A transcription factor related to rice quality and application of its biomaterial

Abstract

The present invention discloses a transcription factor related to rice quality and the application of its biomaterial, and belongs to the technical field related to molecular biology and genetic engineering. The aforementioned transcription factor is OsMYB44. The present invention proves through experiments that compared with the rice grains of wild-type plants, the grains of mutants osmyb44a, osmyb44b and osmyb44c obtained by knocking out the gene OsMYB44 show phenotypes such as increased chalkiness rate, increased cracked grain rate, reduced brown rice rate, reduced polished rice rate and reduced whole polished rice rate. At the same time, the contents of various wax components in the peel of the mutant grains are reduced and the total wax content of the peel is reduced. It can be seen that the OsMYB44 gene can affect the quality of rice by regulating the synthesis of plant waxes, and the gene can be used for genetic improvement of rice quality.

Description

Technical Field

[0001] The invention belongs to the technical field related to molecular biology and genetic engineering, and specifically relates to a transcription factor related to rice quality and application of a biological material thereof. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world. More than half of the countries in the world use rice as their staple food. With the continuous improvement of consumption level and living taste, people's demand for high-quality rice is increasing. The goal of rice breeding has gradually changed from pursuing high yield to pursuing high yield and high quality.

[0003] Rice quality is a complex trait that reflects the opinions of producers, processors, sellers and consumers on rice production, processing, sales and consumption. It can be roughly divided into five categories: milling quality, appearance quality, cooking and taste quality, nutritional quality and hygiene quality. The milling quality of rice is mainly measured by three indicators: brown rice rate, polished rice rate and whole polished rice rate. The whole polished rice rate refers to the percentage of whole polished rice (rice grains with a length of three-quarters or more of the average length of complete rice grains) in the net rice mass after the rice is husked and milled into polished rice, which affects the final yield of rice and therefore directly determines the commercial value and economic benefits of rice. The appearance quality of rice mainly includes color, grain shape (grain length, grain width, grain thickness and aspect ratio), chalkiness (chalkiness rate and chalkiness) and transparency. The cooking and taste quality mainly includes amylose content, gelatinization temperature, gelatin consistency and taste value.

[0004] In the current national standard for high-quality rice, GB / T 17891-2017, the polished rice rate, chalkiness and taste are three indicators for grading high-quality rice. That is, the quality indicators involved in rice variety approval mainly include polished rice rate in milling quality, aspect ratio, chalkiness rate and chalkiness in appearance quality, and gelatin consistency and amylose content in cooking and taste quality.

[0005] Transcription factors, also known as trans-acting factors, can specifically bind to cis-acting elements related to gene promoter regions to activate gene expression. At present, a variety of plant-related transcription factors have been reported, such as MYB, bHLH, AP2 / ERF, WRKY and NAC, among which the MYB transcription factor family is the most widely distributed and most powerful one. The structure and function of MYB transcription factors in plants are more conservative, and they are involved to a certain extent in many stages of plant growth, such as plant growth and development (including organogenesis and growth, secondary cell wall formation and thickening, root hair development, pollen development, etc.), plant primary metabolism and secondary metabolism (accumulation of secondary metabolites such as flavonoids), hormone regulation during plant growth and development (abscisic acid, high temperature, drought, salt damage, heavy metals), etc. Therefore, in-depth research and understanding of the MYB transcription factor family is of great significance to plant breeding and improvement.

[0006] Plant wax is a lipid component present on the surface of the aerial part of the plant. Its hydrophobic structure makes wax play a very important defensive function on the surface of the plant. When the external environment changes, the wax on the surface of the plant can play a certain defensive role against environmental drought, low temperature, insect pests and mechanical damage. Therefore, studying plant wax-related genes is of great significance for improving plant resistance and crop quality. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a gene that participates in wax synthesis and affects rice quality. The technical problem to be solved is not limited to the described technical subject matter, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0008] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0009] The present invention provides an application, an application of a protein or a substance for regulating the expression of a gene encoding the protein or a substance for regulating the activity and / or content of the protein in any of the following:

[0010] M1) Regulate rice quality;

[0011] M2) preparing products for regulating rice quality;

[0012] M3) regulates wax synthesis in plants;

[0013] M4) preparing products for regulating plant wax synthesis;

[0014] M5) regulates the chalkiness of rice grains;

[0015] M6) preparing a product for regulating rice grain chalkiness;

[0016] M7) regulating the head rice rate of rice;

[0017] M8) preparing a product for regulating the rate of polished rice;

[0018] M9) regulates the crack rate of rice grains;

[0019] M10) preparing a product for regulating the crack rate of rice grains;

[0020] M11) regulates the polishing rate of rice;

[0021] M12) preparing a product for regulating rice polishing rate;

[0022] M13) regulates the brown rice rate of rice;

[0023] M14) preparing a product for regulating the brown rice rate of rice;

[0024] M15) regulate plant yield;

[0025] M16) preparing plant-derived products;

[0026] M17) regulates the rice seed setting rate;

[0027] M18) preparing products for regulating rice fruit setting rate;

[0028] M19) regulates the thousand-grain weight of rice;

[0029] M20) preparing a product for regulating rice thousand-grain weight;

[0030] M21) regulates the green grain rate of rice;

[0031] M22) preparing a product for regulating the green grain rate of rice;

[0032] The protein is the transcription factor OsMYB44.

[0033] The transcription factor OsMYB44 is any one of the following:

[0034] A1) a protein whose amino acid sequence is SEQ ID No. 1;

[0035] A2) a protein having more than 80% identity with the protein shown in A1) and having the same function as the protein shown in A1) obtained by substitution and / or deletion and / or addition of amino acid residues;

[0036] A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid shown in any one of A1) or A2).

[0037] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0038] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and searching to calculate the identity of an amino acid sequence, the value (%) of identity can then be obtained.

[0039] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0040] In the above application, the regulation is to upregulate or enhance or increase the expression of the gene encoding the aforementioned protein or the content or activity of the aforementioned protein, and the substance that regulates the expression of the gene encoding the aforementioned protein or the substance that regulates the content or activity of the aforementioned protein is a substance that increases the expression of the gene encoding the aforementioned protein in the cell.

[0041] In the above application, the regulation is to downregulate or inhibit or reduce the expression of the gene encoding the aforementioned protein or the content or activity of the aforementioned protein, and the substance that regulates the expression of the gene encoding the aforementioned protein or the substance that regulates the content or activity of the aforementioned protein is a substance that reduces the expression of the gene encoding the aforementioned protein in the cell.

[0042] The present invention also provides the use of the biomaterial related to the above protein in any of the following:

[0043] B1), RNA molecules that regulate the expression of genes encoding the aforementioned proteins or RNA molecules that regulate the activity or content of the proteins;

[0044] B2), expressing the coding gene of the RNA molecule described in B1);

[0045] B3), an expression cassette containing the gene described in B2);

[0046] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);

[0047] B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4);

[0048] B6), a transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4);

[0049] B7), transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4);

[0050] B8), a transgenic plant organ containing the gene described in B2), or a transgenic plant organ containing the expression cassette described in B3), or a transgenic plant organ containing the recombinant vector described in B4);

[0051] B9), a nucleic acid molecule encoding the aforementioned protein;

[0052] B10), an expression cassette containing the nucleic acid molecule described in B9);

[0053] B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10);

[0054] B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B3);

[0055] B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10);

[0056] B14), transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10);

[0057] B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10);

[0058] The above application is any of the following,

[0059] M1) Regulate rice quality;

[0060] M2) preparing products for regulating rice quality;

[0061] M3) regulates wax synthesis in plants;

[0062] M4) preparing products for regulating plant wax synthesis;

[0063] M5) regulates the chalkiness of rice grains;

[0064] M6) preparing a product for regulating rice grain chalkiness;

[0065] M7) regulating the head rice rate of rice;

[0066] M8) preparing a product for regulating the rate of polished rice;

[0067] M9) regulates the crack rate of rice grains;

[0068] M10) preparing a product for regulating the crack rate of rice grains;

[0069] M11) regulates the polishing rate of rice;

[0070] M12) preparing a product for regulating rice polishing rate;

[0071] M13) regulates the brown rice rate of rice;

[0072] M14) preparing a product for regulating the brown rice rate of rice;

[0073] M15) regulate plant yield;

[0074] M16) preparing plant-derived products;

[0075] M17) regulates the rice seed setting rate;

[0076] M18) preparing products for regulating rice fruit setting rate;

[0077] M19) regulates the thousand-grain weight of rice;

[0078] M20) preparing a product for regulating rice thousand-grain weight;

[0079] M21) regulates the green grain rate of rice;

[0080] M22) preparing a product for regulating the green grain rate of rice;

[0081] In the above application, B1) the RNA molecule targets the gene encoding the protein.

[0082] In some specific embodiments of the present invention, the gene encoding the protein is SEQ ID No.2, and B1) the RNA molecule targets nucleotides 13-32 of SEQ ID No.2.

[0083] In some specific embodiments of the present invention, the gene encoding the protein is SEQ ID No.2, and B1) the RNA molecule targets nucleotides 76-95 of SEQ ID No.2.

[0084] Those skilled in the art can easily mutate the nucleotide sequence encoding the above protein of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the above protein isolated by the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the above protein and have the function of the above protein.

[0085] In the above application, the nucleic acid molecule in B9) is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No.2.

[0086] Among the above substances, the expression cassette containing nucleic acid molecules described in B3) refers to the DNA capable of expressing the RNA molecules described above in host cells. The expression cassette containing nucleic acid molecules described in B9) refers to the DNA capable of expressing the proteins described above in host cells. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary for expressing the nucleic acid molecules of any of the above proteins or the DNA of the RNA molecules. The regulatory sequence can guide the coding sequence to express any of the above proteins or the DNA of the RNA molecules in a suitable host cell under its compatible conditions. The regulatory sequence includes, but is not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence and a transcription terminator. At a minimum, the regulatory sequence should include a promoter and termination signals for transcription and translation. In order to introduce specific restriction enzyme sites into the vector so as to connect the regulatory sequence to the coding region of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule, a regulatory sequence with a linker can be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates the expression of the protein or the DNA of the RNA molecule. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence can be operably connected to the 3' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any terminator that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, i.e., an mRNA non-translated region that is very important for the translation of the host cell. The leader sequence can be operably connected to the 5' end of the nucleic acid sequence encoding the protein or the DNA of the RNA molecule. Any leader sequence that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence connected to the amino terminus of the protein, which can guide the DNA encoding the protein or the RNA molecule into the cell secretory pathway. Signal peptide coding regions that can guide the expressed protein or the DNA of the RNA molecule into the secretory pathway of the host cell used can be used in the present invention. It may also be desirable to add regulatory sequences that regulate the expression of the protein or the RNA molecule according to the growth of the host cell. Examples of regulatory sequences are systems that can turn gene expression on or off in response to chemical or physical stimuli, including in the presence of regulatory compounds. Other examples of regulatory sequences are those that allow gene amplification.

[0087] In the above substances, the vector can be a plasmid, a cosmid, a phage or a virus vector.

[0088] In the above substances, the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0089] In the above substances, the transgenic plant cell lines do not include propagation materials.

[0090] The present invention also provides a method for regulating plant wax synthesis, which comprises regulating the wax synthesis of plants by regulating the substance expressing the gene encoding the protein or regulating the activity and / or content of the protein.

[0091] The present invention also provides a method for regulating rice quality, comprising regulating the rice quality by regulating the expression of the gene encoding the aforementioned protein or regulating the activity or content of the aforementioned protein.

[0092] The above rice quality can be milling quality, appearance quality, cooking and taste quality, nutritional quality and sanitary quality. Among them, milling quality includes brown rice rate, polished rice rate and whole polished rice rate; appearance quality includes color, grain shape (including grain length, grain width, grain thickness and aspect ratio), chalkiness (including chalkiness rate and chalkiness degree) and transparency; cooking and taste quality includes amylose content, gelatinization temperature, gel consistency and taste value; nutritional quality includes the content of substances such as protein, vitamins, amino acids and mineral elements. Sanitary quality mainly refers to the safe edibility of rice.

[0093] The present invention also provides a method for regulating plant yield, the method comprising regulating the yield of the plant by regulating the expression of the coding gene of the aforementioned protein or regulating the activity or content of the aforementioned protein. The above-mentioned yield can be fruit setting rate, grain weight, number of effective tillers, number of grains per ear and maturity.

[0094] The present invention also provides a method for regulating plant stress resistance, which comprises regulating the plant stress resistance by regulating the expression of the gene encoding the aforementioned protein or regulating the activity or content of the aforementioned protein.

[0095] The present invention also provides a method for regulating plant hormones, wherein the method regulates the hormone level of the plant by regulating the expression of the gene encoding the aforementioned protein or regulating the activity or content of the aforementioned protein.

[0096] The plant in the above method is any one of the following:

[0097] G1) dicotyledonous plants or monocotyledonous plants;

[0098] G2) Graminales;

[0099] G3) Gramineae;

[0100] G4) Oryza;

[0101] G5) Rice.

[0102] The present invention also provides a method for regulating the wax synthesis, rice quality, rice yield, fruit setting rate, 1000-grain weight, brown rice rate, polished rice rate, chalky rate, green grain rate and / or crack rate of rice, the method comprising regulating the wax synthesis, rice quality, rice yield, fruit setting rate, 1000-grain weight, brown rice rate, polished rice rate, chalky rate, green grain rate and / or crack rate of rice by regulating the substance expressed by the gene encoding the aforementioned protein or regulating the activity and / or content of the protein.

[0103] In the above method, the regulation is to upregulate, enhance or increase the expression of the gene encoding the aforementioned protein or the content or activity of the aforementioned protein, and the substance that regulates the expression of the gene encoding the aforementioned protein or the substance that regulates the content or activity of the aforementioned protein is a substance that increases the expression of the gene encoding the aforementioned protein in the cell.

[0104] In the above method, the regulation is to downregulate or inhibit or reduce the expression of the gene encoding the aforementioned protein or the content or activity of the aforementioned protein, and the substance that regulates the expression of the gene encoding the aforementioned protein or the substance that regulates the content or activity of the aforementioned protein is a substance that reduces the expression of the gene encoding the aforementioned protein in the cell.

[0105] The above-mentioned proteins or biological materials also fall within the protection scope of the present invention.

[0106] The present invention also provides a mutant osmyb44a, in which the OsMYB44 genes in two homologous chromosomes of the mutant undergo the following mutation: a T is inserted between the 16th and 17th bases of SEQ ID No.2 (i.e., the 6th base of SEQ ID No.3), thereby causing a frameshift mutation and prematurely terminating at the 303rd amino acid of SEQ ID No.1.

[0107] The present invention also provides a mutant osmyb44b, wherein the OsMYB44 genes in the two homologous chromosomes of the mutant have the following mutations: the bases 8 to 32 of SEQ ID No. 2 are deleted, a total of 25 bp (i.e., bases 3 to 11 of SEQ ID No. 3), thereby causing a frameshift mutation, and premature termination at the 3rd amino acid of SEQ ID No. 1;

[0108] The present invention also provides a mutant osmyb44c, in which the OsMYB44 genes in two homologous chromosomes of the mutant undergo the following mutations: the 16th base T of SEQ ID No.2 (i.e., the 6th base of SEQ ID No.3) is deleted, thereby causing a frameshift mutation and premature termination at the 11th amino acid of SEQ ID No.1.

[0109] The mutant was created by introducing a substance capable of editing OsMYB44 into rice.

[0110] Specifically, the substance capable of editing OsMYB44 may be a vector capable of expressing RNA targeting the coding gene (SEQ ID No. 1) of OsMYB44. The RNA targeting the coding gene (SEQ ID No. 1) of OsMYB44 targets nucleotides 13-32 or nucleotides 76-95 of SEQ ID No. 2. The vector may be a plasmid, preferably a CRISPR / Cas9 plasmid.

[0111] Specifically, the rice is Nipponbare rice.

[0112] The present invention edited the exon region of OsMYB44 of Nipponbare rice by CRISPR / Cas9 technology, and obtained three CRISPR homozygous mutant plants of different genotypes, which were named osmyb44a, osmyb44b and osmyb44c. Compared with the wild-type Nipponbare, the mutant plants had reduced thousand-grain weight, reduced wax content in the brown rice pericarp, increased chalkiness rate of brown rice grains, increased green grain rate, increased cracked grain rate, and reduced polished rice rate. These phenotypes all indicate that the OsMYB44 gene is involved in the regulation of rice yield and rice quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0113] Figure 1 The pictures and related data show the gene structure of OsMYB44, the editing results of three CRISPR editing targets, and the corresponding mutant plants and ears.

[0114] Figure 2 To detect the expression level and subcellular localization of OsMYB44 in seeds at different stages.

[0115] Figure 3 OsMYB44 is involved in wax synthesis.

[0116] Figure 4 OsMYB44 affects rice quality. DETAILED DESCRIPTION

[0117] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0118] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0119] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0120] The pYLCRISPR / Cas9 and pYLsgRNA series vectors in the following examples are described in the document "A Robust CRISP R / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Xingliang Ma, Qunyu Zhang, Qinlong Zhu, Wei Liu, YanChen, Rong Qiu, Bin Wang, Zhongfang Yang, Heying Li, Yuru Lin, Yongyao Xie, Rongxin Shen, Shuifu Chen, Zhi Wang, Yuanling Chen, Jingxin Guo, Letian Chen, Xiucai Zhao, Zhicheng Dong and Yao-Guang Liu. Molecular Plant. 2015 August; 8: 1274-1284." The pYLCRISPR / Cas9 vector used in this example is described in the aforementioned document as "pYLCRISPR / Cas9Pubi-H", and its structure is as described in the aforementioned document. Figure 1 As shown in Figure B. The structure of the pYLsgRNA series vectors is as described in the previous literature. Figure 1 As shown in Figure C, pYLsgRNA-OsU3, pYLsgRNA-OsU6a, pYLsgRNA-OsU6b, pYLsgRNA-OsU6c, pYLsgRNA-AtU3d, pYLsgRNA-AtU6-1 and pYLsgRNA-AtU6-29 are included, and OsU3, OsU6a, OsU6b, OsU6c, AtU3d, AtU6-1 and AtU6-29 are different promoters. The public can obtain pYLCRISPR / Cas9 and pYLsgRNA vectors from the Institute of Botany, Chinese Academy of Sciences. The biological materials are only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0121] N6D culture medium formula: 4g / L Chu(N6)Basal Salt Mixture powder+2mg / L glycine+0.5mg / L niacin+0.5mg / L vitamin B6+1mg / L vitamin B1+1mg / L2,4-D+0.3g / L hydrolyzed casein+2.878g / L proline+0.1g / L inositol+30g / L sucrose+4g / L plant gel, pH 5.8.

[0122] Formula of co-culture medium 2N6-AS: 4g / L Chu(N6)Basal Salt Mixture powder+2mg / L glycine+0.5mg / L niacin+0.5mg / L vitamin B6+1mg / L vitamin B1+1mg / L2,4-D+0.3g / L hydrolyzed casein+0.1g / L inositol+30g / L sucrose+30g / L glucose+5g / L plant gelatin+10mg / L acetosyringone, pH 5.2.

[0123] AAM culture medium formula: AAM macro (0.25g / L MgSO4·7H2O+0.15g / L NaH2PO4·2H2O+0.15g / LCaCl2·2H2O+3g / L KCl), AAM micro (10mg / L MnSO4·4H2O+2mg / L MnSO4·4H2O+0.025mg / LCuSO4·5H2O+0.25mg / L Na2MoO4·2H2O+0.025mg / L CoCl2·6H2O+0.75mg / L KI+3mg / L H3BO3) + iron salt (27.8mg / L FeSO4·7H2O+37.3mg / L Na2-EDTA) + 0.5g / L hydrolyzed casein + 7.5mg / L glycine + 0.1767g / L arginine + 0.9g / L glutamine + 0.3g / L aspartic acid + 0.1g / L inositol + 1mg / L niacin + 1mg / L vitamin B6 + 10mg / L vitamin B1 + 68.5g / L sucrose + 36g / L glucose + 10mg / L acetosyringone, pH 5.2.

[0124] Screening medium S1 formula: N6D medium + 25 mg / L hygromycin + 400 mg / L carbenicillin, pH 5.8.

[0125] Screening medium S2 formula: N6D medium + 50 mg / L hygromycin + 400 mg / L carbenicillin, pH 5.8.

[0126] Differentiation medium RE-III formula: 4.4g / L MS (Sigma) + 2g / L hydrolyzed casein + 0.0002mg / L NAA + 2mg / L KT + 30g / L sucrose + 30g / L sorbitol + 4g / L plant gel + 50mg / L hygromycin + 200mg / L carbenicillin, pH 5.8.

[0127] 1 / 2MS culture medium formula: 2.2g / L MS (Sigma) + 15g / L sucrose + 4g / L plant gel, pH 5.8.

[0128] The following examples used GraphPad Prism 8 statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. T test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated an extremely significant difference.

[0129] The name of the funding project for this invention is “STI 2030-Major Project (2023ZD04069). The English annotation is “STI 2030-Major Project (2023ZD04069)”.

[0130] Example 1: Preparation of rice OsMYB44 mutants and overexpression strains

[0131] 1. Genome, coding region and amino acid sequence of OsMYB44

[0132] The amino acid sequence of OsMYB44 is SEQ ID No.1, the nucleotide sequence of OsMYB44 is SEQ ID No.2, and the genome sequence of OsMYB44 is SEQ ID No.3.

[0133] 2. Generate rice OsMYB44 mutants using CRISPR / Cas9 system

[0134] The CRISPR / Cas9 system was used to edit the rice OsMYB44 gene to obtain the transgenic rice OsMYB44 gene mutant. The specific steps are as follows:

[0135] 1. Selection of target sequence

[0136] Target site T1: 5'-CCCTCCTTCTCGCAACACGG-3', located at nucleotides 13-32 of SEQ ID No. 2 (ie, 13-32 upstream of the ATG of the rice OsMYB44 gene).

[0137] Target site T2: 5'-GCGTCGTACGTGCAGGAGCA-3', located at nucleotides 76-95 of SEQ ID No. 2 (i.e., 76-95 downstream of the ATG of the rice OsMYB44 gene).

[0138] 2. Construction of CRISPR / Cas9 vector

[0139] (1) T1-F and T1-R are mixed and then denatured and annealed to prepare the T1 target linker, and T2-F and T2-R are mixed and then denatured and annealed to prepare the T2 target linker.

[0140] T1-F:5'-ggcA CCCCTCTCTCGCAACACGG-3';

[0141] T1-R:5'-aaaC CCGTGTTGCGAGAAGGAGGG-3';

[0142] T2-F:5'-gccGGCGTCGTACGTGCAGGAGCA-3';

[0143] T2-R:5'-aaaCTGCTCCTGCACGTACGACGC-3'.

[0144] The four bases at the 5' end of the primer are complementary bases to the sticky end after cleavage by Bsa I. The capital letters in the F strand and the R strand are the target sequence or its reverse complementary sequence.

[0145] (2) The T1 target linker was connected to Bsa I-HF (NEB, trade name The gRNA gene expression cassette gRNA-U3-OsMYB44-T1 containing the target site T1 driven by the OsU3 promoter was obtained after the reaction of the T2 target site linker with Bsa I-HF, pYLsgRNA-OsU6a, and T4 ligase. The gRNA gene expression cassette gRNA-U6a-OsMYB44-T2 containing the target site T2 driven by the OsU6a promoter was obtained after the reaction of the T2 target site linker with Bsa I-HF, pYLsgRNA-OsU6a, and T4 ligase.

[0146] The construction principle of this part: the pYLsgRNA series vectors contain three Bsa I restriction endonuclease recognition sites. After Bsa I digestion, the pYLsgRNA-OsU3 vector can obtain sgRNA-OsU3, and the pYLsgRNA-OsU6a vector can obtain sgRNA-OsU6a. The complementary bases of the F chain of the aforementioned T1 target linker are complementary to the exposed end of OsU3 in the sgRNA-OsU3 obtained after Bsa I digestion, and the complementary bases of the R chain are complementary to the exposed end of sgRNA in the sgRNA-OsU3 obtained after Bsa I digestion. The complementary bases of the F chain of the aforementioned T2 target linker are complementary to the exposed end of OsU6a in the sgRNA-OsU6a obtained after Bsa I digestion, and the complementary bases of the R chain are complementary to the exposed end of sgRNA in the sgRNA-OsU6a obtained after Bsa I digestion.

[0147] (3) gRNA-U3-OsMYB44-T1 and gRNA-U6a-OsMYB44-T2 were amplified by two rounds of PCR using gRNA expression cassette amplification primers for ligation to pYLCRISPR / Cas9.

[0148] The gRNA expression cassette amplification primer information is as follows:

[0149] First round amplification primers:

[0150] UF:5'-CTCCGTTTTACCTGTGGAATCG-3';

[0151] gRNA-R:5'-CGGAGGAAAATTCCATCCAC-3'.

[0152] Second round amplification primers:

[0153] The position-specific primers for each target site are as follows:

[0154] T1 and T2: SpeI

[0155] Uctcg-B1':5'-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3';

[0156] gRctga-B2:5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3';

[0157] Uctga-B2':5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3';

[0158] gRcggt-BL: 5'-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3' (complementary to the RB side BR of the pYLCRISPR / Cas9 vector), the last target site (Last site) is MluI.

[0159] Note: B1' is the upstream primer of the promoter (U3), B2 is the downstream primer of gRNA in the second round of PCR; Uctcg-B2' is complementary to the end of BL on the RB side of the pYLCRISPR / Cas9 vector after BsaI digestion. gRcggt-BL is complementary to the end of BR on the RB side of the pYLCRISPR / Cas9 vector after BsaI digestion. Lowercase letters such as ctcg and tcag are the ends used for connection after BsaI digestion.

[0160] (6) The amplified gRNA expression cassette was digested with Bsa I, and then connected to the plasmid pYLCRISPR / Cas9 digested with Bsa I, transformed into DH5α, obtained a recombinant plasmid, and sequenced. The correctly sequenced vector was named pYLCRISPR / Cas9-U3T1-U6aT2, which contained a gRNA gene expression cassette (U3T1) driven by the U3 promoter with a target of T1 and a gRNA gene expression cassette (U6aT2) driven by the U6a promoter with a target of T2.

[0161] 3. Obtaining genetically modified rice

[0162] The pYLCRISPR / Cas9-U3T1-U6aT2 vector obtained in step 2 was transferred to the Agrobacterium tumefaciens competent cell EHA105 by freeze-thaw method to obtain the recombinant bacteria EHA105 / pYLCRISPR / Cas9-U3T1-U6aT2.

[0163] The wild-type Nipponbare rice was transformed by Agrobacterium-mediated genetic transformation to obtain homozygous mutant rice osmyb44a, osmyb44b and osmyb44c with OsMYB44 gene mutation. The specific transformation method is as follows:

[0164] a. Seed disinfection: soak in 70-75% ethanol for one minute, rinse once with ddH2O, soak in 2.5% sodium hypochlorite for about 20 minutes, and wash 5 times with sterile water.

[0165] b. Callus induction: Place the sterilized seeds on callus induction medium N6D in a light incubator at 32°C with 24 hours of light for about 6 days. Cut the grown callus and transfer it to fresh callus induction medium N6D, and continue to culture in a 32°C continuous light incubator for 3 days.

[0166] c. Infection: Collect and culture until OD 600nm The recombinant bacteria EHA105 / pYLCRISPR / Cas9-U36-T1T2 with a value of about 0.5-0.8 were resuspended in 30-40 ml AAM solution to obtain EHA105 / pYLCRISPR / Cas9-U36-T1 T2 infection solution. The callus tissue was then placed in the aforementioned infection solution for infection. After infection for 3 minutes, the callus tissue was transferred to sterile filter paper to absorb the infection solution.

[0167] d. Co-cultivation: The infected callus was transferred to the co-cultivation medium 2N6-AS covered with sterile filter paper and cultured at 25°C in the dark for 3 days.

[0168] e. Screening: Wash the callus with sterile water several times until the Agrobacterium is clean, then add sterile water containing carboxybenzyl (500 mg / L) and wash 3-4 times, each time for 15 minutes (90rpm), then dry the water on sterile filter paper, and finally transfer to screening medium S1 and culture at 25°C in the dark for 3-4 days.

[0169] f. Screening: Transfer to screening medium S2 and place in an incubator with continuous light at 32°C for about 2 weeks. Observe the status of newly grown callus at any time. If the status is good, transfer to differentiation medium RE-III.

[0170] g. Differentiation: Culture on differentiation medium RE-III for 6-7 days, then transfer to fresh differentiation medium for 6-7 days. Generally, seedlings will grow on the second differentiation medium, and then the seedlings can be transferred from the differentiation medium to 1 / 2MS medium. After culture for a period of time, seedlings are obtained. After the seedlings are tested and identified as positive plants, they are marked as T0 generation rice.

[0171] 4. Identification of transgenic rice with mutation in OsMYB44 gene

[0172] The T0 rice genomic DNA obtained in step 3 was extracted and PCR amplified using the following primer pairs.

[0173] OsMYB44_F: 5'-TAAGCTCAAGCTTCCTTCCATCTGG-3';

[0174] OsMYB44_R: 5'-GGTGGGTGTTTCCAGAAGTTCTTGAC-3'.

[0175] The PCR amplification product was sent to a biological company for sequencing and analysis to obtain the mutation information of the OSMYB44 gene. The results were compared with the OsMYB44 gene in wild-type rice. Figure 1As shown in A, the T0 generation rice mutant osmyb44a has an A inserted after the 16th position of the translation start site ATG of the OsMYB44 gene, a frameshift mutation, and the 303rd amino acid terminates prematurely; the rice mutant osmyb44b has a 25bp deletion after the 9th position after the ATG of the translation start site of the OSMYB44 gene, a frameshift mutation, and the 3rd amino acid terminates prematurely; the rice mutant osmyb44b has a T deletion after the 16th position after the ATG of the translation start site of the OSMYB44 gene, a frameshift mutation, and the 11th amino acid terminates prematurely.

[0176] 5. Genotype identification of T1 transgenic rice

[0177] The T0 generation OSMYB44 gene mutant rice plants obtained in step 4 are harvested to obtain T1 generation seeds, which are then propagated to obtain homozygous T2 generation seeds.

[0178] The genotype of OSMYB44 gene in T1 transgenic rice was identified as follows: PCR amplification was performed with OsMYB44_F / OsMYB44_R using genomic DNA from leaves of T1 transgenic rice as template to obtain PCR amplification products of different strains. Individual plants with homozygous mutant OsMYB44 were selected based on sequencing results and named as homozygous mutant osmyb44a, osmyb44b and osmyb44c rice for subsequent research.

[0179] Compared with wild-type rice, the OsMYB44 gene in the two homologous chromosomes of the homozygous mutant osmyb44a rice underwent the following mutation: a T was inserted between the 16th and 17th bases of SEQ ID No.2 (i.e., the 6th position of SEQ ID No.3), resulting in a frameshift mutation and premature termination at the 303rd amino acid of SEQ ID No.1.

[0180] Compared with wild-type rice, the OsMYB44 gene in the two homologous chromosomes of the homozygous mutant osmyb44b rice underwent the following mutation: the 8th to 32nd bases of SEQ ID No.2 were deleted, totaling 25 bp (i.e., the 3rd to 11th bases of SEQ ID No.3), resulting in a frameshift mutation and premature termination at the 3rd amino acid of SEQ ID No.1.

[0181] Compared with wild-type rice, the OsMYB44 gene in the two homologous chromosomes of the homozygous mutant osmyb44c rice underwent the following mutation: the 16th base T of SEQ ID No.2 (i.e., the 6th base of SEQ ID No.3) was deleted, resulting in a frameshift mutation and premature termination at the 11th amino acid of SEQ ID No.1.

[0182] 3. Obtaining OsMYB44 overexpression strains

[0183] 1. Vector construction

[0184] Using OsMYB44 cDNA as a template, high-fidelity polymerase Q5 and primer pair OsMYB44-OE-F / R were used to amplify the CDS region of the OsMYB44 gene to obtain an amplified product. The amplified product and the pCambia1392 vector (its nucleotide sequence is shown in the following "pC ambia1392 vector sequence") were double-digested with BamHI / SpeI, and then sequenced after ligation with T4 ligase. After verifying that the sequence is correct, Escherichia coli DH5α was transformed, and the plasmid was extracted to obtain a recombinant expression vector. The recombinant expression vector pCambia1392-OSMYB44 is a recombinant expression vector that replaces a small fragment between the BamHI and SpeI restriction sites of the pCambia1392 vector with a DNA molecule and keeps other sequences unchanged. The recombinant expression vector expresses the protein OsMYB44 with an amino acid sequence of SEQID No.1. The DNA molecule is a sequence with an HA tag added thereto, which is obtained by connecting SEQ ID No. 2 and the HA sequence (5'-TACCCATACGACGTCCCAGACTACGCT-3') in a 5'-3' direction.

[0185] OsMYB44-OE-F:

[0186] 5′-ataGGATCCATGGGGCGGCCGCCGTGTTGCGAGAA-3′ (bold letters indicate BamHI restriction enzyme recognition site);

[0187] OsMYB44-OE-R:

[0188] 5'-ggACTAGTAGCGTAGTCTGGGACGTCGTATGGGTAgaaagcgtaattacggaga-3' (the bold letters indicate the SpeI restriction enzyme recognition site).

[0189] 2. Preparation of recombinant bacteria containing overexpression vectors

[0190] The recombinant expression vector pCambia1392-OsMYB44 was introduced into Agrobacterium tumefaciens EHA105 by freeze-thaw method to obtain the recombinant bacteria EHA105 / pCambia1392-OsMYB44.

[0191] 3. Preparation of overexpression strains

[0192] The wild-type Nipponbare rice was transformed by Agrobacterium-mediated genetic transformation to obtain rice homozygous for overexpression of the OsMYB44 gene. The specific transformation method is the same as above (“ag” in “3. Obtaining transgenic rice” in Part 2), in which the recombinant bacteria was changed to EHA105 / pCambia1392-OsMYB44).

[0193] 4. Western blot detection of OsMYB44 expression in overexpression strains

[0194] Extraction buffer formula: 150mM NaCl, 2mM EDTA, 0.5% NP-40, 0.1% SDS, 50mM Tris-HCl, protease inhibitor cocktail (name: EDTA-free Protease Inhibitor Cocktail, Roche product, catalog number 4693132001) and Phos-STOP phosphatase inhibitor (name: PhosSTOP phosphatase inhibitor, Easybio product, catalog number 04906845001).

[0195] Western blot operation is as follows: Take rice panicles and grind them thoroughly in liquid nitrogen. Add 3 ml of extraction buffer to each gram of sample tissue and vortex to mix. Centrifuge at 4°C, 20,000×g for 5 minutes, and transfer the supernatant to a new centrifuge tube. Load the same amount of protein and transfer to the membrane after electrophoresis. Transfer the transferred PVDF membrane to 5% BSA blocking buffer and incubate at room temperature for 1 hour. Then add the primary antibody (name: Anti-GFP Tag Rabbit Polyclonal Antibody, EarthOx product, item number E022200-1) and incubate at 4°C overnight. After washing three times with TBST, add the secondary antibody and incubate for hybridization at room temperature for 1 hour. Wash three times with TBST again, and then expose to light.

[0196] 5. OsMYB44 overexpression lines have increased wax content

[0197] The water drop method was used to detect that the wax content on the leaf surface of the overexpression plants was higher than that of the wild-type Nipponbare plants.

[0198] 4. Determination of wax content, rice quality and yield

[0199] The experiments were repeated at least three times.

[0200] OsMYB44 group: The mutants osmyb44a, osmyb44b and osmyb44c were planted in Beijing in summer. After the plants were full of fruit, the plant height, tillering, fruit setting rate, 1000-grain weight, ear weight, number of grains per ear, and yield per plant were counted. After that, the mature rice was harvested individually, and the harvested rice seeds were placed in a cool place for shade drying. When the moisture content of the rice was lower than 10%, the rice quality (such as chalky rate, green grain rate, cracked grain rate, brown rice rate, polished rice rate and whole polished rice rate, etc.) and wax content were determined. The rice quality determination method refers to the national standard GB1350 "Rice".

[0201] Determination of chalkiness rate: Rice ears are threshed by individual plants, and the husks of rice grains are removed to obtain brown rice. Unripe grains (green grains and unfull grains) and diseased and insect-damaged grains (with yellow spots or black spots) are removed from the brown rice, and only mature and full brown rice grains are retained. 200 full and mature brown rice grains are randomly selected from each rice plant, and the chalkiness phenotype is counted using the rice appearance quality tester JMWT 12, and the count is repeated for at least three individual plants. The chalkiness rate is chalkiness grains / total number of grains*100%.

[0202] Determination of green grain rate: 200 mature and full rice grains were randomly selected from each individual plant, and the husks were removed to obtain brown rice. The percentage of green grains in the brown rice to the total number of brown rice was the green grain rate.

[0203] Determination of cracked grain rate: thresh the rice ears by individual plants, manually remove the palea to obtain brown rice, and remove immature grains (green grains or unfull grains) and diseased and insect-damaged grains (with yellow spots or black spots). Randomly take out 200 full and mature brown rice grains from each individual plant, observe them under the Japanese Kett rice grain perspective instrument TX-200, count the number of cracked (a) and broken (b) brown rice grains, and calculate the field cracked grain rate = (a+b)%. Repeat the statistics for at least three individual plants. Alternatively, use a constant temperature and humidity chamber to induce cracks: randomly select 100 full and disease-free grains from each rice individual plant grain sample with a moisture content of less than 10%, and put them in a water-proof nylon mesh bag; fold the seed bag mouth and pin it with a paper clip to prevent the seeds from spilling; write the sample number on a water-proof plastic label and hang it outside the nylon mesh bag. Set up the binder constant temperature and humidity chamber (Program 7) to stabilize the conditions in the chamber to 22±2°C, 12±5%RH. Transfer the rice grain samples packed in nylon bags to the constant temperature and humidity chamber stand, lay the bags flat, shake the grains loose, and ensure that the grains are laid in one layer without overlapping each other. Close the glass door and iron door of the constant temperature and humidity chamber, maintain Program 7, and when the conditions in the chamber reach 22±2℃, 12±5%RH, stabilize in the pre-treatment for at least 30min. Drying pretreatment: The constant temperature and humidity chamber is adjusted to Program 5, 46±2℃, 12±5%RH, 60min; about 26min after setting, the temperature reaches 44℃, and the timing treatment starts for 30min. Explosion induction: Adjust to Program 6, 46±2℃, 98±5%RH, 50min; about 3-4min after setting, the humidity reaches 90%, and the timing treatment starts for 40min. Drying: Adjust to Program 7, 22±2℃, 12±5%RH, 24h. After drying, the lemma was manually peeled off to obtain brown rice, and immature grains and grains with diseases and insect pests were removed. The rice grains were observed under the rice grain perspective instrument TX-200, and the number of cracked (a) and broken (b) brown rice grains was counted to calculate the induced cracking rate = (a+b)%.

[0204] Determination of brown rice rate: weigh mature rice grains, peel off the husks of the weighed rice grains to obtain brown rice, weigh the brown rice, and the percentage of the weight of the brown rice to the weight of the rice grains is the brown rice rate. Repeat the statistics at least three times.

[0205] Determination of polished rice rate: The brown rice obtained by the above-mentioned brown rice rate is subjected to removal of the bran layer and the germ, and polished to obtain polished rice. The percentage of the weight of the polished rice to the weight of the paddy rice is the polished rice rate.

[0206] Determination of whole polished rice rate: Remove broken rice from the above polished rice, sort out the whole polished rice and weigh it. The percentage of the weight of the whole polished rice to the weight of the rice is the whole polished rice rate.

[0207] Wax determination on the surface of brown rice pericarp: The rice ears were threshed by individual plants, and the palea were manually peeled off (wearing gloves throughout the process) to obtain brown rice, and immature grains (green grains or unfull grains) and diseased and insect-damaged grains (with yellow spots or black spots) were removed. 20 full and mature brown rice grains were randomly taken out from each individual plant, weighed and recorded, and the weighed brown rice grains were placed in a 4ml glass bottle. 1ml of chloroform preheated at 55℃ was added to the glass bottle, and after 1min of water bath treatment at 55℃, the extract was transferred to a new glass bottle, and the above operation was repeated for a total of 3 times to obtain about 3ml of extract. C24 standard was added to the extract, and the liquid was mixed and nitrogen blown. Then, pyridine and BSTFA were added to the small glass bottle after nitrogen blown, and derivatization treatment was performed at 70℃ for 50min. After the sample was cooled, the wax was determined by GC-QQQ.

[0208] Wax determination of germ rice: Remove the rice bran layer from brown rice to obtain germ rice. Grind the germ rice into powder with a ball mill at 28.0Hz for 40s, scrape all the powder onto weighing paper with a small spoon and weigh it on a 1 / 10,000 balance. Divide the weighed powder into three equal parts by weight and pour it into a 0.45um nylon filter centrifuge tube. Write the number on the tube and record the number of milligrams of each sample. Then add 600ul of chloroform preheated at 55℃ to the centrifuge tube, let it stand for 1min, centrifuge at 800rpm for 1min, and carefully draw the lower layer of liquid into a clean and dried glass bottle. Repeat the above operation 5 times to obtain about 3ml of extract, add C24 standard to the extract, mix the liquid and blow it with nitrogen, then add pyridine and BSTFA to the small glass bottle after nitrogen blowing, derivatize it at 70℃ for 50min, and use GC-QQQ to determine the wax after the sample cools down.

[0209] Wild-type rice Nipponbare (WT): OsMYB44 plants were replaced with wild-type rice Nipponbare plants, and other operations were the same as the OsMYB44 group.

[0210] The experimental results showed that compared with the wild type, the thousand-grain weight of the mutant plants was reduced ( Figure 1 Middle E), chalkiness rate increased ( Figure 4 Middle E), green grain rate increased ( Figure 4 I), crack particle rate increased ( Figure 4 F and G), the time for cracks to occur during immersion is shorter ( Figure 4 B, C and D), brown rice rate reduction, polished rice rate reduction ( Figure 4 J and K), the head rice rate is reduced ( Figure 4 H and L), the wax content on the surface of brown rice peel decreased ( Figure 3 These data indicate that OsMYB44 may affect rice yield and quality to some extent by participating in the wax biosynthesis pathway.

[0211] 5. Expression level detection and subcellular localization at different seed stages

[0212] 1. Expression level detection at different seed stages

[0213] The rice flowers were marked during the flowering period, and materials were collected at 0 days (i.e., 0 DAF), 4 days (i.e., 4 DAF), 8 days (i.e., 8 DAF), 12 days (i.e., 12 DAF), 16 days (i.e., 16 DAF), and 20 days (i.e., 20 DAF) after flowering for RNA extraction. The extracted RNA was reverse transcribed to obtain cDNA for qPCR identification. The identification results are as follows: Figure 2 As shown in center A, the expression level of OsMYB44 was relatively high in the late stage of seed development.

[0214] 2. Subcellular localization

[0215] The expression position of a gene in a cell has a great influence on the function of the gene. Understanding the subcellular localization of a gene has a good reference value for predicting the function of the gene. The inventor analyzed the amino acid sequence of OsMYB44 and found a nuclear localization signal peptide at the N-terminus. Therefore, the inventor transiently co-expressed OsMYB44-GFP and the nuclear localization marker H2B-mCherry in rice protoplasts. The results showed that OsMYB44 and H2B-mCherry were co-localized in the cell nucleus. In order to verify this result, the inventor transiently expressed OsMYB44-GFP, and observed under a microscope after DAPI staining. It was found that the DAPI-stained cell nucleus co-localized with the green fluorescence expressed by OsMYB44-GFP ( Figure 2 This result verified the conclusion that OsMYB44 is localized in the cell nucleus.

[0216] 3. Transcription Activation Activity Detection

[0217] The inventors detected the transcriptional activation activity of OsMYB44 by yeast system. First, the bait plasmid pGBKT7 was double-digested at the two restriction sites of BamHI and EcoRI, and then the OsMYB44 CDS sequence was connected by homologous recombination to construct the bait vector BD-OsMYB44. The inventors then transferred the vector into yeast and cultured the yeast by shaking. When the bacterial solution OD600 = 0.4, it was diluted to 1 / 1, 1 / 10, 1 / 100 and 1 / 1000 and plated on SD / -Trp / X-α-Gal and SD / -Trp / X-α-Gal / AbA (200ng / mL) culture medium (with empty BD vector as control). After the plate was completed, the culture medium was inverted and cultured in a 30°C incubator for 3-5 days. After the culture was completed, the inventors found that the yeast colonies of BD-OsMYB44 were blue, and even blue colonies grew on the SD / -Trp / X-α-Gal / AbA (200ng / mL) culture medium, which indicates that this protein may have self-activation. In order to verify the result, the inventors used the BD-OsMYB44 vector and empty AD co-transfection method to verify it again. At the same time, pGBKT7-Lam+pGADT7-T was used as a negative control, and pGBKT7-53+pGADT7-T was used as a positive control. The cells were cultured on SD / -Leu / -Trp, SD / -His / -Leu / -Trp, and SD / -Ade / -His / -Leu / -Trp culture media, respectively. The results showed that the BD-OsMYB44 yeast colonies still grew well on the three-deficiency and four-deficiency culture media. This result shows that OsMYB44 has self-activation phenomenon ( Figure 2 (C), because OsMYB44 is a transcription factor, it indicates that it has transcriptional activation activity.

[0218] The above embodiments involve the following sequences:

[0219] OsMYB44 amino acid sequence (SEQ ID No. 1):

[0220] MGRPPCCEKEGVKKGPWTPEEDMVLASYVQEHGPGNWRAVPPRTGLLRCSKSCRLRWTNYLRPGIRRGGFSHHEERLILHLQALLGNRWAAIASYLPHRTDNDVKNFWNTHLKKKLALTSSSSSPPTPTTPLVARGQWERKLQTDIDLARRALRDALSVDDAASPAMISSGPPAPAAAAAYALSERNISVMLSGWAAPPPARKGLSACNPAAATTTPGGAAAESASTAGTSLELTADCCSGGGDSSASNCLPSSMLLACDDGDATATAAGVAPLSAIESWLLLDDSGEPQLALDEQLLDVALRNYAF。

[0221] Coding region of OsMYB44 (SEQ ID No.2): (Lowercase italic letters are two target sites)

[0222] 5'-ATGGGGCGGCCGccgtgttgcgagaaggagggGGTGAAGAAGGGGCCATGGACGCCGGAGGAGGACATGGTGC TGgcgtcgtacgtgcaggagcaCGGCCCGGGCAACTGGCGCGCCGTGCCGCCCAGGACGGGCCTCCTCCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGCCGCGGCGGCTTCTCCCACCACGAGGAGCGCCTCATCCTCCACCTCCAGGCCCTCCTCGGCAACCGCTGGGCCGCCATCGCCTCCTACCTCCCCCACCGCACCGACAACGACGTCAAGAACTTCTGGAACACCCACCTCAAGAAGAAGCTCGCCCTCACCTCCTCCTCCTCCTCGCCGCCGACGCCGACGACGCCGCTCGTCGCCAGGGGGCAGTGGGAGCGCAAGCTGCAGACCGACATCGACCTCGCCAGGCGCGCCCTCCGCGACGCCCTCTCCGTCGACGACGCCGCCTCCCCGGCGATGATCAGCAGCGGGCCGCCCGCGCCGGCGGCGGCGGCGGCGTACGCCCTGAGCGAGCGCAACATCTCCGTGATGCTGAGCGGCTGGGCGGCGCCGCCTCCGGCCAGGAAAGGATTGTCAGCCTGCAACCCGGCGGCGGCGACGACGACGCCCGGTGGCGCCGCCGCGGAGAGCGCGTCCACGGCCGGGACGTCGTTGGAGCTCACCGCCGACTGCTGCTCCGGCGGCGGCGACTCCAGCGCGTCCAACTGCCTGCCGTCGTCCATGCTCCTCGCGTGCGACGACGGCGACGCGACGGCGACGGCGGCCGGGGTGGCGCCGCTGTCGGCGATCGAGTCGTGGCTGCTGCTCGACGACAGCGGAGAGCCGCAGCTGGCACTGGACGAGCAGCTGCTGGACGTAGCTCTCCGTAATTACGCTTTCTAA-3'.

[0223] Genome of OsMYB44 (SEQ ID No. 3):

[0224] 5'-ATGGGGCGGCCGCCGTGTTGCGAGAAGGAGGGGGTGAAGAAGGGGCCATGGACGCCGGAGGAGGACATGGTGC TGGCGTCGTACGTGCAGGAGCACGGCCCGGGCAACTGGCGCGCCGTGCCGCCCAGGACGGGCCTCCTCCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGCCGCGGCGGCTTCTCCCACCACGAGGAGCGCCTCATCCTCCACCTCCAGGCCCTCCTCGGCAACCGCTGGGCCGCCATCGCCTCCTACCTCCCCCACCGCACCGACAACGACGTCAAGAACTTCTGGAACACCCACCTCAAGAAGAAGCTCGCCCTCACCTCCTCCTCCTCCTCGCCGCCGACGCCGACGACGCCGCTCGTCGCCAGGGGGCAGTGGGAGCGCAAGCTGCAGACCGACATCGACCTCGCCAGGCGCGCCCTCCGCGACGCCCTCTCCGTCGACGACGCCGCCTCCCCGGCGATGATCAGCAGCGGGCCGCCCGCGCCGGCGGCGGCGGCGGCGTACGCCCTGAGCGAGCGCAACATCTCCGTGATGCTGAGCGGCTGGGCGGCGCCGCCTCCGGCCAGGAAAGGATTGTCAGCCTGCAACCCGGCGGCGGCGACGACGACGCCCGGTGGCGCCGCCGCGGAGAGCGCGTCCACGGCCGGGACGTCGTTGGAGCTCACCGCCGACTGCTGCTCCGGCGGCGGCGACTCCAGCGCGTCCAACTGCCTGCCGTCGTCCATGCTCCTCGCGTGCGACGACGGCGACGCGACGGCGACGGCGGCCGGGGTGGCGCCGCTGTCGGCGATCGAGTCGTGGCTGCTGCTCGACGACAGCGGAGAGCCGCAGCTGGCACTGGACGAGCAGCTGCTGGACGTAGCTCTCCGTAATTACGCTTTCTAA-3'.

[0225] pCambia1392 vector sequence:

[0226]

[0227] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of upregulating or enhancing the activity of a protein in any of the following: N1) Increase the wax content of rice leaves; N2) preparing a product for increasing the wax content of rice leaves; The protein is a protein whose amino acid sequence is SEQ ID No.

1.

2. Use of a biomaterial related to the protein of claim 1 in any of the following: The biological material is any one of the following: B9), a nucleic acid molecule encoding the protein according to claim 1; B10), an expression cassette containing the nucleic acid molecule described in B9); B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10); B12), a recombinant microorganism containing the nucleic acid molecule described in B9), or a recombinant microorganism containing the expression cassette described in B10), or a recombinant microorganism containing the recombinant vector described in B3); The application is any of the following, N1) Increase the wax content of rice leaves; N2) Preparation of products for increasing the wax content of rice leaves.

3. The use according to claim 2, characterized in that: B9) The nucleic acid molecule is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID No. 2.

Images