Kit for detecting DNA methylation level of a subject's smoking status, gene chip, and method for detecting the smoking status of a subject

Abstract

The present invention provides a kit, gene chip, and method for detecting DNA methylation levels in a subject's smoking status. The kit includes reagents capable of specifically detecting methylation sites in a biological sample. These methylation sites include nuclear DNA methylation sites and mitochondrial DNA methylation sites. Nuclear DNA methylation sites include cg14021375, cg03561637, cg20736847, cg12810233, cg09167044, and cg04720886; and mitochondrial DNA methylation sites include D-loop, ATP6, ATP8, and MT-COX1. This method addresses the difficulty in accurately determining a subject's smoking status in existing technologies and is suitable for use in the field of smoking status detection.

Description

Technical Field

[0001] The present invention relates to the field of smoking status detection, and in particular to a kit for detecting DNA methylation levels in detecting the smoking status of a subject, a gene chip, and a method for detecting the smoking status of a subject. Background Art

[0002] Smoking is one of the leading preventable causes of death and a major risk factor for disease burden. Tobacco kills over 8 million people worldwide each year, including an estimated 1.3 million non-smokers exposed to secondhand smoke. Smoking damages lung structure, lung function, and the respiratory immune system, causing a variety of respiratory diseases. It also impairs vascular endothelial function, leading to atherosclerotic changes, narrowing the blood vessels, obstructing arterial blood flow, and causing a variety of cardiovascular and cerebrovascular diseases. It also increases insulin resistance, leading to type 2 diabetes. Furthermore, tobacco smoke contains at least 69 carcinogens that can cause malignant tumors. Therefore, understanding an individual's smoking status is crucial in clinical diagnosis and treatment.

[0003] The patent (CN110140177B) proposes a procedure, device, system, and method for patients who want to quit smoking. The system assesses smoking status based on the CO concentration in the smoker's exhaled gas or the cotinine concentration in the saliva to determine whether the smoking information reported by the patient is accurate, thereby assisting in smoking cessation treatment.

[0004] Currently, assessments of smoking status are mostly based on subjective self-reports, which are subject to recall bias and concealment, and smoking prevalence based on self-reports tends to be underestimated. Self-reported smoking status is also not always available in clinical settings. In addition to self-reporting, serum cotinine or exhaled breath carbon monoxide levels can also be used to assess smoking status. However, these have short half-lives and can only detect short-term exposure. Cotinine levels are also susceptible to other factors, such as nicotine replacement therapies such as nicotine gum or transdermal patches, resulting in certain limitations. Summary of the Invention

[0005] The main purpose of the present invention is to provide a kit, a gene chip and a method for detecting the DNA methylation level of a subject for detecting the smoking status of a subject, so as to solve the problem in the prior art that it is difficult to accurately judge the smoking status of a subject.

[0006] To achieve the above objectives, according to a first aspect of the present invention, a kit for detecting DNA methylation levels in detecting the smoking status of a subject is provided, the kit comprising a reagent capable of specifically detecting methylation sites in a biological sample, the methylation sites comprising nuclear DNA methylation sites and mitochondrial DNA methylation sites; the nuclear DNA methylation sites comprising: cg14021375, cg03561637, cg20736847, cg12810233, cg09167044 and cg04720886; the mitochondrial DNA methylation sites comprising: D-loop, ATP6, ATP8 and MT-COX1.

[0007] Furthermore, the reagent includes a nucleic acid molecule; preferably, the nucleic acid molecule includes a primer pair for amplifying the methylation site and a probe for detecting the methylation site.

[0008] Furthermore, the primer pair includes a forward primer and a reverse primer, the methylation site, and the nucleotide sequences of the forward primer, reverse primer, and probe are shown in the following table:

[0009]

[0010] Furthermore, the smoking status includes: smoking, non-smoking, or former smoking but quitting.

[0011] Furthermore, the kit further comprises any one or more of the following components: red blood cell lysis buffer, proteinase K, phenol-chloroform, isopropanol, 75% (v / v) ethanol, deoxyribonuclease I, NaCl, MgCl2, CaCl2, deoxyribonucleoside triphosphates, a buffer, a stabilizer, a thermostable DNA polymerase or a marker; preferably, the buffer comprises Tris-HCl.

[0012] Furthermore, the label includes a fluorescent label, a chemiluminescent label or a radioactive label.

[0013] Furthermore, the kit also includes a reaction reagent that can differentially modify methylated DNA and non-methylated DNA; preferably, the reaction reagent includes bisulfite; preferably, the kit also includes an internal reference gene.

[0014] Furthermore, the biological sample is a peripheral blood sample.

[0015] To achieve the above-mentioned object, according to a second aspect of the present invention, a gene chip for detecting the DNA methylation level of a subject's smoking status is provided. The gene chip contains probes that can specifically bind to methylation sites, and the methylation sites include nuclear DNA methylation sites and mitochondrial DNA methylation sites; the nuclear DNA methylation sites include: cg14021375, cg03561637, cg20736847, cg12810233, cg09167044 and cg04720886; the mitochondrial DNA methylation sites include: D-loop, ATP6, ATP8 and MT-COX1.

[0016] To achieve the above-mentioned object, according to a third aspect of the present invention, a method for detecting the smoking status of a subject is provided, the method comprising: using the above-mentioned kit for detecting the DNA methylation level for detecting the smoking status of a subject, or the above-mentioned gene chip for detecting the DNA methylation level for detecting the smoking status of a subject, detecting the DNA methylation level of methylation points in a biological sample of the subject, and obtaining the smoking status of the subject.

[0017] By applying the technical solution of the present invention and utilizing the above-mentioned kit, specific DNA methylation sites are detected using the reagents in the kit, and the DNA methylation level obtained by the detection can be used to determine the smoking status of the subject with high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings, which constitute part of this application, are intended to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are intended to explain the present invention and do not constitute an undue limitation of the present invention. In the accompanying drawings:

[0019] Figure 1 The figure shows the ROC result of using multiple methods to respectively determine whether a subject is a smoker according to Example 2 of the present invention. DETAILED DESCRIPTION

[0020] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0021] As mentioned in the background art, in the prior art, the assessment of smoking status is mostly based on subjective self-reports of the subjects, which has low accuracy, and the self-reported smoking status of patients in clinical situations is not always available. In addition to self-reporting, serum cotinine or exhaled carbon monoxide levels can also be used to assess smoking status, but these compounds have a short half-life and can only detect short-term exposure, and are easily affected by other external factors, and the accuracy is difficult to meet the needs of actual use. At present, there is no application technology for using smoking-related DNA methylation to determine smoking status, especially in clinical scenarios. Therefore, it is necessary to develop a detection kit that is easy to operate, moderately priced, and objectively identifies the smoking status of individuals to assist clinical smoking cessation clinics and physical examinations, which require accurate information about the smoking status of the subject.

[0022] Therefore, in the present application, the inventors attempted to develop a kit for detecting DNA methylation levels that can be used to detect the smoking status of a subject, and proposed a series of protection schemes of the present application.

[0023] In a first typical embodiment of the present application, a kit for detecting DNA methylation levels in a subject's smoking status is provided, the kit comprising a reagent capable of specifically detecting methylation sites in a biological sample, the methylation sites comprising nuclear DNA methylation sites and mitochondrial DNA methylation sites; the nuclear DNA methylation sites comprising: CpG No.1 cg14021375, CpG No.2 cg07552108, CpG No.3, CpG No.4 and CpG No.5, CpG No.6; the mitochondrial DNA methylation sites comprising: CpG No.7, CpG No.8, CpG No.9 and MT-COX1.

[0024] By using the reagents in the aforementioned kit to detect the methylation status of the aforementioned nuclear and mitochondrial DNA methylation sites in biological samples from subjects, it is possible to assess the subject's lifetime smoking intensity and exposure level, thereby enabling the detection and assessment of the subject's smoking status. Testing the methylation status of specific DNA methylation sites can avoid the influence of subjective factors or exogenous compounds on the test results. The technology is mature, cost-effective, and highly accurate.

[0025] In a preferred embodiment, the reagent includes a nucleic acid molecule; preferably, the nucleic acid molecule includes a primer pair for amplifying the methylation site and a probe for detecting the methylation site.

[0026] By utilizing the above-mentioned ribose molecules, including primers and probes, it is possible to amplify the methylation sites, capture the amplified products, and obtain a sequencing library, thereby realizing the detection of DNA methylation levels using high-throughput sequencing.

[0027] In a preferred embodiment, the primer pair includes a forward primer and a reverse primer, and the nucleotide sequences of the methylation site, the forward primer, the reverse primer, and the probe are shown in Table 1 below:

[0028] Table 1

[0029]

[0030] In a preferred embodiment, the smoking status includes: smoking, non-smoking, or former smoking but quitting.

[0031] The above-mentioned kit is used to specifically detect methylation sites in biological samples from subjects, thereby detecting the smoking status of the subjects. The smoking status includes three results: smoking (i.e., still smoking before the test), non-smoking (i.e., no smoking history at the time of the test), and former smoker who has quit smoking (i.e., had a smoking history but quit smoking before the test, and the time of quitting smoking is more than half a year).

[0032] In a preferred embodiment, the kit further comprises any one or more of the following components: RBC Lysis Buffer, Proteinase K, phenol-chloroform, isopropanol, 75% (v / v) ethanol, deoxyribonuclease I, NaCl, MgCl2, CaCl2, deoxyribonucleoside triphosphates, a buffer, a stabilizer, a thermostable DNA polymerase, or a marker; preferably, the buffer comprises Tris-HCl.

[0033] In the above kit, any one or more of the above components can be optionally provided to detect specific methylation sites in biological samples. Those skilled in the art can also flexibly adjust the components in the kit and replace them with components in the prior art that can achieve the same function.

[0034] Among the above ingredients, red blood cell lysis solution: used to lyse red blood cells and release the DNA in them; proteinase K: used to digest proteins, thereby removing protein contamination in DNA samples; phenol-chloroform: used to extract DNA from biological samples, and can separate DNA from proteins and lipids; isopropanol: used to precipitate DNA by reducing the solubility of the solution; 75% (v / v) ethanol: used to wash DNA and remove residual salts and organic solvents; deoxyribonuclease I: an enzyme that can specifically cut DNA, used to simulate the enzymatic reaction of DNA methylation; NaCl: as a salt, it can adjust the ionic strength of the solution and affect the activity of the enzyme ; MgCl2: Magnesium ions are necessary for the activity of DNA polymerase, so MgCl2 acts as a cofactor of DNA polymerase in the reaction system; CaCl2: Calcium ions can enhance the stability of DNA polymerase and improve its activity; Deoxyribonucleoside triphosphate: It is the substrate of DNA polymerase and is used to synthesize new DNA chains; Buffer: It is used to maintain the pH value of the reaction solution to ensure the activity of the enzyme; Stabilizer: It is used to protect DNA polymerase or samples to prevent them from inactivation and denaturation during the reaction; Thermostable DNA polymerase: It can maintain activity at higher temperatures and achieve PCR amplification; Marker: It is used to label the synthesized DNA chain to facilitate subsequent detection and analysis.

[0035] In a preferred embodiment, the label comprises a fluorescent label, a chemiluminescent label or a radioactive label.

[0036] In a preferred embodiment, the kit further comprises a reaction reagent capable of differentially modifying methylated DNA and unmethylated DNA; preferably, the reaction reagent comprises bisulfite.

[0037] In a preferred embodiment, the kit further comprises an internal reference gene, which can be used to perform calibration and quality control of the test results.

[0038] In a preferred embodiment, the biological sample is a peripheral blood sample.

[0039] In a second typical embodiment of the present application, a gene chip for detecting the DNA methylation level of a subject's smoking status is provided. The gene chip contains probes that can specifically bind to methylation sites, and the methylation sites include nuclear DNA methylation sites and mitochondrial DNA methylation sites; the nuclear DNA methylation sites include: cg14021375, cg03561637, cg20736847, cg12810233, cg09167044 and cg04720886; the mitochondrial DNA methylation sites include: D-loop, ATP6, ATP8 and MT-COX1.

[0040] In a preferred embodiment, the smoking status includes: smoking, non-smoking, or former smoking but quitting.

[0041] The above-mentioned gene chip is used to detect biological samples. Methylated and unmethylated DNA bind to different probes to generate different signals. By detecting and analyzing the signal intensity, the methylation level of the above-mentioned methylation site can be obtained, thereby realizing the detection of the smoking status of the subject.

[0042] In a third typical embodiment of the present application, a method for detecting the smoking status of a subject is provided, the method comprising: using the above-mentioned kit for detecting the DNA methylation level of the subject, or the above-mentioned gene chip for detecting the DNA methylation level of the subject, to detect the DNA methylation level of the methylation point in the biological sample of the subject to obtain the smoking status of the subject.

[0043] Preferably, the above method is a method for non-diagnostic or non-therapeutic purposes, and is only used to obtain the smoking status of the subject, and has no direct relevance to the diagnosis or treatment of the disease.

[0044] The beneficial effects of the present application will be further explained in detail below with reference to specific embodiments.

[0045] Example 1

[0046] 1. Nuclear DNA Extraction and Bisulfite Conversion

[0047] Peripheral blood (1 mL) was collected and centrifuged at 200 g for 15 min at room temperature. The lower layer, which mainly contained blood cells, was collected and circulating cell nuclear DNA was extracted from the blood sample using the QIAamp DNA Mini kit (QIAGEN, MD, USA). The DNA was then bisulfite-converted using the Epitect Bisulfite Kit (Cat. No. 59104) from QIAGEN, Germany. The steps were carried out according to the kit instructions.

[0048] 2. Extraction and Bisulfite Conversion of Platelet Mitochondrial DNA

[0049] The platelet-rich upper layer obtained by centrifugation in step 1 was centrifuged at 1400 g for 15 min at room temperature. 3 μL of deoxyribonuclease I (Roche Holding AG, BASEL, Switzerland, 10 U / μL) and 3 μL of buffer (10×, 400 mMTris–HCl, 100 mM NaCl, 60 mM MgCl2, 10 mM CaCl2; pH 7.9) were added and incubated at 37°C for 3 h to reduce nuclear DNA contamination. Mitochondrial DNA was then extracted and bisulfite-converted using the Zymo Research EZ DNA Methylation-Direct™ Kit according to the kit instructions.

[0050] 3. PCR Amplification

[0051] PCR was performed using bisulfite-converted DNA as a template using the following conditions: Hotstart (Hieff UNICON Catalog No.: 31301ES) 12.5 μL, PCR buffer (Tris-HCl) (100 mM) 7 μL, dNTPs 0.5 μL, Primer F (forward primer) 1 μL, Primer R (reverse primer) 1 μL, ddH2O 1 μL, Template DNA 2 μL, total volume 25 μL.

[0052] Taking the methylation site CpG No.1 cg14021375 as an example, the PCR reaction conditions are as follows: 95°C: 5 minutes; 95°C: 20 seconds, 60°C: 30 seconds, 72°C: 20 seconds, for a total of 45 cycles.

[0053] 4. Pyrosequencing

[0054] After equilibrating all required reagents at room temperature, perform purification according to the PyroMark Q96 instructions. Add the biotin-labeled single strand attached to the beads to a system containing sequencing primers. For example, for the methylation site CpG No. 1 cg14021375, the sequencing primer (probe) S is ATATAGTTAAGTGGGGTAGT (SEQ ID NO: 3). Configure the software according to the sequence to be sequenced and perform sequencing. The software calculates the methylation frequency of the methylation site in the sequence, and the percentage above the detected site represents the methylation level.

[0055] The primer sequences used in the above PCR amplification and sequencing are shown in Table 2.

[0056] Table 2

[0057]

[0058] Among them, the primer sequences F, R, and S represent the forward primer, reverse primer, and sequencing primer (probe), respectively.

[0059] 5. Detection of smoking status of the crowd

[0060]

[0061] Among them, cg14021375, cg03561637, cg20736847, cg12810233, cg09167044, and cg04720886 are the methylation levels of six nuclear DNA methylation sites (i.e., the methylation level parameters of the first gene site), D-loop, ATP6, ATP8, and MT-COX1 are the methylation levels of four mitochondrial DNA methylation sites (i.e., the methylation level parameters of the second gene site), 0.126 and a2-a6 are the average methylation levels of the six nuclear DNA methylation sites in the target population dataset, 0.023 and b2-b6 are the standard deviations of the methylation levels of the DNA methylation sites in the target population dataset, for normalization, c1-c10 are the coefficients of the methylation levels of the 10 DNA methylation sites estimated by the algorithm (i.e., the above-mentioned weight coefficients, where c1 is 1.634 and c10 is 4.80), β 性别 , β 年龄 and β BMI are gender weight, age weight, and body mass index parameters, respectively.

[0062] In this formula, b7-b9 and 2.61 are also the standard deviations of the methylation levels of mitochondrial DNA methylation sites in the target population dataset, which are included in the weight coefficients of c7-c10. For example, the weight parameter corresponding to the target gene site CpG No.7 is .

[0063] The above coefficients were obtained from a sample of 600 community residents aged 45 and over in a specific region of China, including 150 smokers, 150 ex-smokers, and 300 non-smokers. Based on a literature review, 674 nuclear DNA methylation sites and 15 mitochondrial DNA methylation sites were selected and obtained using pyrosequencing. Using the machine learning LASSO model, the top 50 sites associated with smoking / non-smoking were obtained in the 150 smokers and 300 non-smokers. The LASSO model was then used again to identify the top 10 sites associated with smoking cessation status among the 20 sites, which are the sites selected by the kit. In the algorithm, a and b are the mean and standard deviation of the corresponding methylation sites in the community, and the weight coefficient c for each site is the effect value of the corresponding site obtained based on XGboost and binomial regression.

[0064] Those with a smoking score <0.5 are classified as non-smokers, those with a score between 0.5 and 1.0 as quitters, and those with a score >1.0 as smokers. The smoking score has been proven to be effective in identifying smoking status.

[0065] The smoking status of a subject can be identified using the above-mentioned smoking scoring model. The required parameters are the methylation levels of the aforementioned 10 DNA methylation sites, the subject's gender, age, and BMI. The parameter information of the subject is shown in Table 3.

[0066] Table 3

[0067]

[0068] The above parameters were calculated using the smoking score model, resulting in a smoking score of 0.3486. The smoking score assesses the subject's lifetime tobacco exposure. A score of 0.3486 < 0.5 indicates a very low exposure level, and the individual is classified as a non-smoker. This result is consistent with the actual situation.

[0069] Example 2

[0070] Based on 180 independent sample groups collected separately, the ability of three algorithms and a clinical smoking marker to judge whether the subjects are smokers was compared in the control group of non-smokers and ex-smokers. Score 1 is the algorithm proposed in this patent, and the calculation method is consistent with Example 1; Score 2 is an algorithm based only on nuclear DNA methylation sites (CpG No.1-6) (the coefficient remains unchanged), and the calculation method is consistent with Example 1; Score 3 is an algorithm based on the article published by the inventor in 2017 (http: / / link.springer.com / 10.1007 / s10654-017-0248-9), and Score 4 is a commonly used serum cotinine smoking exposure marker in clinical practice. The judgment results of the four judgment methods are as follows: Figure 1 shown.

[0071] Based on the AUC value, it can be seen that after incorporating both nuclear and mitochondrial DNA methylation sites, the algorithm achieved an AUC of 0.88, which is better than a score based only on a subset of nuclear DNA methylation sites (AUC = 0.72) and significantly better than the algorithm published by the inventors in 2017 (AUC = 0.68). However, the discriminatory power based on clinical serum cotinine levels was only 0.60. In summary, the applicant's algorithm outperforms existing algorithms and commonly used clinical markers. From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: using the above-mentioned kit or gene chip to detect the methylation levels of methylation sites in a subject, where the detected methylation sites include nuclear DNA methylation sites and mitochondrial DNA methylation sites, it is possible to detect the smoking status of a subject and determine whether the subject is a smoker, a non-smoker, or a former smoker who has quit smoking. The test results obtained using this kit and gene chip are accurate, the detection method is simple, and the detection cost is controllable, providing accurate data for understanding an individual's smoking status.

[0072] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A kit for detecting DNA methylation levels in a subject's smoking status, characterized in that: The kit includes a reagent capable of specifically detecting methylation sites in a biological sample, The methylation sites include nuclear DNA methylation sites and mitochondrial DNA methylation sites; The nuclear DNA methylation sites are cg14021375, cg03561637, cg20736847, cg12810233, cg09167044, and cg04720886; The mitochondrial DNA methylation site is D-loop 、 ATP6 、 ATP8 and MT-COX1 Methylation sites on genes; The biological sample is a peripheral blood sample; The reagents include nucleic acid molecules; The nucleic acid molecule includes a primer pair for amplifying the methylation site and a probe for detecting the methylation site; The primer pair includes a forward primer and a reverse primer, and the methylation site, and the nucleotide sequences of the forward primer, the reverse primer, and the probe are as follows: 。 2. The kit according to claim 1, wherein The smoking status includes: smoking, non-smoking, or former smoking but quitting.

3. The kit according to claim 1, wherein The kit may further comprise any one or more of the following components: Erythrocyte lysis buffer, proteinase K, phenol-chloroform, isopropanol, 75% (v / v) ethanol, deoxyribonuclease I, NaCl, MgCl2, CaCl2, deoxyribonucleoside triphosphates, buffer, stabilizer, thermostable DNA polymerase or label.

4. The kit according to claim 3, wherein The buffer includes Tris-HCl.

5. The kit according to claim 3, characterized in that The label includes a fluorescent label, a chemiluminescent label or a radioactive label.

6. The kit according to claim 1, wherein The kit also includes reaction reagents that can differentially modify methylated DNA and non-methylated DNA.

7. The kit according to claim 6, characterized in that The reaction reagent includes bisulfite.

8. The kit according to claim 6, characterized in that The kit also includes an internal reference gene.

9. A method for detecting a subject's smoking status for non-diagnostic purposes, characterized in that: The method comprises: using the DNA methylation level detection kit for detecting the smoking status of a subject according to any one of claims 1 to 8 to detect the DNA methylation level of the methylation point in the biological sample of the subject to obtain the smoking status of the subject; The biological sample is a peripheral blood sample.

Images