A SNP associated with somatic cell count in dairy cows and its application

Abstract

The present invention proposes a SNP related to the somatic cell number of dairy cows and its application, and belongs to the technical field of biochemical genetic breeding. In the present invention, a SNP related to the somatic cell number trait of dairy cows (chr6:g.88494442T>C) is identified and obtained, and its genotype CC is analyzed to be a dominant genotype. By selecting individuals with dominant genotypes for breeding, the frequency of the SLC4A4 dominant genotype in the dairy cow population can be increased, thereby optimizing the somatic cell number of the dairy cow population, improving the udder health of dairy cows, reducing the probability of mastitis, and increasing economic benefits. The present invention provides a new method for improving the genetic improvement of mastitis resistance in dairy cows.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical genetic breeding, and in particular relates to a SNP related to the somatic cell count of dairy cows and an application thereof. Background Art

[0002] The statements in this section merely provide background information related to the present invention and do not necessarily constitute prior art.

[0003] Dairy cows are an important source of dairy products in the world. However, with the high-yield dairy cow production from intensive farming, more and more animal health problems have emerged, especially mammary problems such as mastitis. Bovine mastitis is a common postpartum disease. It not only causes problems such as poor milk quality, less milk, and breast engorgement, affecting calf lactation, but also causes infectious inflammation of the mammary gland, which is not conducive to long-term healthy production.

[0004] Cow mastitis is an inflammation of the cow's mammary gland tissue. The incidence rate is relatively high in dairy farms, which not only reduces milk production and milk quality, but also affects its reproductive performance, causing great losses to the breeding industry. Studies have shown that cow mastitis is positively correlated with somatic cell count.

[0005] The genome-wide association study (GWAS) method is a powerful means to analyze the genetic mechanism of complex traits and locate key candidate molecular marker sites. It has played an important role in analyzing the genetic mechanism of quality and quantitative traits of model species and non-model species. It is of great significance to use GWAS technology to analyze the genes and their loci related to the somatic cell number trait of dairy cows, and then improve the resistance of dairy cows to mastitis. Summary of the invention

[0006] In order to overcome the above-mentioned deficiencies of the prior art, the present invention provides a SNP associated with the somatic cell count of dairy cows and its application. In the present invention, a SNP associated with the somatic cell count of dairy cows (SLC4A4, chr6: g.88494442T>C) was identified (the coordinate position of the SNP site is based on the cattle reference genome UMD3.1, as shown in the schematic diagram Figure 1 ). Analysis of its genotype CC is a dominant genotype, which can be used to select dairy cows with low somatic cell count traits for herd optimization and assisted breeding.

[0007] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:

[0008] In a first aspect, the present invention provides a SNP molecular marker, wherein the SNP is chr6:g.88494442T>C.

[0009] The present invention uses the Bovine SNP50 chip to perform genotype identification in a dairy cow population and finds that the SNP is located in the SLC4A4 gene, i.e., the 16th-17th intron region on chromosome 6 of Holstein cows (chr6:g.88494442T>C). The SNP can be used as an auxiliary breeding marker to improve the performance of the somatic cell number trait of dairy cows.

[0010] In the present invention, SEQ ID NO.3 and 4 are used to amplify Holstein cows to obtain nucleic acid fragments, whose nucleic acid sequences are shown in SEQ ID NO.1 or 2 respectively; they contain the above-mentioned SNP molecular marker, and the SNP molecular marker is C or T at the 197th position of SEQ ID NO.1 or 2 respectively (as shown in bold red in the sequence).

[0011] Solute carrier family 4 (sodium bicarbonate cotransporter) member 4 (SLC4A4) is a protein-coding gene involved in regulating bicarbonate secretion and absorption and intracellular pH. The SLC4A4 gene is significantly associated with the somatic cell number trait of Holstein cows, and existing studies have found that this gene encodes multiple transcript variants of different isoforms.

[0012] SEQ ID NO.1:

[0013] tgagtttggagttgcccgagggcttctttcctcacgtgactgctgccggggctgggggctccccctctgactagtcc

[0014] aaggctggcttgggttttctcacagctgggcactgtgatgcctcccgtgacctcctgctcctttgaaagggggcagtt

[0015] gccacttggctttccttgttgccatgtgaatatgcactcatcattcattttctgattttcaaagagaggttggaaattcaaa

[0016] ttcttaagtgaaatctggtgattctgaaatattggccaatgatcaacattttaaaattacattgtgctgaccagaaagca

[0017] cttagctgtatattcccaagtatggggaatagaagccaagcattgtagtcacaga

[0018] SEQ ID NO.2:

[0019] Tgagtttggagttgcccgagggcttctttcctcacgtgactgctgccggggctgggggctccccctctgactagtc

[0020] caaggctggcttgggttttctcacagctgggcactgtgatgcctcccgtgacctcctgctcctttgaaagggggcag

[0021] ttgccacttggctttccttgttgccatgtgaatatgcactcattattcattttctgattttcaaagagaggttggaaattcaa

[0022] attcttaagtgaaatctggtgattctgaaatattggccaatgatcaacattttaaaattacattgtgctgaccagaaagc

[0023] acttagctgtatattcccaagtatggggaatagaagccaagcattgtagtcacaga

[0024] In a second aspect, the present invention provides use of a substance for detecting the SNP described in the first aspect in the preparation of a product for identifying a somatic cell number trait of a dairy cow.

[0025] The substances include amplification primers and / or probes;

[0026] The primer is shown in SEQ ID NO.3 or SEQ ID NO.4;

[0027] Preferably, the product comprises a kit.

[0028] SEQ ID NO.3:tgagtttggagttgcccgag;

[0029] SEQ ID NO. 4: tctgtgactacaatgcttggc.

[0030] In a specific embodiment of the present invention, the kit further comprises one or more of a sampling tool, a genomic DNA extraction reagent or a PCR reaction reagent.

[0031] In a third aspect, the present invention provides a primer set for detecting the SNP molecular marker described in the first aspect, wherein the upstream primer sequence is shown as SEQ ID NO.3, and the downstream primer sequence is shown as SEQ ID NO.4.

[0032] In a fourth aspect, the present invention provides a kit, comprising the primer set described in the third aspect.

[0033] In a fifth aspect, the present invention provides the use of the above-mentioned SNP molecular marker, primer set or kit in any one or more of the following:

[0034] A1: Identification of somatic cell number traits in dairy cows;

[0035] A2: Dairy cattle herd optimization or assisted breeding.

[0036] In a specific embodiment of the present invention, the dairy cow is a Chinese Holstein cow;

[0037] In the application A2, chr6:g.88494442T>C on the SLC4A4 gene is a dominant gene related to the somatic cell number trait of dairy cows; when the genotype is CC, it has a lower somatic cell number genomic estimated breeding value.

[0038] The lower somatic cell count genomic estimated breeding value specifically refers to the score of the somatic cell count content contained in the milk of Chinese Holstein cows. The lower the score, the lower the somatic cell count content per milliliter of milk, indicating that the risk of mastitis in dairy cows is lower. It should be clear that the above-mentioned SNP molecular markers are used to identify dairy cows with reasonably low somatic cell counts, and the dairy cows with the C / C genotype have lower somatic cell counts.

[0039] In a sixth aspect, the present invention provides a method for identifying a somatic cell number trait of a dairy cow, comprising the following steps:

[0040] S1: using the primers described in the third aspect or the kit described in the fourth aspect to obtain the SLC4A4 gene in the genome of the dairy cow to be tested;

[0041] S2: Analyze the gene sequence obtained in S1 and determine the genotype, where the SNP is chr6:g.88494442T>C;

[0042] S3: If the genotype is CC, the somatic cell count is low.

[0043] In a seventh aspect, the present invention provides a method for identifying Chinese Holstein cows with low somatic cell count, comprising the following steps:

[0044] S1: using the primers described in the third aspect or the kit described in the fourth aspect to obtain the SLC4A4 gene in the genome of the dairy cow to be tested;

[0045] S2: Analyze the gene sequence obtained in S1 and determine the genotype, where the SNP is chr6:g.88494442T>C;

[0046] S3: If the genotype is CC, the tested cow has a low somatic cell count.

[0047] In an eighth aspect, the present invention provides a method for herd optimization or assisted breeding of Chinese Holstein dairy cows, comprising the following steps:

[0048] S1: using the primers described in the third aspect or the kit described in the fourth aspect to obtain the SLC4A4 gene in the genome of the dairy cow to be tested;

[0049] S2: Analyze the gene sequence obtained in S1 and determine the genotype, where the SNP is chr6:g.88494442T>C;

[0050] S3: If the genotype is CC, the tested cow is a cow with a low somatic cell count trait advantage.

[0051] In a ninth aspect, the present invention provides a system, comprising:

[0052] Amplification module: configured to obtain the SLC4A4 gene sequence of the cow to be tested;

[0053] Analysis module: configured to analyze the sequence of the SLC4A4 gene obtained by the amplification module and distinguish the genotype;

[0054] Output module: is configured to output the results of the analysis module.

[0055] One or more of the above technical solutions have the following beneficial effects:

[0056] In the present invention, a new SNP site on the SLC4A4 gene of dairy cows is identified by combining bioinformatics with molecular biology; early selection of genotype individuals with low somatic cell count traits can be achieved through detection of the site.

[0057] By analyzing the association with the estimated breeding value of the somatic cell count trait of dairy cows and selecting favorable individuals for breeding, the frequency of the low somatic cell count trait genotype of the SLC4A4 gene in the dairy cow population can be increased, thereby improving the mastitis resistance of the dairy cow population, reducing the feeding cost of the pasture, and improving the breeding efficiency. This provides a new method for the genetic improvement of the low somatic cell count trait of dairy cows.

[0058] Advantages of additional aspects of the present invention will be given in part in the following description, and in part will become obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0060] Figure 1 Schematic diagram of the SNP site of the present invention. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0062] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. The incompleteness of the present invention is well known to those skilled in the art. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. The experimental steps not recorded in detail refer to "Molecular Cloning Experiment Guide" ((US) MR Green (Michael R. Green), (US) J. Sambrook (Joseph. Sambrook) ed., 4th edition), pathophysiological experiments, online databases, etc.

[0063] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0064] The present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the specific embodiments are intended to explain the present invention rather than to limit it.

[0065] Embodiment 1

[0066] This embodiment provides a molecular marker and application of the SLC4A4 gene that affects the somatic cell count of dairy cows.

[0067] 1. Screening of SLC4A4 gene as a candidate gene for somatic cell count in dairy cows

[0068] (1) Blood or hair follicle samples were collected from 2,757 Holstein cows in eight large-scale farms

[0069] Holstein cattle samples were collected from 8 ranches across the country. The location of the ranches and the number of samples collected from each ranch are shown in Table 1.

[0070] Table 1. Location of farms where samples were collected and number of samples collected

[0071] Ranch location Number of samples Ranch location Number of samples Gansu Ranch 394 Hebei Ranch 278 Inner Mongolia Autonomous Region Ranch 499 Jiangsu Ranch 295 Xinjiang Uygur Autonomous Region Ranch 213 Shandong Ranch 1 294 Shandong Ranch 2 498 Shandong Ranch 3 286

[0072] (2) The genotypes of the collected samples were determined using the Illumina BovineSNP50 chip. The genotype determination was performed by Neogen, and the genotypes of a total of 47,843 SNP marker loci were obtained.

[0073] (3) The genomic breeding value of the somatic cell count of each individual is estimated based on the genotype. The genomic estimated breeding value is provided by the United States Dairy Cattle Genetics and Breeding Committee (CDCB).

[0074] (4) Based on genotype data, GEMMA software was used to conduct genome-wide association analysis on the somatic cell count genomic breeding value. The analysis model used a mixed linear model, with pasture and cattle age as covariates. The FDR method was used for multiple test correction. The results of the association analysis showed that the most significant SNP site (chr6:g.88494442T>C) was located in the 16th-17th intron of the SLC4A4 gene, with a significant P value of 7.27E-03.

[0075] 2. Identification of the dominant allele of the SLC4A4 gene

[0076] Among the 2757 Holstein cows collected, the present invention compared the estimated breeding values ​​of the somatic cell count genome of different genotypes of the SNP site chr6:g.88494442T>C, and the results are shown in Table 2. For chr6:g.88494442T>C, the estimated breeding values ​​of the somatic cell count genome are T / T: 2.96, T / C: 2.94, and C / C: 2.90. Because the smaller the estimated breeding value of the somatic cell count genome, the lower the content of somatic cells per milliliter in the milk, the dominant allele of the chr6:g.88494442T>C site is C.

[0077] Table 2 Estimated breeding values ​​of somatic cell count genomes of dairy cows with different genotypes of chr6:g.88494442T>C

[0078]

[0079] 3. Amplification of Partial Sequence of Bovine SLC4A4 Gene

[0080] (1) Blood collection from the cattle tail vein

[0081] Cows with high somatic cell count and cows with short somatic cell count were selected as test materials, and blood was collected from the tail vein of the cows.

[0082] (2) Genomic DNA extraction

[0083] Take 500 μL of whole blood, add 500 μL of STE lysis buffer, then add 50 μL of 10% SDS, 5 μL of proteinase K

[0084] (20 mg / ml), lyse at 56°C for about 3 hours until the lysate is clear. Add the same volume of saturated phenol (250 μL), chloroform / isoamyl alcohol (24:1)

[0085] (250μL), shake gently for 20 minutes, and centrifuge at 12000rpm for 10 minutes. Take the supernatant and repeat the above steps until there is no protein layer between the aqueous phase and the organic phase. Take the supernatant, add the same volume of chloroform / isoamyl alcohol, shake gently for 20 minutes, and centrifuge at 12000rpm for 10 minutes. Take the supernatant, add 1 / 10 volume of 3MNaAc (pH5.2) and 2 volumes of cold anhydrous ethanol, shake well and let stand at -20℃ for 20 minutes, and centrifuge at 12500rpm for 20 minutes. The nucleic acid is precipitated at the bottom of the tube. Discard the supernatant and wash the precipitate with 70% ethanol. Collect the precipitate and dry it in the air until the ethanol is completely evaporated. Add 20μL TE (containing RNaseA) to dissolve the DNA, let stand at 37℃ for about 30 minutes, and then store at 4℃. Detect the DNA sample by 1% agarose gel electrophoresis, and detect the concentration and purity by UV spectrophotometer.

[0086] (3) Primer design

[0087] According to the gene sequence of bovine SLC4A4 gene (GenBank gene accession number LOC282360), a pair of specific primers were designed.

[0088] The forward primer is SLC4A4-5F: 5'-TGAGTTTGGAGTTGCCCGAG-3' (SEQ ID NO. 3)

[0089] The reverse primer is SLC4A4-3F: 5'-TCTGTGACTACAATGCTTGGCT-3' (SEQ ID NO. 4)

[0090] (4) Polymerase chain reaction

[0091] The above primers were used for PCR amplification, and the reaction system was as follows: 10× Buffer 1 μL, 2.5 mM dNTP 0.8 μL, 2.5 mM MgCl 2 , 0.6 μL, primer F (10 μM) 0.1 μL, primer R (10 μM) 0.5 μL, Taq enzyme (5 U / μL) 0.1 μL, template 0.5 μL, LCGreen saturated fluorescent dye 0.7 μL, add H 2 O to make up to 10 μL. Amplification reaction was completed on Applied Biosystem PCR system, and the reaction conditions were as follows: 95℃5min; 95℃30s, 59℃30s, 72℃1min; 35 cycles; 72℃5min. The genotype of PCR product was determined by Sanger sequencing.

[0092] By selecting individuals from the core group of dairy cows and using the above-mentioned molecular biology-related technologies to detect the genotype of the SLC4A4 gene chr6:g.88494442T>C site, favorable individuals were selected for breeding, which can improve the somatic cell count traits of the dairy cow population, improve breeding efficiency, reduce breeding costs, increase breeding income, and lay the foundation for breeding a new breed of excellent dairy cows with high resistance to mastitis.

[0093] Embodiment 2

[0094] In order to verify the relationship between the chr6:g.88494442T>C site and the somatic cell number trait of Holstein cattle, the genotype of a SNP site in the 16th-17th intron of SLC4A4 was identified in 793 Holstein dairy cows from two Holstein dairy cow populations by Sanger sequencing, and the estimated breeding values ​​of somatic cell number genomes of individuals with different genotypes were compared, and the results are shown in Table 3. The test results showed that there were three genotypes in the Holstein dairy cow population tested; among all the tested populations, the estimated breeding value of somatic cell number genomes of the C / C genotype was the lowest, and the estimated breeding value of somatic cell number genomes of the T / T genotype was the highest, and there was a significant difference between the mean estimated breeding values ​​of somatic cell number genomes of individuals with C / C genotype and those of individuals with T / T genotype in the two populations, with significant P values ​​of 0.000195 and 1.07488E-07, respectively.

[0095] Table 3 Relationship between the genotype of cattle chr6:g.88494442T>C locus and the estimated breeding value of somatic cell number genome in the validation population

[0096]

[0097] Table 3 Description: The above group materials are all Holstein cattle groups in my country, among which: Group 1 is a Holstein cattle group from a ranch in Shandong, and Group 2 is a Holstein cattle group from a ranch in Shanxi.

[0098] The present invention identifies a SNP site associated with the somatic cell number of dairy cows, detects the genotype of the SLC4A4 gene at this site of individual dairy cows through molecular biology related techniques, and selects favorable genotype individuals for breeding through association analysis with the estimated breeding value of the somatic cell number trait of dairy cows, which can increase the frequency of the SLC4A4 gene advantage low somatic cell number trait genotype in the dairy cow population, reduce the feeding cost of the pasture, improve the breeding efficiency, and provide a new method for the genetic improvement of the somatic cell number trait of dairy cows.

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a substance for detecting SNP in the preparation of a product for detecting and identifying a cow somatic cell count trait or a cow mastitis resistance trait, characterized in that: The SNP is located in the SLC4A4 gene, i.e., the 16th-17th intron region on chromosome 6 of Holstein cows; the SNP molecular marker is C or T at position 197 of SEQ ID NO. 1 or 2, respectively.

2. The use according to claim 1, characterized in that: The substance includes amplification primers and / or probes; the primers are shown as SEQ ID NO.3 and SEQ ID NO.4.

Images