nerve regulation, and sleep aid, providing a new candidate strain for excellent probiotic products.

[0006] The first aspect of this study provides a strain of Bifidobacterium animalis subsp. lactis, named Bbm-19, which is deposited at the China Culture Collection Center for Microbial Cultures, accession number CGMCC No. 25080.

[0007] Preferably, samples are taken from the breast milk of healthy women. The samples are shaken to mix, and 1 mL is taken into MRS solid medium containing 0.05% L-cysteine. After anaerobic incubation at 37°C for 48 hours, a single colony is picked up with an inoculation loop and streaked into MRS solid medium containing 0.05% L-cysteine. After anaerobic incubation at 37°C for 48 hours, white colonies are picked and repeatedly inoculated and screened until uniform single colonies are obtained, which are named Bbm-19.

[0008] Bifidobacterium animalis subsp. lactis is Gram-positive, appears as short rods under a microscope, and as curved, short rods under an electron microscope. When grown on MRS solid medium containing 0.05% L-cysteine, it forms milky white, opaque, smooth, moist, round colonies with neat edges. In MRS liquid medium containing 0.05% L-cysteine, it grows in a uniformly turbid manner, and the cells precipitate white after prolonged standing.

[0009] This invention provides a screening method for the above-mentioned Bifidobacteria, characterized by comprising the following steps:

[0010] (1) Screening of lactic acid bacteria

[0011] After collecting and mixing the breast milk sample, 1 mL of the sample was spread onto MRS solid medium containing 0.05% L-cysteine ​​and cultured. After a period of culture, single colonies were picked and further purified by streaking on MRS solid medium containing 0.05% L-cysteine. After purification, Gram staining and microscopic examination were performed. Strains that met the identification criteria for Bifidobacterium were preserved in glycerol and stored at -80°C for later use.

[0012] (2) Strain identification

[0013] Genomic DNA was extracted from the isolated strain using a bacterial DNA extraction kit, and the extracted DNA was amplified by PCR using the 16S rDNA sequence. The PCR product was purified and sequenced, and the sequencing results were compared by BLAST. Gene sequences of 16S rRNA from similar strains were found in GenBank. A phylogenetic tree was constructed by combining the gene sequence of the strain's 16S rRNA with the determined sequence using the Neighbor Joining method. 1000 random samples were taken, and the confidence level of the phylogenetic tree was calculated by calculating the self-guiding value. The final identification result confirmed that the strain was Bifidobacterium animalis subsp. lactis.

[0014] The selected Bifidobacterium animalis subsp. lactis Bbm-19 has good acid and bile salt resistance characteristics and can be used as a probiotic in probiotic fermented dairy products and live bacteria preparations.

[0015] The aforementioned animal Bifidobacterium lactis subspecies Bbm-19 does not possess hemolytic ability.

[0016] No putrescine, cadaverine, histamine, or tyramine were detected in the fermentation supernatant of the aforementioned Bifidobacterium lactis subsp. Bbm-19.

[0017] This invention also provides a bacterial agent containing *Bifidobacterium animalis* subsp. *lactamase* Bbm-19 as described in the above-mentioned scheme, wherein the effective viable count of the bacterial agent is ≥1×10⁻⁶. 6 CFU / mL.

[0018] The present invention also provides a method for preparing the bacterial agent described in the above scheme, comprising the following steps: inoculating the animal Bifidobacterium lactis subsp. Bbm-19 described in the above scheme into MRS medium containing 0.05% L-cysteine ​​salt, and culturing it under anaerobic conditions at 37°C to obtain the bacterial agent.

[0019] Preferably, the Bifidobacterium lactis subsp. Bbm-19 has excellent acid and bile salt resistance.

[0020] The second aspect of the present invention provides the application of Bifidobacterium animalis subsp. lactis Bbm-19 or the bacterial agent described above or the bacterial agent prepared by the preparation method described above in the generation of functional active substances.

[0021] The active ingredients include one or more of short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and gut-brain axis regulating substances.

[0022] Preferably, the fermentation product of Bifidobacterium animalis subsp. lactis Bbm-19 includes the extracellular product of Bifidobacterium animalis subsp. lactis Bbm-19.

[0023] The third aspect of this invention provides the application of the animal Bifidobacterium lactis subsp. Bbm-19 strain in antibacterial activity.

[0024] Studies have found that the probiotic Bifidobacterium animalis subsp. lactis Bbm-19 can produce organic acids such as lactic acid, propionic acid, butyric acid, and valeric acid, thereby inhibiting pathogenic bacteria, enhancing intestinal barrier function, and providing anti-inflammatory effects.

[0025] The fourth aspect of this invention provides the application of Bifidobacterium animalis subsp. lactis Bbm-19 strain in the production of GABA and serotonin.

[0026] Research has found that the animal bifidobacterium lactis subspecies Bbm-19 can secrete GABA and serotonin, and through this characteristic of producing GABA and serotonin, it can affect the function of the nervous system and improve sleep quality.

[0027] The fifth aspect of this invention provides the application of Bifidobacterium lactis subsp. Bbm-19 in a mouse model of insomnia.

[0028] Studies have found that the animal bifidobacterium lactis strain Bbm-19 can regulate serotonin and GABA levels in mice with insomnia induced by p-chlorophenylalanine.

[0029] This invention provides the application of *Bifidobacterium animalis* subsp. lactis Bbm-19 or its fermentation product, or a microbial agent containing *Bifidobacterium animalis* subsp. lactis Bbm-19 and / or its fermentation product, in the generation of functionally active products; the functionally active substances include one or more of short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and gut-brain axis regulating substances. The strain of this invention has various probiotic effects, including the production of organic acids such as lactic acid, butyric acid, propionic acid, and valeric acid, and the production and secretion of GABA and serotonin. The strain of this invention has the effect of regulating serotonin and GABA levels in insomniac mice. Therefore, *Bifidobacterium animalis* subsp. lactis Bbm-19 has multiple functions, including antibacterial activity, regulation of nervous system function, and regulation of neurotransmitter levels in insomniacs. The *Bifidobacterium animalis* subsp. lactis Bbm-19 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 25080. This invention provides a novel approach for the in-depth research and utilization of probiotics with functional active substances, and has significant application and economic value. Attached Figure Description

[0030] The accompanying drawings are provided to further illustrate the invention and form part of the specification. Obviously, the drawings described below are merely some embodiments of the invention, and those skilled in the art can obtain other drawings based on these drawings without any inventive effort. Wherein:

[0031] Figure 1 Phylogenetic tree of Bifidobacterium lactis subspecies Bbm-1916S rDNA;

[0032] Figure 2 A circulated genome diagram of Bifidobacterium lactis subspecies Bbm-19;

[0033] Figure 3 Gram staining image of Bifidobacterium lactis subspecies Bbm-19;

[0034] Figure 4 Electron micrograph of Bifidobacterium animalis subsp. lactis Bbm-19;

[0035] Figure 5 The acid and bile salt tolerance characteristics of Bifidobacterium lactis subspecies Bbm-19;

[0036] Figure 6Figure 1 shows the results of the hemolytic evaluation test of Bifidobacterium animalis subsp. lactis Bbm-19 (1. Negative control: Listeria innocense CICC 10417; 2. Positive control: Staphylococcus aureus CICC 10473; 3. Sample: Bifidobacterium animalis subsp. lactis Bbm-19).

[0037] Figure 7 The classification and proportion of extracellular functional active substances in Bifidobacterium lactis subsp. Bbm-19;

[0038] Figure 8 The levels of serotonin and GABA in the colon contents and serum of mice in the model group and healthy control group after intervention with Bifidobacterium lactis subsp. Bbm-19 were measured.

[0039] Biological Preservation Instructions

[0040] Bifidobacterium animalis subsp. lactis Bbm-19 was deposited on June 13, 2022, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China, with accession number CGMCC No. 25080. Detailed Implementation

[0041] This invention provides the application of *Bifidobacterium animalis* subsp. lactis Bbm-19 or its fermentation product, or a microbial agent containing *Bifidobacterium animalis* subsp. lactis Bbm-19 and / or its fermentation product, in the generation of functionally active products; the functionally active substances include one or more of short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and gut-brain axis regulating substances. The strains of this invention possess various probiotic effects, including the ability to produce organic acids such as lactic acid, propionic acid, and valeric acid, and to produce and secrete GABA and serotonin. The strains of this invention have the effect of regulating serotonin and GABA levels in insomniac mice. Therefore, *Bifidobacterium animalis* subsp. lactis Bbm-19 has multiple functions, including antibacterial activity, regulation of nervous system function, and regulation of neurotransmitter levels in insomniacs. The *Bifidobacterium animalis* subsp. lactis Bbm-19 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 25080.

[0042] The animal Bifidobacterium lactis subspecies Bbm-19 of the present invention was isolated from the breast milk of healthy women in Hohhot, Inner Mongolia, China.

[0043] The *Bifidobacterium lactis* subsp. Bbm-19 of this invention was isolated by the following method: Breast milk samples were spread on MRS solid medium containing 0.05% L-cysteine ​​and anaerobically cultured at 37°C for 48 hours. Typical colonies were selected for Gram staining and microscopic examination, and then streaked onto modified MRS solid medium containing 0.05% L-cysteine ​​for 2-3 cultivations to obtain pure colonies. After enrichment culture, bacterial sludge was collected and stored in glycerol tubes at -80°C.

[0044] Next, the isolated Bbm-19 strain was subjected to PCR using universal 16S rDNA primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT). The PCR product was then sequenced. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned with the NCBI Genome database. The results showed that the Bbm-19 strain shared >99% homology with the known 16S rDNA sequence of *Bifidobacterium animalis* subsp. *lactamella*, confirming that Bbm-19 is a different strain of the same species of *Bifidobacterium animalis* subsp. *lactamella*. In this invention, the 16S rRNA sequence of the *Bifidobacterium animalis* subsp. *lactamella* Bbm-19 is as shown in SEQ ID No. 1, specifically:

[0045] Figure 1 .

[0046] Based on 16S rRNA molecular identification, the strain described above is a subsp. lactis of Bifidobacterium animalis, named Bifidobacterium animalis subsp. lactis Bbm-19.

[0047] The *Bifidobacterium lactis* subspecies Bbm-19 of this invention has the following biological characteristics: Gram-positive, non-motile, non-spore-forming, and anaerobic; the bacterial cells are short rod-shaped, and the colonies are milky white, smooth, round, and small with regular edges. The optimal growth temperature is 36–38°C; the optimal pH value is 6.0–7.0.

[0048] The animal Bifidobacterium lactis subspecies Bbm-19 of the present invention is a Bifidobacterium strain with excellent probiotic properties selected from 1294 strains of lactic acid bacteria isolated from 202 breast milk samples.

[0049] The *Bifidobacterium lactis* subsp. Bbm-19 of this invention exhibited a survival rate of 61.16% after 3 hours of digestion in an artificial gastric juice environment at pH 2.5. Subsequent digestion in an artificial digestive juice environment at pH 8.0 for 8 hours resulted in a survival rate as high as 95.03%. It possesses excellent acid and bile salt resistance, allowing it to enter the human intestinal tract as a live bacterium and exert health benefits. These characteristics form the basis for its use as a probiotic.

[0050] This invention also provides the application of *Bifidobacterium lactis* subsp. Bbm-19 or fermentation products of *Bifidobacterium lactis* subsp. Bbm-19, or microbial agents containing fermentation products of *Bifidobacterium lactis* subsp. Bbm-19, in the production of functional active substances; the functional active substances include extracellular products of *Bifidobacterium lactis* subsp. Bbm-19, specifically including one or more of short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and gut-brain axis regulatory substances; the *Bifidobacterium lactis* subsp. Bbm-19 is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 25080.

[0051] The extracellular matrix of *Bifidobacterium lactis* subspecies Bbm-19 of this invention can synthesize functional active substances such as short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and substances that regulate the gut-brain axis, thus possessing potential value in intestinal regulatory efficacy. The *Bifidobacterium lactis* subspecies Bbm-19 strain of this invention has a clear origin and can be applied to ordinary foods, health foods, and biopharmaceuticals, facilitating industrial production and possessing broad application prospects.

[0052] In this invention, the short-chain fatty acids preferably include one or more of propionic acid, butyric acid, lactic acid, and valeric acid. In this invention, butyric acid can enhance the intestinal chemical barrier; propionic acid has antibacterial, anti-inflammatory, and antipyretic effects; lactic acid has antibacterial activity; and valeric acid can inhibit cytokines to exert an anti-inflammatory effect.

[0053] In this invention, the organic acid preferably includes one or more of citric acid, neochlorogenic acid, and N-acetylneuraminic acid vanillic acid. In this invention, citric acid has bactericidal and antioxidant effects; neochlorogenic acid has antioxidant and metabolism-promoting effects; and N-acetylneuraminic acid can improve and maintain memory and enhance learning ability.

[0054] In this invention, the amino acids and their derivatives preferably include one or more of L-isoleucine, L-leucine, L-valine, glutamic acid, and methionine. In this invention, L-isoleucine regulates protein metabolism and enhances immunity; L-leucine participates in maintaining nitrogen balance and promoting tissue growth; L-valine can regulate nerve conduction and improve cognitive function and thinking ability; glutamic acid is a precursor to the inhibitory neurotransmitter GABA; and methionine participates in liver detoxification and maintains a normal immune system.

[0055] In this invention, the brain-gut axis regulating substance preferably includes one or more of GABA and serotonin. In this invention, GABA is an inhibitory neurotransmitter that regulates the nervous system and promotes sleep; serotonin controls bodily functions such as mood, sleep, appetite, and muscle contraction.

[0056] The animal bifidobacterium lactis subspecies Bbm-19 provided by this invention can regulate serotonin and GABA levels in mice with insomnia induced by p-chlorophenylalanine.

[0057] Exemplary embodiments will now be described in detail, examples of which are illustrated in the accompanying drawings. When the following description relates to the drawings, unless otherwise indicated, the same numbers in different drawings denote the same or similar elements. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present invention. Rather, they are merely examples of methods consistent with some aspects of the invention as detailed in the appended claims.

[0058] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0059] The methods and culture media used in the embodiments of the present invention are as follows:

[0060] In the experimental examples of this application, the culture medium used to culture Bifidobacterium lactis subsp. was MRS medium containing 0.05% L-cysteine.

[0061] MRS liquid culture medium: 10g peptone (animal source), 8g beef extract, 4g yeast extract, 20g glucose, 1mL Tween-80, 2g dipotassium hydrogen phosphate, 5g sodium acetate, 2g triamine citrate, 0.05g manganese sulfate, 0.2g magnesium sulfate, 1L distilled water. Adjust pH to 6.5±0.2 and sterilize at 121℃ for 15min.

[0062] Example 1: Isolation, screening and identification of Bifidobacterium animalis subsp. lactis Bbm-19

[0063] 1. Materials and Methods

[0064] 1.1 Origin, isolation and identification of Bifidobacterium animalis subsp. lactis Bbm-19 strain

[0065] Breast milk samples were spread on MRS solid medium containing 0.05% L-cysteine ​​and anaerobically cultured at 37°C for 48 hours. Typical colonies were selected, Gram-stained, and examined under a microscope. These colonies were then streaked onto MRS solid medium containing 0.05% L-cysteine ​​and cultured 2-3 times to obtain pure colonies. After enrichment culture, bacterial sludge was collected and stored in glycerol tubes at -80°C. Microscopic observation revealed that *Bifidobacterium animalis* subsp. *milk* Bbm-19 is a Gram-positive bacterium, non-motile, non-spore-forming, and anaerobic. The bacteria are short rod-shaped, and the colonies are milky white, smooth, small, and round with regular edges. The optimal growth temperature is 36–38°C; the optimal pH is 6.0–7.0.

[0066] The isolated Bbm-19 strain was amplified by PCR using universal 16S rDNA primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT). The amplification conditions were: pre-denaturation at 94℃ for 5 min, one cycle; denaturation at 94℃ for 30 s, annealing at 54℃ for 30 s, extension at 72℃ for 90 s, 35 cycles; and extension at 72℃ for 10 min, one cycle. The PCR products were sequenced. The obtained 16S rDNA sequence (SEQ ID No: 1) was BLAST-aligned in the NCBI Genome database. The results showed that the Bbm-19 strain shared >99% homology with the known 16S rDNA sequence of *Bifidobacterium animalis* subsp. *lactamella*, and phylogenetic analysis with homologous strains was performed. Figure 1 This confirms that Bbm-19 is a different strain of the same species, *Bifidobacterium animalis* subsp. *lactobacter*. In this invention, the 16S rRNA sequence of *Bifidobacterium animalis* subsp. *lactobacter* Bbm-19 is shown in SEQ ID No. 1.

[0067] 1.2 Gastrointestinal Fluid Tolerance of Bifidobacterium animalis subsp. lactis Bbm-19

[0068] 1.2.1 Gastrointestinal fluid tolerance test method:

[0069] 1.2.1.1 Preparation of artificial gastric juice

[0070] Take 40 mL of sterile PBS, add 3.0 g / L pepsin (0.3%), adjust the pH to 2.5 (adjust with 0.1 mol / L HCl), filter through a 0.22 micrometer filter membrane into a sterile empty conical flask, and set aside for use.

[0071] 1.2.1.2 Preparation of artificial intestinal fluid

[0072] Take 40 mL of sterile PBS, add 1.0 g / L trypsin (0.1%) and 1.8% bile salts, adjust the pH to 8.0 (adjust with 0.1 mol / L NaOH), filter through a 0.22 microfiltration membrane into a sterile empty conical flask, and set aside for use.

[0073] 1.2.1.3 Determination Method

[0074] The bacterial culture in centrifuge tubes was centrifuged to collect the bacterial cells. The cells were washed twice with PBS, and 5 mL of PBS was added and the mixture was shaken to obtain the original bacterial culture. The original bacterial culture was diluted and counted, with the result recorded as the 0-hour value. 500 μL of the original bacterial culture was transferred to a test tube containing 4.5 mL of gastric fluid and incubated in a 37°C water bath for 10 min. After another 10 min of incubation, the tube was immediately placed in an anaerobic workstation and incubated for 3 h. The cells were then counted. 500 μL of the 3-h incubation culture was transferred to a test tube containing 4.5 mL of intestinal fluid and incubated in a 37°C water bath for 10 min. The tube was immediately placed in an anaerobic workstation and incubated for 8 h. The viable cell count was determined using the pour method with MRS solid medium containing 0.05% L-cysteine.

[0075] Survival rate = [N1 / N0] × 100%

[0076] Where N0 represents the number of viable bacteria at 0h; N1 represents the number of viable bacteria after simulated digestion for 3h or 8h.

[0077] Tolerance effect: The results of treatment with simulated gastric and intestinal fluids of Bifidobacterium animalis subsp. lactis Bbm-19 are shown in Table 2 below:

[0078] Table 1. Survival status of Bifidobacterium lactis subsp. Bbm-19 in simulated gastrointestinal digestive fluids.

[0079]

[0080] From Table 1 and Figure 5It can be seen that Bifidobacterium animalis subsp. lactis Bbm-19 has good tolerance characteristics, and its survival rate can reach 95.03% after 8 hours of treatment with simulated intestinal fluid.

[0081] Based on the gastrointestinal fluid tolerance effect of this embodiment, it can be seen that Bifidobacterium animalis subsp. lactis Bbm-19 has good tolerance in the intestine.

[0082] Example 2: Preparation and Analysis of Extracellular Metabolites of Bifidobacterium lactis subspecies Bbm-19

[0083] 1. Preparation method of extracellular metabolites

[0084] 1.1 Strain Activation: The strain, cryopreserved at -80℃, was inoculated into MRS liquid medium containing 0.05% L-cysteine ​​and activated under anaerobic conditions at 37℃. After activation, the test strain was inoculated into MRS liquid medium containing 0.05% L-cysteine ​​at a 2% inoculation rate using a pipette, and then cultured continuously at 37℃ under anaerobic conditions for 10–14 h. To ensure the purity of the test strain, the morphology of the microorganisms was observed during subculturing.

[0085] 1.2 Scale-up culture: The above seed culture was scaled up at an inoculum of 10% (V / V).

[0086] 1.3 Sample Pretreatment: After 24 hours of incubation, collect the supernatant and transfer 50 μL of the supernatant to a centrifuge tube; add 150 μL of 20% acetonitrile methanol internal standard extraction solution, vortex for 3 min, and centrifuge at 12000 rpm for 10 min at 4℃; after centrifugation, transfer 150 μL of the supernatant to another centrifuge tube and let it stand in a -20℃ refrigerator for 30 min; centrifuge again at 12000 rpm for 3 min at 4℃, and transfer 120 μL of the supernatant to the corresponding sample vial liner for instrumental analysis.

[0087] 1.4 Chromatographic conditions: Column: Waters ACOUITY Premier HSS T3 Column 1.8um, 2.1mm*100mm; Mobile phase A: 0.1% formic acid / water, Mobile phase B: 0.1% formic acid / acetonitrile; Instrument column temperature: 40℃; Flow rate: 0.4mL / min; Injection volume: 4uL.

[0088] Table 2. Column mobile phase gradient conditions

[0089]

[0090] 1.5 Mass Spectrometry Conditions:

[0091] Table 3. AB TripleTOF 6600 Mass Spectrometry Conditions

[0092]

[0093] 2 Results and Analysis

[0094] 2.1 Extracellular bioactive products of Bifidobacterium animalis subsp. lactis Bbm-19 were detected using metabolomics techniques. The identification results and functional analysis of intracellular functional bioactive substances are shown in Table 4. Among them, the functional metabolites with higher content were mainly concentrated in short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and metabolites related to the gut-brain axis, specifically accounting for [percentage missing]. Figure 7 As shown. This application focuses on illustrating the substances with high content in the above-mentioned compound categories.

[0095] Table 4. Identification results of intracellular bioactive products of Bifidobacterium lactis subspecies Bbm-19

[0096]

[0097] Example 3: Study on the regulation of neurotransmitters in insomnia mice by Bifidobacterium lactis subspecies Bbm-19

[0098] 1. Experimental Design

[0099] The C57BL / 6J inbred mice used in this embodiment were purchased from Spiford (Beijing) Biotechnology Co., Ltd. Thirty 6-week-old male, pathogen-free C57BL / 6J inbred mice were housed for one week at a room temperature of 22–24°C and humidity of 40–60%, with 12h / 12h day-night alternation, and free access to food and water. They were then divided into three groups according to body weight: a control group (HEL, administered via gavage with saline), a model group (INS, administered via gavage with saline), and a probiotic group (Bb, administered via gavage with probiotics at a dose of 5 × 10⁻⁶). 9 (CFU / unit / day). The experiment lasted for 42 days.

[0100] The insomnia mouse model was established by gavage administration of chlorophenylalanine (300 mg / kg*d) for 3 consecutive days. The model group and the probiotic group were gavage-administered on day 32 to establish the model.

[0101] On day 42 of the experiment, all mice were euthanized, and blood and colon contents were collected. After the blood was allowed to stand for 2 hours, it was centrifuged at 3000g for 15 minutes, and the supernatant was collected and stored at -80℃. Fresh colon contents were flash-frozen in liquid nitrogen and then stored at -80℃.

[0102] 2. Results and Analysis

[0103] p-Chlorophenylalanine induces insomnia symptoms by blocking serotonin synthesis in the body. Animal experiments showed that the serotonin levels in serum and colonic contents of the INS group were significantly lower than those in the HEL group (P<0.05), indicating successful model establishment. Ingestion of Bifidobacterium lactis subsp. Bbm-19 significantly increased the serotonin levels in serum and colonic contents (P<0.05).

[0104] GABA, an inhibitory neurotransmitter, is crucial for maintaining normal sleep. The GABA content in the colonic contents of the INS group was significantly lower than that of the HEL group (P<0.05), while there was no significant difference in serum GABA levels. Ingestion of Bifidobacterium lactis subspecies Bbm-19 significantly increased both serum and colonic GABA levels (P<0.05). These results confirm that Bifidobacterium lactis subspecies Bbm-19 plays a role in regulating neurotransmitter imbalances induced by p-chlorophenylalanine in insomnia in mice.

[0105] 3. Conclusion

[0106] Bifidobacterium animalis subspecies Lactobacillus Bbm-19 exhibits good acid and bile salt resistance. Its extracellular matrix can produce functionally active substances such as short-chain fatty acids, organic acids and their derivatives, amino acids and their derivatives, and substances regulating the gut-brain axis. Bifidobacterium animalis subspecies Lactobacillus Bbm-19 can regulate serotonin and GABA levels in insomniac mice. This invention provides a novel approach for the in-depth research and utilization of probiotics with functionally active substances, and has significant research and application value in the field of sleep aid.

[0107] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp lactis Bbm-19, characterized in that, The Bifidobacterium animalis subspecies Bbm-19 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25080.

2. A microbial agent, characterized in that, Contains *Bifidobacterium animalis* subsp. *lactum* Bbm-19 as described in claim 1, with an effective viable count ≥ 1 × 10⁻⁶. 6 CFU / mL.

3. The method for culturing Bifidobacterium animalis subsp. Lactobacillus Bbm-19 according to claim 1, characterized in that, MRS medium with 0.05% L-cysteine ​​added was used for anaerobic culture at 37°C.

4. The application of Bifidobacterium animalis subsp. lactis Bbm-19 as described in claim 1 or the bacterial agent as described in claim 2 in the production of functional active substances, characterized in that, The functional active substances include one or more of the following: propionic acid, butyric acid, lactic acid and valeric acid, citric acid, neochlorogenic acid, N-acetylneuraminic acid, L-isoleucine, L-leucine, L-valine, glutamic acid, methionine, GABA and serotonin.

5. The use of Bifidobacterium lactis subsp. Bbm-19 as described in claim 1 in the preparation of health products for improving sleep.

Citation Information

Patent Citations

  • Probiotic agent capable of improving sleep quality and application thereof

    CN116656549A

  • Application of bifidobacterium animalis subsp. Lactis BX-245 in bacteriostasis and / or production of functional active substances

    CN116747245A