Application of Cpxm2 gene as a therapeutic target in the preparation of drugs against diabetic cardiomyopathy

Abstract

The present invention discloses the application of Cpxm2 gene as a therapeutic target in the preparation of anti-diabetic cardiomyopathy drugs, belonging to the field of biomedicine technology. The present invention finds that Cpxm2 can be used as a target in the preparation of anti-diabetic cardiomyopathy drugs, and plays a role in the treatment of diabetic cardiomyopathy by overexpressing Cpxm2 gene or protein level. The results of the present invention show that overexpressing Cpxm2 by gene modification can reverse myocardial cell damage and effectively alleviate myocardial hypertrophy and myocardial fibrosis caused by diabetes or high sugar.

Description

Technical Field

[0001] The present invention relates to application of Cpxm2 gene as a therapeutic target in preparing an anti-diabetic cardiomyopathy drug, and belongs to the technical field of biomedicine. Background Art

[0002] Type 1 diabetes (T1D) is an autoimmune disease that mainly occurs in children and adolescents. In T1D patients, the immune system attacks and destroys insulin-producing cells (β cells) in the pancreas, which leads to an absolute lack of insulin, so patients are unable to produce enough insulin to maintain normal blood sugar balance. In recent years, the prevalence of T1D diabetes has increased rapidly, and diabetic complications have also increased, becoming a global public health problem. Among all T1D complications, myocardial disease is considered to be the main cause of disability and death. It is myocardial dysfunction caused by abnormal myocardial structure and reduced contractility in patients without obvious vascular complications.

[0003] Diabetic cardiomyopathy (DCM) is a specific diabetic cardiac complication independent of hypertension and coronary heart disease. As one of the most serious cardiovascular complications, it manifests as myocardial hypertrophy, fibrosis, apoptosis and dysfunction, and even leads to heart failure and sudden death in diabetic people. There is evidence that impaired cardiac insulin metabolic signaling, oxidative stress, elevated advanced glycation end products, mitochondrial dysfunction, endoplasmic reticulum stress, inflammatory response, microvascular O-GlcNAc glycosylation modification and abnormal exosome pathways are all related to the pathology of DCM. Despite decades of preclinical and clinical research, the pathophysiology of diabetic cardiomyopathy has not been fully elucidated. So far, T1D-DCM cannot be cured, and patients need to rely on insulin injections for life to maintain blood sugar control. Scientists have not yet developed reliable gene therapy methods to prevent or treat it, and there is still a lack of specific drugs and therapeutic targets.

[0004] Therefore, it is necessary to develop more effective treatment strategies, explore new therapeutic targets for the treatment of DCM, and develop and prepare anti-diabetic cardiomyopathy drugs to delay the course of diabetic cardiomyopathy or improve T1D-DCM. Summary of the invention

[0005] In order to solve the above problems, the present invention provides the use of Cpxm2 gene as a drug target in the preparation of a drug for treating diabetic cardiomyopathy. The present invention provides a new therapeutic target for diabetic cardiomyopathy, namely Cpxm2 gene. The present invention finds that by targeting Cpxm2 gene and overexpressing Cpxm2 gene, myocardial function damage, myocardial hypertrophy and fibrosis induced by high glucose can be alleviated, thereby achieving the treatment of diabetic cardiomyopathy.

[0006] The Cpxm2 gene plays an important role in the myocardial tissue of diabetic patients, which is verified by the low expression of the Cpxm2 gene in the myocardial tissue of T1D-DCM mice and the cardiomyocytes cultured in high glucose, revealing that overexpression of the Cpxm2 gene through gene modification can alleviate myocardial damage caused by diabetes. The Cpxm2 gene can be used as a target for the treatment of diabetic cardiomyopathy, and the present invention provides new ideas and strategies for the treatment and drug development or screening of diabetic cardiomyopathy.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The first object of the present invention is to provide a use of Cpxm2 as a therapeutic target in the preparation of an anti-diabetic cardiomyopathy drug, wherein the drug increases the expression of the Cpxm2 gene or protein.

[0009] In one embodiment, the medicament comprises an activator of Cpxm2.

[0010] In one embodiment, the activator includes an agent that enhances Cpxm2 gene expression and / or an agent that enhances Cpxm2 protein expression.

[0011] In one embodiment, the medicament alleviates diabetic cardiomyopathy-induced myocardial hypertrophy and myocardial fibrosis.

[0012] The second object of the present invention is to provide the use of a Cpxm2 activator in the preparation of a drug for treating diabetic cardiomyopathy.

[0013] In one embodiment, the Cpxm2 activator includes an agent that enhances Cpxm2 gene expression and / or an agent that enhances Cpxm2 protein expression.

[0014] The third object of the present invention is to provide the use of Cpxm2 gene or protein in screening drugs for preventing or treating diabetic cardiomyopathy.

[0015] In one embodiment, the application includes using the expression of the Cpxm2 gene or protein to verify whether a drug can be used to prevent or treat diabetic cardiomyopathy.

[0016] In one embodiment, the drug for preventing or treating diabetic cardiomyopathy can increase the expression of Cpxm2 gene or protein.

[0017] The fourth object of the present invention is to provide a drug capable of preventing or treating diabetic cardiomyopathy.

[0018] In one embodiment, the drug comprises an activator of the Cpxm2 gene and / or its expression product.

[0019] In one embodiment, the drug is a vector for gene therapy, including vectors for gene editing, gene expression regulation or gene delivery; or the drug is a vector for cell therapy, including stem cells, immune cells or repair cells.

[0020] In one embodiment, the medicament prevents or treats diabetic cardiomyopathy by increasing the expression of Cpxm2 gene or protein.

[0021] In one embodiment, the drug contains the above-mentioned Cpxm2 activator and pharmaceutically acceptable excipients.

[0022] In one embodiment, the auxiliary material includes any one of a carrier, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a solubilizer, a solubilizing agent, an osmotic pressure regulator, a surfactant, a coating material, a colorant, a pH regulator, an antioxidant, an antibacterial agent or a buffer, or a combination of at least two thereof.

[0023] In one embodiment, the carrier is one or more of a virus, a liposome, and a nanoparticle.

[0024] In one embodiment, the excipient is one or more of mannitol, lactose, fatty acid, and polyethylene glycol.

[0025] In one embodiment, the dosage form of the drug includes any one of suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, suppositories, enemas, aerosols, patches or drops.

[0026] In one embodiment, the administration route of the drug includes oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

[0027] In one embodiment, the drug of the present invention has at least one or more of the following functions:

[0028] (1) Restore the reduction in left ventricular ejection fraction and left ventricular fractional shortening caused by T1D and reverse the damage to cardiac function;

[0029] (2) reduce the levels of markers of T1D-induced myocardial hypertrophy and myocardial fibrosis;

[0030] (3) Restore the decline in cardiomyocyte viability caused by high glucose and inhibit the activity of Caspase 3.

[0031] Beneficial effects of the present invention:

[0032] The application of the Cpxm2 gene provided by the present invention in the preparation of a drug for treating diabetic cardiomyopathy has found for the first time that overexpression of the Cpxm2 gene can effectively alleviate myocardial damage caused by diabetic cardiomyopathy or high sugar. Cell experiments and mouse experiments have shown that overexpression of Cpxm2 by gene modification can effectively alleviate the symptoms of myocardial hypertrophy and myocardial fibrosis caused by diabetes or high sugar. The present invention illustrates the protective effect of overexpression of Cpxm2 on the myocardium of T1D-DCM mice and the improvement of cardiac function through gene modification technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The results of differential gene expression analysis of myocardial tissue of T1D-DCM mice vs. control mice in multiple GEO datasets. (AD) are the PCA analysis results of expression profile data of datasets GSE155377, GSE161827, GSE161931, and GSE173384; (EH) are the volcano plots of differential analysis results of datasets GSE155377, GSE161827, GSE161931, and GSE173384; (I) is the cross-analysis result of significantly differentially upregulated genes in the four datasets; (J) is the cross-analysis result of significantly differentially downregulated genes in the four datasets; (KN) are the expression of significantly differentially downregulated genes in the four datasets GSE155377, GSE161827, GSE161931, and GSE173384; (O) Cpxm2 expression in various cells of the heart; (P) Cpxm2 is significantly reduced in myocardial cells of the heart of T1D-DCM mice. n=4-5. *P<0.05 compared with the control group.

[0034] Figure 2 The figure shows the changes of Cpxm2 protein and gene levels in cardiomyocytes cultured in T1D-DCM and high glucose. (A) Cpxm2 protein level in the hearts of control and T1D-DCM mice; (B) Cpxm2 mRNA level in the hearts of control and T1D-DCM mice; (C) Western blot detection of Cpxm2 protein level in cardiomyocytes exposed to normal or high glucose; (D) RT-PCR detection of Cpxm2 mRNA level in cardiomyocytes exposed to normal or high glucose. n = 4-6. *P < 0.05 compared with the control group.

[0035] Figure 3The figure shows the protective effect of targeted overexpression of Cpxm2 in cardiomyocytes on the myocardium and improvement of cardiac function in T1D-DCM mice. (A) is the efficiency detection of overexpression of Cpxm2 in cardiomyocytes; (B) is a representative transthoracic ultrasound image of mice in different groups; (C and D) quantification of left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS); (E) serum creatine kinase isoenzyme (CK-MB) level; (F) serum lactate dehydrogenase (LDH) level; (G) mRNA levels of myocardial hypertrophy markers ANP, BNP, and β-MHC; (G) mRNA levels of cardiac fibrosis markers Collagen I, Collagen III, and Fibronectin. n=4-6. *P<0.05 compared with Vector, # Compared with T1D, P<0.05. Vector: normal mice + empty vector plasmid group; Cpxm2 OE: normal mice + Cpxm2 overexpression (OE, overexpression) group; T1D: type 1 diabetic mice group; T1D+Cpxm2 OE: type 1 diabetic mice + Cpxm2 overexpression group.

[0036] Figure 4 Figure 1 shows the improvement of overexpression of Cpxm2 on cardiomyocyte injury and hypertrophy caused by high glucose. (A) is the efficiency test of overexpression of Cpxm2 in cardiomyocytes; (B) cell viability; (C) Caspase 3 activity test; (D) mRNA levels of myocardial hypertrophy markers ANP, BNP, and β-MHC. n = 4-6. *P < 0.05 compared with Vector, # Compared with HG, P<0.05. Vector: normal glucose (NG) + empty vector plasmid group; Cpxm2 OE: Cpxm2 overexpression (OE) group; HG: high glucose (HG) + empty vector plasmid group; HG+Cpxm2 OE: high glucose (HG) + Cpxm2 overexpression group. DETAILED DESCRIPTION

[0037] Unless otherwise specified, the experimental materials and drugs used in the embodiments of the present invention can be obtained through conventional purchase.

[0038] The methods involved in the following embodiments are:

[0039] 1. Construction of animal model: 7-8 week old male C57BL / 6J mice were purchased from the Experimental Animal Center of Yangzhou University. High-fat diet (HFD, 60% fat) was purchased from Shanghai Shrek Company. All mice were housed in specific pathogen-free micro-isolation cages and were free to eat and drink. The animals were kept in a room with controlled temperature and humidity and a 12-hour light / dark cycle. Type 1 diabetic mice were induced by intraperitoneal injection of 0.2% streptozotocin (STZ) at a dose of 50 mg / kg for 5 consecutive days, and the normal control group was given an equal amount of citric acid buffer. Three days after the injection, the random blood glucose of the mice was measured, and mice with blood glucose concentrations ≥16.7 mmol / L were considered to have successfully established T1D models. After 12 weeks of feeding, diabetic cardiomyopathy was produced, which was a T1D-DCM mouse model. Normal mice of matching age were selected for the normal control group for experiments. All animal experiments were in accordance with ethical standards.

[0040] 2. Isolation and culture of primary cardiac cells: Primary cardiomyocytes, endothelial cells and fibroblasts were isolated from the hearts of newborn Sprague Dawley rats. The specific methods are as follows:

[0041] (1) Animal preparation: Select healthy newborn Sprague Dawley rats;

[0042] (2) Anesthesia and dissection: The rats were fully anesthetized with sodium pentobarbital, and then the hearts were quickly dissected out and cut into approximately 1-2 mm 3 small pieces;

[0043] (3) Cell separation: Use trypsin and collagenase to separate different types of cells:

[0044] a. Isolation of primary cardiomyocytes: Add digestion buffer containing 0.08% trypsin to the heart tissue, incubate at 37°C for 20-30 minutes, and then stop digestion with pre-cooled culture medium. Centrifuge the mixed cell suspension and remove the supernatant, then resuspend the cells and perform a washing step.

[0045] b. Endothelial cell isolation: Add digestion buffer containing 0.1% trypsin and 0.1% collagenase to the heart tissue, incubate at 37°C for 30-40 minutes with an oscillator, and then filter through a filter to remove solid tissue debris. Centrifuge the cell suspension and remove the supernatant, then resuspend the cells and perform a washing step.

[0046] c. Fibroblast isolation: Add digestion buffer containing 0.2% collagenase and 0.25% trypsin to the heart tissue, incubate at 37°C for 60-90 minutes with an oscillator, and then filter out solid tissue debris through a filter. Centrifuge the cell suspension and remove the supernatant, then resuspend the cells and perform a washing step.

[0047] (4) Cell culture: The isolated primary cardiomyocytes, endothelial cells and fibroblasts are inoculated into culture dishes pre-coated with a suitable matrix (such as collagen coating), and appropriate culture medium (such as DMEM / F12, DMEM, etc.) and culture conditions (37°C temperature, 5% CO2 concentration, etc.) are provided.

[0048] 3. H9c2 cell culture: H9c2 cells were derived from the cardiac cell line of the left ventricle of SD rats and were purchased from the Shanghai Institute of Biological Sciences, Chinese Academy of Sciences (China). 5 Cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin. The cells were grown in a humidified incubator at 37°C containing 95% air and 5% carbon dioxide.

[0049] 4. Transthoracic echocardiography of mice: Refer to the equipment manual and use the Vevo 2100 high-resolution imaging system (Visualsonics, Toronto, ON, Canada) and the equipped 30 MHz probe to perform transthoracic echocardiography of mice. The specific steps are as follows:

[0050] (1) Anesthetizing mice: Use isoflurane to fully anesthetize the mice and ensure that they are in a pain-free and motionless state;

[0051] (2) Positioning the mouse: Place the mouse on a heating pad and adjust the position so that the chest is exposed to the ultrasound probe;

[0052] (3) Prepare the probe: Connect the 30 MHz probe to the Vevo 2100 high-resolution imaging system and calibrate the probe to ensure good imaging quality;

[0053] (4) Applying gel: Apply a small drop of ultrasound gel on the appropriate position of the mouse's chest to provide an ultrasound transmission medium and reduce air gaps;

[0054] (5) Ultrasound imaging: The ultrasound probe was gently placed on the chest area coated with ultrasound gel and fixed in a suitable position, and the Vevo 2100 system was started for image acquisition;

[0055] (6) Obtaining images: Using the real-time imaging function provided by the system to obtain the heart image of the mouse;

[0056] (7) Data analysis: importing the collected electrocardiographic data into analysis software to calculate and analyze cardiac function parameters;

[0057] (8) End of operation: After completing image acquisition and data analysis, turn off the Vevo 2100 system, remove the mouse from the heating pad, and wait for anesthesia to recover.

[0058] 5. Western blot: Western blot is a commonly used protein analysis technique used to detect the presence and quantification of specific proteins in complex samples. This technique is based on the molecular weight and immunological properties of proteins. It separates proteins by electrophoresis, transfers them to a membrane, and uses specific antibodies for detection. The specific operation method is as follows:

[0059] (1) Sample preparation: a. Collection of mouse heart tissue and cell samples; b. Tissue lysis: Place the collected samples in a suitable lysis buffer, grind the tissue completely to release proteins;

[0060] (2) Protein extraction: a. Centrifugation: Centrifuge the lysed sample to remove solid residues such as cell debris and cell nuclei, and collect the supernatant, which contains the lysed protein; b. Protein concentration determination: Use the BCA protein quantification method to determine the protein concentration, and dilute the sample to make the protein concentration suitable for subsequent experiments according to experimental needs;

[0061] (3) SDS-PAGE gel electrophoresis: a. Sample preparation: Mix the extracted protein sample with SDS-PAGE sample buffer and heat it at an appropriate temperature for denaturation; b. Gel preparation: Prepare polyacrylamide gel of appropriate concentration and select the appropriate gel percentage according to the protein size and resolution requirements; c. Sample loading: Load the denatured protein sample into the gel wells and load the molecular weight marker as a reference; d. Electrophoresis: Place the gel in an electrophoresis tank, add appropriate electrophoresis buffer, and apply an electric field for electrophoresis. Set the appropriate current and time according to the gel size and protein size;

[0062] (4) Transfer (blotting): a. Prepare the membrane: Transfer the protein from the gel to the protein blotting membrane (such as polyvinylidene fluoride or nitrocellulose membrane). Prepare a membrane of appropriate size and pretreat the membrane before transfer; b. Transfer device: Stack the gel and membrane in sequence, place them in the protein transfer device, and add appropriate transfer buffer. Make sure there are no bubbles between the gel and the membrane and make them fully contact; c. Transfer: Apply appropriate current and time to transfer the protein from the gel to the membrane;

[0063] (5) Immunoblotting: a. Blocking: Place the protein blotting membrane in a blocking buffer to block nonspecific binding sites and reduce the nonspecific binding of subsequent antibodies; b. Antibody binding: Add specific primary antibodies (Cpxm2 antibody, abs110629, Absin; β-actin antibody, ab8226, Abcam) to the antibody binding buffer, incubate the membrane with the primary antibody, and allow the primary antibody to bind to the target protein; c. Washing: Perform multiple washing steps on the membrane to remove unbound primary antibodies and other nonspecific binding substances; d. Secondary antibody binding: Add enzyme-labeled secondary antibodies, incubate the membrane with secondary antibodies, and allow the secondary antibodies to bind to the primary antibodies; e. Washing: Perform multiple washing steps on the membrane again to remove unbound secondary antibodies and other nonspecific binding substances; f. Signal detection: Use chemiluminescence to detect the signal of the protein on the membrane according to the secondary antibody and detection method used; g. Data analysis: Quantitatively analyze the protein blotting images using tools such as image analysis software to obtain the relative expression level of the protein.

[0064] 6. Reverse transcription polymerase chain reaction (RT-PCR): RT-PCR is a commonly used molecular biology technique for detecting and amplifying RNA molecules. It combines the two steps of reverse transcription and polymerase chain reaction, which can transcribe RNA into corresponding DNA and amplify it, thereby realizing the detection and quantitative analysis of RNA. The specific operation method is as follows:

[0065] (1) Sample preparation: Collect the RNA sample to be tested, pay attention to avoid RNA degradation and protect the integrity of RNA;

[0066] (2) Reverse transcription: Reverse transcription is the process of transcribing RNA into a corresponding DNA molecule. First, the RNA template is added to the reaction system together with reverse transcriptase and primers. Primers are DNA fragments that can complement and pair with specific regions of the target RNA sequence. Reverse transcriptase binds the primer to the end of the RNA template and begins to synthesize the DNA chain at the starting point of the primer. Reverse transcriptase synthesizes the corresponding complementary DNA chain according to the nucleotide sequence on the RNA template to form an RNA-DNA hybrid molecule;

[0067] (3) Heat denaturation: In order to remove the RNA template, the reverse transcription reaction mixture is subjected to heat denaturation treatment. This step will dissolve the RNA-DNA hybrid molecules at high temperature, denature the RNA template, but retain the synthesized DNA chain;

[0068] (4) PCR amplification: The heat-denatured reaction mixture is added to the PCR reaction system for DNA amplification. The PCR reaction system contains DNA polymerase, primers, and four nucleotides. The primers will complement each other with specific regions of the synthesized DNA chain, and the DNA polymerase will start synthesizing a new DNA chain at the starting point of the primer. Through a series of cyclic reactions, including high-temperature denaturation, primer annealing, and DNA synthesis, a specific DNA fragment can be amplified; -ΔΔCt The gene expression was calculated by the method.

[0069] 7. Prepare special culture medium: Normal glucose (NG) medium is a mixture of 5.5mM glucose and 27.8mM mannitol; high glucose (HG) medium uses DMEM complete medium (5.5mM glucose) supplemented with D-glucose, with a final concentration of 33.3mM. All prepared culture media are filtered using a sterile filter to remove potential microbial contamination, and then the culture medium is sterilized.

[0070] 8. Cell viability: CCK8 is a rapid, highly sensitive detection kit based on WST-8, which can be converted to orange by mitochondrial dehydrogenase (the color is linearly related to the number and viability of cells). H9c2 cells were inoculated into 96-well culture plates (10,000 cells / well), and all cells and cell culture supernatants were processed according to the kit operating instructions under the previous experimental conditions, and 10 μL of CCK-8 reagent was added. Then, the optical density value at the appropriate wavelength (450 nm) was measured using a micro reader.

[0071] 9. Caspase 3 activity detection: After washing the collected adherent cells twice with cold PBS, add 100 μL of cold lysis buffer, vortex at high speed for 15 seconds every 5 minutes, and then centrifuge at 4°C and 1000 rpm for 5 minutes, quickly aspirate the supernatant into another pre-cooled clean centrifuge tube, and then detect its activity according to the method described in the Caspase 3 detection kit. Since Caspase 3 can catalyze the substrate Ac-DEVD-PNA to produce yellow 4-nitroaniline (PNA) with strong absorbance near the wavelength of 400nm, the optical density value can be used to reflect the activity of Caspase 3, that is, the larger the OD value, the stronger the activity of Caspase 3.

[0072] 10. Serum CK-MB and LDH determination: Mice were killed by cervical dislocation and about 1 mL of blood sample was collected. The sample was allowed to stand at room temperature for 2 h and centrifuged at 3000 rpm for 10 min to obtain the upper serum. Lactate dehydrogenase (LDH) and creatine phosphokinase-isoenzyme MB kits (CK-MB) were purchased from Nanjing Jiancheng Biotechnology Co., Ltd. The detection was completed strictly according to the instructions of the ELISA detection kits corresponding to CK-MB and LDH.

[0073] 11. Statistical analysis of data: Cell and molecular experiments were repeated at least 3 times independently, and animal experiments were repeated at least 6 times. The data of repeated experiments were averaged and expressed as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 7.0 software. Unpaired t-test was used to determine the differences between the two groups, and analysis of variance (ANOVA) was used for multiple group comparisons. Bonferroni post hoc test was used after ANOVA to analyze the comparisons between the groups. P < 0.05 was considered statistically significant.

[0074] Example 1: Transcriptome analysis of T1D-DCM mouse heart tissues from multiple GEO samples to screen for differentially expressed genes

[0075] Transcriptome analysis of T1D-DCM mouse heart tissue from multiple GEO samples helps to integrate different research data and further study the molecular mechanisms and potential therapeutic targets of T1D-DCM. The datasets screened this time are: GSE161931, GSE161827, GSE157317, GSE44179, GSE173384, GSE4745, GSE155377, and the analysis methods are as follows:

[0076] (1) Download and process raw data:

[0077] a. GSE161931 dataset: Gene expression profile data in count format of dataset GSE161931 were downloaded from GEO database. The expression profile was re-annotated using biomaRt package in R language. The expression profile of mouse gene symbol was obtained for subsequent analysis.

[0078] b. GSE155377 dataset: Download the raw chip data of the dataset GSE155377 from the GEO database, use the R language oligo package to read the sample data, and perform RMA standardization. Use the platform annotation file GPL23038 corresponding to the dataset to re-annotate the dataset and obtain the expression spectrum of the mouse gene symbol for subsequent analysis. If a chip probe corresponds to multiple gene symbols, delete the probe; if multiple chip probes correspond to one gene symbol, select the maximum value as the expression value of this gene;

[0079] c. GSE161827: Gene expression profile data in count format of the dataset GSE161827 were downloaded from the GEO database. The expression profile was re-annotated using the biomaRt package in R language, and the expression profile of mouse gene symbols was obtained for subsequent analysis.

[0080] d. GSE173384: Gene expression profile data in FPKM format of dataset GSE173384 were downloaded from GEO database. The data were normalized by log2(FPKM+1) to eliminate the dimension of gene expression in the sample, and then the normalized data were used for subsequent differential analysis.

[0081] (2) Differential analysis of mRNA

[0082] a. GSE161931: Based on step (1), the re-annotated expression profile of GSE161931 in gene symbol count format was obtained. The expression profile was then differentially analyzed using the R language DESeq2 package. The screening threshold for significantly differentially expressed genes was pvalue < 0.05.

[0083] b. GSE155377: The expression profile of the dataset GSE155377 was normalized by RMA, and the differential analysis was performed using the R language limma package. The screening threshold for genes with significant differential expression was p value < 0.01;

[0084] c. GSE161827: For the count-format expression profile of the dataset GSE161827 downloaded from GEO, the DESeq2 package in R language was used for differential analysis, and the screening threshold for significantly differentially expressed genes was set to p value < 0.01;

[0085] d. GSE173384: The data set of GSE173384 was standardized by log2(FPKM+1) and differential analysis was performed using the 2R language limma package. The screening threshold for significantly differentially expressed genes was set to p value < 0.01.

[0086] (3) Screening of genes with significant expression differences

[0087] According to step (2), four data sets of myocardial tissues of T1D-DCM mice vs. myocardial tissues of control mice are differentially analyzed to obtain four groups of significantly expressed differentially genes. Then, the four groups of significantly expressed differentially genes are cross-analyzed, and the differentially expressed genes that are significantly up-regulated in the four data sets are taken as the differentially expressed genes that are significantly up-regulated in the myocardial tissues of T1D-DCM mice vs. the myocardial tissues of the control mice, and the differentially expressed genes that are significantly down-regulated in the four data sets are taken as the differentially expressed genes that are significantly down-regulated in the myocardial tissues of T1D-DCM mice vs. the myocardial tissues of the control mice.

[0088] The results are as follows Figure 1As shown in A-1N, after differential analysis and significance threshold screening, the dataset GSE155377 obtained a total of 409 significantly differential genes, of which 238 were up-regulated and 171 were down-regulated; after differential analysis and significance threshold screening, the dataset GSE161827 obtained a total of 817 significantly differential genes, of which 487 were up-regulated and 330 were down-regulated; after differential analysis and significance threshold screening, the dataset GSE161931 obtained a total of 1058 significantly differential genes, of which 528 were up-regulated and 530 were down-regulated; after differential analysis and significance threshold screening, the dataset GSE173384 obtained a total of 914 significantly differential genes, of which 357 were up-regulated and 557 were down-regulated. After cross-analysis of the results of the four groups of significant difference analyses, five differentially expressed genes were obtained that were significantly upregulated in all four data sets, namely Cpt1a, Decr1, Ucp2, Acot1, and Acot2; and two differentially expressed genes were obtained that were significantly downregulated in all four data sets, namely Cpxm2 and Oxct1. Figure 1 O The public database showed that Cpxm2 was mainly expressed in cardiomyocytes (https: / / tabula-muris.ds.czbiohub.org / ). The cDNA sequences of mouse and rat Cpxm2 genes were obtained from NCBI (mouse: SEQ ID NO.1; rat SEQ ID NO.2).

[0089] Example 2: Expression of Cpxm2 in T1D-DCM animals and cells

[0090] The experimental techniques involved in Example 1 include: animal model construction, isolation and culture of mouse heart cells, H9c2 cell culture, RT-PCR, immunoblotting and data statistical analysis.

[0091] T1D-DCM model mice were constructed, and the myocardial cells, myocardial fibroblasts and cardiac endothelial cells from the control and T1D-DCM groups were separated by enzyme digestion. It was found that compared with the normal control group, Cpxm2 decreased by 64.60% in the myocardial cells of T1D-DCM model mice, but there was no change in myocardial fibroblasts and cardiac endothelial cells ( Figure 1 O) (primer sequences see SEQ ID NO.15-18).

[0092] like Figure 2As shown in A-2B, immunoblotting and RT-PCR detection methods revealed that the levels of Cpxm2 protein and mRNA in the heart tissue of T1D-DCM mice were significantly reduced by 59.03% and 56.15%, respectively (primer sequences see SEQ ID NO.15-18); Figure 2 C-2D is a rat H9c2 cell model treated with normal glucose (NG) and high glucose (HG). Immunoblotting and RT-PCR detection methods found that the levels of Cpxm2 protein and mRNA in high glucose-treated cardiomyocytes were significantly reduced, by 67.57% and 72.61%, respectively (primer sequences see SEQ ID NO.25-28). The above results suggest that the synthesis and expression of Cpxm2 are abnormally reduced in T1D-DCM animal and cell models.

[0093] Example 3: Study on the therapeutic effect of cardiomyocyte-specific overexpression of Cpxm2 on DCM.

[0094] The experimental techniques involved in Example 3 include: animal model construction, mouse transthoracic cardiac ultrasound, H9c2 cell culture, immunoblotting, RT-PCR, serum CK-MB and LDH determination, Caspase 3 activity detection and data statistical analysis.

[0095] In order to evaluate the physiological function of Cpxm2 gene in cardiomyocytes, the present invention constructs and verifies an experimental system capable of specifically overexpressing Cpxm2 gene in cardiomyocytes. The obtained cDNA sequence of Cpxm2 gene is used for PCR amplification to obtain the target gene fragment. Appropriate restriction endonuclease sites (EcoRI) are added to the 5' end and 3' end of Cpxm2 respectively to facilitate subsequent cloning operations. The selected restriction sites should avoid the same sites inside the Cpxm2 gene as much as possible to avoid damage to the gene sequence. Adeno-associated virus vector (AAV9) is selected as an expression vector, and the α-myosin heavy chain (α-MHC) promoter is used to drive the expression of Cpxm2. The α-MHC promoter is inserted into the upstream of the multiple cloning site (MCS) of the AAV9 vector, and the appropriate restriction endonuclease EcoRI is selected for double enzyme digestion. The selected enzyme digestion site should be located in the MCS and not destroy other important elements of the vector. The Cpxm2 gene fragment is seamlessly connected to the multiple cloning site of the vector, and the Cpxm2 fragment and the vector after enzyme digestion are connected together by T4 DNA ligase. The recombinant plasmid was transformed into competent E. coli cells, positive clones were screened, and the correct insertion and absence of mutations of the Cpxm2 gene were verified by sequencing. 293T cells were used as packaging cell lines for the production of viral vectors. The constructed recombinant vector and packaging plasmid were co-transfected into 293T cells, and the cell culture supernatant was collected after 72 hours. The virus particles were purified by ultracentrifugation or iodine gradient ultracentrifugation, and the virus titer was determined by real-time fluorescence quantitative PCR. The results are shown in Figure 3 As shown in A, after cardiomyocyte-specific overexpression of Cpxm2, the protein level of Cpxm2 increased by 2.01 times, indicating that Cpxm2 was overexpressed successfully.

[0096] The method for specifically overexpressing Cpxm2 in the mouse heart is to receive a single injection of Cpxm2 overexpression plasmid carrying the cardiac-specific troponin T (cTnT) promoter or negative control AAV9 viral vector into the tail vein of the mouse, which are divided into overexpression (Cpxm2 OE) group and control (empty vector Vector) group. Six weeks after STZ injection, 100 μL of Cpxm2 overexpression plasmid carrying the cTnT promoter or negative control AAV9 viral vector (10× 11 PFU / mL), and cardiac ultrasound or biochemical analysis was performed after 6 weeks.

[0097] Representative images of mouse transthoracic cardiac ultrasound are shown in Figure 2. Figure 3 As shown in B. Figure 3 C shows that the left ventricular ejection fraction (EF) value of T1D-DCM mice was significantly reduced, and the EF value of T1D+Cpxm2 OE (overexpression) group, i.e., after targeted overexpression of Cpxm2 in T1D-DCM mouse cardiomyocytes, was significantly restored; Figure 3D is the left ventricular shortening fraction (FS) of mice in different groups. The results showed that the FS value of T1D-DCM mice was significantly reduced, and the FS value was significantly restored after targeted overexpression of Cpxm2 in mouse cardiomyocytes. The above results indicate that overexpression of the Cpxm2 gene can reverse the cardiac function damage caused by T1D.

[0098] The present invention detects the myocardial injury indicators CK-MB and LDH. Figure 3 E and 3F showed that compared with the control mice, the levels of CK-MB and LDH in the serum of T1D-DCM mice increased by 1.23 times and 1.88 times, respectively, while cardiomyocyte-specific overexpression of Cpxm2 significantly reduced the levels of CK-MB and LDH in the serum of T1D-DCM mice.

[0099] RT-PCR was performed according to the primers of each gene (SEQ ID NO.3-16), and the results showed that cardiomyocyte-specific overexpression of Cpxm2 significantly reduced the mRNA levels of myocardial hypertrophy markers (ANP, BNP, β-MHC) and myocardial fibrosis markers (Collagen I, Collagen III, Fibronectin) in T1D-DCM mice ( Figure 3 G and 3H).

[0100] To further clarify the therapeutic effect of overexpression of Cpxm2 in cardiomyocytes on DCM, H9c2 cardiomyocytes were transfected with Cpxm2 overexpression plasmids. The cells were seeded in 96-well cell culture plates, transfected with pcDNA.3.1 empty vector and pcDNA.3.1-Cpxm2 overexpression plasmids (0.5 μg), and treated with normal glucose (NG, 5.5 mM glucose mixed with 27.8 mM mannitol) and high glucose (HG, 33.3 mM glucose) for 48 hours.

[0101] Figure 4 A The results showed that overexpression of Cpxm2 significantly increased its protein content by about 1.96 times. Figure 4 B and 4C showed that overexpression of Cpxm2 significantly restored the decrease in cell viability caused by high glucose (HG) and inhibited the activity of Caspase 3. Figure 4 D. RT-PCR results showed that overexpression of Cpxm2 significantly reduced the increase in the mRNA levels of cardiomyocyte hypertrophy markers (ANP, BNP, β-MHC) induced by high glucose (primer sequences see SEQ ID NO.19-26).

[0102] The present invention relates to the sequence:

[0103] The nucleotide sequence of mouse Cpxm2 gene (NCBI gene ID: 55987):

[0104] SEQ ID NO.1:

[0105] atggtgagcaatgacagccacacatgggttactgtgaagaatggatctggcgacatgatatttgaaggaaacagtgagaaggagattcctgtgct

[0106] caatgagctgccagtccccatggtggcccgctacattcgcataaaccctcagtcctggtttgataacgggagcatctgcatgaggatggagatct

[0107] tgggctgcccactgccggatcctaataactattatcaccgacgtaatgagatgaccaccacggatgacctggattttaagcaccacaactataag

[0108] gaaatgcgccagttgatgaaggttgtcaatgaaatgtgccccaatattaccaggatttacaacattggcaaaagccaccagggcctgaaattgtat

[0109] gc ggtagagatc tctgaccatc ctggggaaca tgaagttggtgagc ccgagttccactacatcgca ggggcccacggcaatgaggt

[0110] tctgggacga gaactgctgc tgctgctgct gcacttcctc tgccaggaatactcggcgcagaacgcacgc atcgtccgct tggtggagga

[0111] gactcgaatc cacattctaccctccctcaa tcctgatggc tatgagaagg cctatgaaggagtgg ccacagagac cagagccgtc

[0112] atcgcctgga tggagaagat cccgtttgtgctgggaggca acctacaggg gggtgagctggtcgtggcat acccctatga

[0113] catggtgcggtccctgtgga agacccagga gcacacccca acacctgatg atcatgtgttccgctggctggcgtattcct acgcctccac

[0114] tcaccgcctc atgacagatg ccaggaggcg agtgtgccacacggaagatt ttcagaaggaggagggcacc gtcaatgggg

[0115] cttcctggca cacagtggctggaagtct aaacgatttc agctacctccatacaaactgctttgagctg tccatctacg tgggctgtga

[0116] taaataccca cacgagagcg agctgccggaggaatgggag aataaccggg agtctctgattgtgttcatg gagcaggttcatcgag

[0117] gcatcaaagg catagtgaga gatttacaagggaaagggat ttcaaatgct gtcatctctgtggaaggtgt taaccatgac

[0118] atccggacagcc agcgatgggg attactggcg tctactgaaccctggcgaat atgtggtcacagccaaggcg gaaggcttta

[0119] tcacttccac caagaactgcatggttggct atgatatggg agctactcgg tgtgacttcaccctcacaaa gaccaacctggctaggataa

[0120] gagaaattat ggagacattt gggaagcagc ctgtcagcct accctccaggcgcctgaagctgcggggacg gaaaaggcgg

[0121] cagcgtgggt ga

[0122] Nucleotide sequence of the rat Cpxm2 gene (NCBI gene ID: 293566):

[0123] SEQ ID NO.2:

[0124] atggcccgtctggggaccgccttccccgcggtggccctggcacttgtggcagtggccctggctggagtcagagcccagggcgaagccttcga

[0125] ggagcctgactattacagccaggagctctggaggcgcgggcgctactatgagaatggggagccagagcctgagccggagctcttctcgcctt

[0126] cacagcatgaggacctacgggtggaggagcaggaacagcaggagccgcaccagcaggggcccaggaagcccaagaaggccactaagcc

[0127] caaaaaggctcccaagagggagaagttagttgcagagacgcctccaccaggtaaaaatagcaacagaaaaggcagaaggagcaagaatctt

[0128] gagaaagctgcccgcgatgaccatggtgtccctgtggttcgtgaggatgtcagagagagttgtccacctcttggtctggaaacattaaaaatcac

[0129] agacttccagctacatgcctccacaacaaagcgttatggtctgggagcccatcgtgggagactcaacatccaggcaggcattaatgaaaacgac

[0130] ttttacga tggggcttgg tgtgccggta ggaacgacttgcatcagtgg atcgaagtggacgcccggcg cctgactaag

[0131] ttcacaggggtcattacccaaggaaggaac tctctctggc tg agtgactggg tgacgtcctacaaagtcatggtgagcaatg

[0132] acagccacacatgggttacc gtgaagaatg gatctggtga catgatatttgaaggaaacaatgagaaggagacc cctgtgctca

[0133] atgagctgcc agtccccatg gtggcccgct acattcgcataaaccctcag tcctggtttgataatgggag catctgtatg aggatggaga

[0134] tcttgggctgcccactgcca gatccta ataactta tcaccgacgtaatgagatgaccaccactga tgacctggat tttaagcacc

[0135] acaactataa ggaaatgcgccagttgat gaaggttgtgaatgagatgt gccccaatattaccaggatt tacaacattg gcaaaagtca

[0136] cggggcctgaagttgtatg cgtaggat ttctgaccat cctggggacacgaagttggtgagcc cgagttccactacatcgcag

[0137] gggcccatgg caatgaggtt ctggggccgag agctgctgct gctgctgctggagttcctctgccaggagta cttggcgcag

[0138] aacacacgca tcgtccgctt ggtggaggagactcggattc acattctacc ctccctcaatcctgatggct atgaaaaggc ctatgaagga

[0139] ggttccg agttgggagg ctggtccctg ggacgttgga cccatgatggcattgacatcaacaacaact ttccggattt aaacacgctg

[0140] ctctgggagg cagaggaccggcagaacgcc ccaaggaaag ttcccaacca ctacattgccatccctgagtggtttctgtctgagaatgcc

[0141] acagtgg ccatggagac cagagccatc attgcttggatggagaagat cccgtttgtgctgggaggca acctacaggg gggtgagctg

[0142] gttgtagcatacccctacgacatggtgcggtccctgtggaagacccaggagcacaccccgacacccgacgatcacgtgttccgctggctggct

[0143] tactcttatgcctccactcaccgcctcatgaccgatgccaggaggcgagtgtgccacacagaggaatttcagaaggaagaaggcaccgtcaat

[0144] ggggcttcctggcacaccgtggctggaagtctaaatgacttcagttacctccatacgaactgctttgagctgtccatctacgtgggctgcgataaat

[0145] acccacacgagagtgagctgcccgaggaatgggagaataaccggga gtctctgatt gtgttcatggaacaggttcatcg aggcatcaaa

[0146] ggcatagtga gagacttacaagggaaaggg atttctaatg ccatcatctc tgtggaaggtgttaaccatg acatccggacagccagcg

[0147] atggggattattggcgcctactgaaccctggtgaatacgtggtcacagcgaaagcagaaggctttatcacctccaccaagaactgcatggttggc

[0148] tatgacatgggagcaactcggtgtgacttcacactcagcaagaccaacctggctaggataagagaaatcatggagacatttgggaagcagcct

[0149] gtcaacctacct gccaggcgcc tgaagctgcggggacgaaaa aggcggcagc gcgggtga

[0150] Protein ANP gene (NCBI gene ID:230899):

[0151] SEQ ID NO.3:Forward:5′-ACCTGCTAGACCACCTGGAG-3′,

[0152] SEQ ID NO.4:Reverse:5′-CCTTGGCTGTTATCTTCGGTACCGG-3′.

[0153] Encoding BNP gene (NCBI gene ID:18158):

[0154] SEQ ID NO.5:Forward:5′-GAGGTCACTCCTATCCTCTGG-3′,

[0155] SEQ ID NO.6:Reverse:5′-GCCATTTCCTCCGACTTTTCTC-3′.

[0156] β-MHC complex (NCBI gene ID: 140781):

[0157] SEQ ID NO.7:Forward:5′-CCGAGTCCCAGGTCAACAA-3′,

[0158] SEQ ID NO.8:Reverse:5′-CTTCACGGGCACCCTTGGA-3′.

[0159] Collagen I gene (NCBI gene ID: 12842):

[0160] SEQ ID NO.9:Forward:5′-CCCAAGGAAAAAGAAGCACGTC-3′

[0161] SEQ ID NO.10: Reverse:5′-AGGTCAGCTGGATAGCGACATC-3′

[0162] Primers for mouse collagen III (NCBI gene ID: 12825):

[0163] SEQ ID NO.11: Forward:5′-TGGTAGAAAGGACACAGAGGC-3′

[0164] SEQ ID NO.12: Reverse:5′-TCCAACTTCACCCTTAGCACC-3′

[0165] Primers for mouse Fibronectin (NCBI gene ID: 14268):

[0166] SEQ ID NO.13: Forward:5′-ATGTGGACCCCTCCTGATAGT-3′

[0167] SEQ ID NO.14: Reverse:5′-GCCCAGTGATTTCAGCAAAGG-3′

[0168] Mouse internal reference β-actin primers (NCBI gene ID: 11461):

[0169] SEQ ID NO.15: Forward:5′-CCGTGAAAAGATGACCCAGA-3′

[0170] SEQ ID NO.16: Reverse:5′-TACGACCAGAGGCATACAG-3′

[0171] Primers for mouse Cpxm2 (NCBI gene ID: 55987):

[0172] SEQ ID NO.17: Forward:5′-GGGCGCTATTATGGGCATCC-3′

[0173] SEQ ID NO.18: Reverse:5′-GGCCTTCTTGGGAGTTCTGT-3′

[0174] Primers for rat ANP (NCBI gene ID: 24602):

[0175] SEQ ID NO.19:Forward:5′-GGCCTTTTGGCTCCCAGGCC-3′

[0176] SEQ ID NO.20:Reverse:5′-CTAAGTGCCGCCCCCGCTTC-3′

[0177] Host BNP gene (NCBI gene ID:25105):

[0178] SEQ ID NO.21:Forward:5′-TTGGGCAGAAGATAGACCGGAT-3′

[0179] SEQ ID NO.22:Reverse:5′-GGTCTTCCTAAAACAACCTCA-3′

[0180] β-MHC complex (NCBI gene ID:29557):

[0181] SEQ ID NO.23:Forward:5'-GCAGACAGAGAATGGGGAGCTGTCC-3'

[0182] SEQ ID NO.24:Reverse:5′-TCGCAATCATGCCGGGCTGAC-3′

[0183] Material β-actin complex (NCBI gene ID:81822):

[0184] SEQ ID NO.25:Forward:5′-AAGTCCCTCACCCTCCCAAAAG-3′

[0185] SEQ ID NO.26:Reverse:5′-AAGCAATGCTGTCACCTTCCC-3′

[0186] Cpxm2 gene (NCBI gene ID: 293566):

[0187] SEQ ID NO.27:Forward:5'-TGCCTTCTGCCATGAACAGT-3'

[0188] SEQ ID NO.28:Reverse:5'-TATGTTCTCTCTCCCCGGGG-3'

[0189] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Application of plasmid overexpressing Cpxm2 gene in the preparation of anti-diabetic cardiomyopathy drugs.

2. The use according to claim 1, characterized in that: The drug alleviates myocardial hypertrophy and myocardial fibrosis induced by diabetic cardiomyopathy.

3. The use according to claim 1, characterized in that: The dosage form of the drug is any one of suspension, granules, capsules, powders, tablets, emulsions, pills, injections, suppositories, enemas, aerosols, patches or drops.

4. The use according to claim 1, characterized in that: The administration route of the drug is oral administration, sublingual administration, rectal administration, skin mucosal administration, inhalation administration or injection administration.

5. Application of Cpxm2 gene or protein in screening drugs for preventing or treating diabetic cardiomyopathy.

Images