A Lactobacillus plantarum and its application in preparing a preparation for preventing and treating inflammatory bowel disease and having antioxidant, anti-inflammatory and antibacterial functions

By using Lactipintibacillus plantarum 19-4, this strain has antioxidant, anti-inflammatory and antibacterial properties, solving the problems of intestinal microbial imbalance and lack of antioxidant substances in patients with inflammatory bowel disease, significantly improving the inflammatory condition of the mice's colon and providing a safe and effective alternative therapy.

CN118792209BActive Publication Date: 2025-06-17SHANGHAI BONA TIANCHUN BIOTECHNOLOGY CO LTD

Patent Information

Application Number
CN202411072117.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-06
Publication Date
2025-06-17
Estimated Expiration
2044-08-06

AI Technical Summary

Technical Problem

Intestinal microbial imbalance and lack of antioxidant substances in patients with inflammatory bowel disease (IBD) lead to intestinal inflammation and oxidative stress. The existing treatment methods have side effects and safe and effective alternative therapies are needed.

Method used

A Lactipintibacillus plantarum 19-4 was used, which has good antioxidant, anti-inflammatory and antibacterial properties. It was proved that it has improved function for inflammatory bowel disease by constructing a mouse colitis model.

Benefits of technology

Lactobacillus plantarum 19-4 can significantly reduce the inflammatory activity index of mice's colon, reduce intestinal pathological damage, enhance antioxidant levels, and reduce inflammatory factor expression, thereby alleviating the symptoms of inflammatory bowel disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118792209B_ABST
    Figure CN118792209B_ABST
Patent Text Reader

Abstract

The present invention discloses a Lactobacillus plantarum and its application in the preparation of functional preparations for preventing and treating inflammatory bowel disease, as well as antioxidant, anti-inflammatory and antibacterial functions. It has excellent ability to scavenge reactive oxygen species, as well as good probiotic characteristics such as acid tolerance, bile salt tolerance, hydrophobicity, self-aggregation ability and inhibition of common human pathogenic bacteria. At the same time, it can improve intestinal inflammation, has a preventive and therapeutic effect on inflammatory bowel disease, and has high biological safety. It can be used as a probiotic preparation to relieve inflammatory bowel disease, improve intestinal mucosal damage and colon inflammation, providing a new strategy for the prevention and treatment of inflammatory bowel disease and having potential clinical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly relates to a Lactiplantibacillus plantarum and its application in the preparation of functional preparations for preventing and treating inflammatory bowel disease and having antioxidant, anti-inflammatory and antibacterial functions. Background Art

[0002] Inflammatory bowel disease (IBD) is a chronic non-specific inflammatory disease that occurs in the gastrointestinal tract. It is divided into ulcerative colitis (UC) and Crohn's disease (CD), and the incidence rate has been increasing year by year. IBD shows extensive lesions, often spreading to the entire colon, mainly manifested as ulcers and erosion of the colonic mucosa. IBD is a recurrent disease that is difficult to cure and often develops into colorectal cancer (CRC). In recent years, IBD has become a global public health problem. Although the pathogenesis of the disease is still unclear, there is a considerable amount of evidence indicating that the disease is the result of the combined effects of genetic, environmental and dietary factors. At the same time, persistent intestinal infections, intestinal microbiota imbalance, intestinal mucosal immune regulation, abnormal intestinal barrier function, etc. are also related to the occurrence and development of IBD. The medical treatment of IBD focuses on controlling inflammation and preventing disease progression to induce remission. Traditional non-targeted treatments, such as aminosalicylates, glucocorticoids and immunomodulators, usually have strong side effects. Therefore, there is an urgent need to develop safe and effective alternative therapies.

[0003] The composition and function of the intestinal microbiota are key factors affecting the progression of IBD. Intestinal microbiota dysbiosis can lead to damage to the intestinal barrier and cause intestinal inflammation. Lactobacilli can re-establish intestinal symbiosis and protect the intestinal mucosa by increasing the adhesion of healthy probiotics to the intestinal mucosa, inhibiting the adhesion of pathogens to the mucosal surface, competitively eliminating pathogenic microorganisms, producing antibacterial substances, and regulating immune function. Lactiplantibacillus plantarum belongs to the genus Lactobacillus, which is the largest genus among lactobacilli. It is Gram-positive, short rod-shaped, microaerophilic, acid-tolerant, does not form spores, and is mostly used as a starter in the food industry. Currently, it has become attractive to directly change the composition of the intestinal microbiota by supplementing probiotics for the treatment or remission of IBD.

[0004] The level of ROS in IBD tissues is significantly increased, while the level of antioxidant substances decreases. Inflammation is the main manifestation of IBD, and ROS plays a crucial role in the inflammatory process. Inflammatory mediators can induce the production of ROS, and excessive ROS can further activate the inflammatory / immune response through the NF-KB signaling pathway, leading to an increase in the expression and secretion of pro-inflammatory cytokines and exacerbating disease development. There is also evidence that the ability of inflammatory cells in the intestinal mucosa of CD patients to produce ROS is significantly increased, and the level of ROS in the plasma of UC patients is also significantly increased. The invasion of ROS can damage the intestinal mucosal epithelial barrier, trigger apoptosis, exacerbate intestinal inflammation, and may induce allergic reactions and immune-inflammatory reactions in the intestinal tissue. At the same time, IBD patients often lack antioxidant substances. Multiple studies have shown that the levels of multiple antioxidant substances in the plasma of UC and CD patients are significantly decreased. In addition, the activities of antioxidant enzymes are also weakened, such as superoxide dismutase, glutathione peroxidase, etc. Summary of the Invention

[0005] The object of the present invention is to provide a Lactiplantibacillus plantarum with good antioxidant, anti-inflammatory, and antibacterial properties and its application.

[0006] The present invention provides Lactiplantibacillus plantarum 19-4, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on June 24, 2024. The taxonomic name is Lactiplantibacillus plantarum, and the deposit number is GDMCC No: 64788.

[0007] Lactiplantibacillus plantarum 19-4 was isolated from healthy wild boar fecal samples. After sequencing verification, the sequence of the 16S rRNA of this strain is consistent with that of Lactiplantibacillus plantarum. Through in vitro experiments, it was found that this strain has excellent reactive oxygen species scavenging ability, as well as good acid tolerance, bile salt tolerance, hydrophobicity, self-aggregation ability, and other probiotic characteristics such as inhibiting common pathogenic bacteria, and is sensitive to common antibiotics; by constructing a mouse colitis model, it was proved that this strain is harmless to animals and has the function of improving inflammatory bowel disease, can reduce the disease activity index (DAI) and the shortening of colon length in colitis mice, and reduce the colon pathological score. At the same time, it enhances the antioxidant level and reduces the expression of inflammatory factors, thereby alleviating disease damage. The Lactiplantibacillus plantarum 19-4 provided by the present invention shows good probiotic potential and excellent application prospects in the prevention and / or treatment of inflammatory bowel disease.

[0008] The present invention provides a bacterial agent, which contains the above-mentioned Lactobacillus plantarum 19-4. It also includes inulin, trehalose, galactomannan, cellulose powder and dry matter of probiotic metabolites; among them, the viable count of Lactobacillus plantarum 19-4 is 10 10 ~10 12 CFU / g.

[0009] The present invention also provides a preparation method of the above probiotic preparation, which includes the following steps:

[0010] 1) Activate the above probiotics: Inoculate Lactobacillus plantarum 19-4 into fresh liquid medium for culture to obtain a bacterial suspension. The specific process is: slant culture of bacteria → primary liquid seed culture → secondary liquid seed culture;

[0011] 2) Solid probiotic preparation: Centrifuge the above secondary probiotic seed liquid at 8000-10000 rmp / min for 10 min to collect the supernatant fermentation broth and the precipitate. Add 1-2 times the mass of freeze-drying protectant (3-7% inulin, 3-7% trehalose) to the precipitate and mix evenly, then freeze-dry. First, perform vacuum concentration on the supernatant fermentation broth, and then perform low-temperature spray drying. The inlet air temperature is 100 °C and the outlet air temperature is 60 °C to obtain dry powder. Mix the dry powder of the fermentation broth and the dry powder of the probiotics in a ratio of 0.5-2:1, and finally add galactomannan and cellulose powder and stir evenly;

[0012] 3) Liquid compound probiotic preparation: Centrifuge the above secondary probiotic seed liquid at 8000-10000 rmp / min for 10 min to collect the precipitate and the supernatant fermentation broth for standby. First, perform vacuum concentration on the supernatant fermentation broth, mix the concentrated fermentation broth and the probiotic precipitate in a ratio of 1-3:1, and finally add inulin, trehalose, galactomannan and cellulose powder and stir evenly.

[0013] The beneficial effects of the present invention are as follows: The Lactobacillus plantarum 19-4 provided by the present invention has excellent ability to scavenge reactive oxygen species, as well as good probiotic characteristics such as acid tolerance, bile salt tolerance, hydrophobicity, self-aggregation ability and inhibition of common human pathogenic bacteria; at the same time, it can improve intestinal inflammation, has the prevention and treatment effects on inflammatory bowel disease, and has high biological safety. It can be used as a probiotic preparation to relieve inflammatory bowel disease, improve intestinal mucosal damage and colon inflammation, providing a new strategy for the prevention and treatment of inflammatory bowel disease and having potential clinical application prospects.

[0014] It has been confirmed by experiments on the C57BL / 6 mouse colitis model that after 21 days of pre-gavage treatment with the Lactobacillus plantarum 19-4 bacterial suspension, the strain has no obvious toxic and side effects on the experimental animals. After 7 days of formal intervention, it was found that the symptoms such as diarrhea and bloody stools in the mice were significantly alleviated compared with the model group, the DAl decreased significantly, the symptoms of colon shortening and phenotypes were significantly improved, the pathological damage of the colon in the colitis mice was reduced, the histopathological score of the colon tissue was decreased, and at the same time, the antioxidant enzyme activities in the serum and liver of the mice were significantly increased, while the levels of colonic inflammatory factors were significantly decreased, proving that Lactobacillus plantarum 19-4 can improve the intestinal mucosal injury and relieve the inflammatory response in colitis mice.

[0015] In the present invention, the probiotics and their metabolites are mixed with a variety of prebiotics in a certain proportion. On the one hand, the various prebiotics provide sufficient nutrients for the probiotics, promoting the proliferation and colonization of the probiotics in the intestine; on the other hand, the above probiotic preparation includes the probiotic fermentation products, increasing the antibacterial ability of the combination. At the same time, the fermentation broth contains a large amount of short-chain fatty acids, indole derivatives, etc., which directly affect intestinal lipid metabolism and barrier integrity, and also avoid the waste of the fermentation broth. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0017] Wherein:

[0018] Figure 1 is the growth curve of the Lactobacillus plantarum of the present invention;

[0019] Figure 2 is the morphology of Lactobacillus plantarum 19-4 on the MRS solid medium; microscopic morphology observation of Lactobacillus plantarum;

[0020] Figure 3 is the phylogenetic analysis of Lactobacillus plantarum;

[0021] Figure 4 is the microscopic morphology observation of Lactobacillus plantarum;

[0022] Figure 5 is the antibacterial circle diagram of Lactobacillus plantarum 19-4 against common pathogenic microorganisms in Example 3 of the present invention;

[0023] Figure 6 is the antibacterial circle diagram of different Lactobacillus plantarum against drug-resistant Staphylococcus epidermidis in Example 4 of the present invention;

[0024] Figure 7Effect of Lactobacillus plantarum 19-4 on the biofilm formation of drug-resistant Staphylococcus epidermidis in Example 5 of the present invention;

[0025] Figure 8 For Figure 7 The absorbance values of different groups in

[0026] Figure 9 The body weight change trend of each group of mice at 28 days in Example 6 of the present invention;

[0027] Figure 10 Statistical analysis chart of DAI of each group of mice during DSS intervention in Example 6 of the present invention;

[0028] Figure 11 Analysis of colon length and phenotype of each group of mice in Example 6 of the present invention;

[0029] Figure 12 Histogram of HE staining and pathological score statistics of colon mucosa tissues of each group of mice in Example 6 of the present invention;

[0030] Figure 13 Changes in the activities of antioxidant enzymes in serum and colon of each group of mice in Example 6 of the present invention;

[0031] Figure 14 Expression levels of pro-inflammatory cytokines in the colon of each group of mice in Example 6 of the present invention.

[0032] The values in the figures are all shown as mean ± standard deviation; * is P < 0.05, ** is P < 0.01, *** is P < 0.001 VS CON. Among them, CON represents the control group, DSS represents the model group, l and ll represent the probiotic preparation intervention groups, n = 6. Detailed implementation manners

[0033] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below with reference to the accompanying drawings in the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without creative efforts shall fall within the protection scope of the present invention.

[0034] Example 1: Isolation and identification of Lactobacillus plantarum

[0035] (1) Strain isolation

[0036] An appropriate amount of fresh and healthy wild boar feces samples were resuspended in sterile PBS and serially diluted 10-fold. Then, the diluents of appropriate gradients were selected for plate coating, and incubated statically at 37 °C for 24 h. Colonies with different sizes and colors were picked for Gram staining and catalase reaction to screen for lactic acid bacteria, and subcultured and purified 3 times. The purified strains can be used for experiments or cryopreservation.

[0037] Figure 1 The growth curve of Lactobacillus plantarum was shown. The first 4 h was the lag phase, 4 - 12 h was the logarithmic phase, 12 - 48 h was the stationary phase, and there was no decline phase.

[0038] Figure 2 The microscopic morphology of Lactobacillus plantarum was shown. This bacterium was a Gram-positive bacterium, with a rod-shaped cell morphology, and the cell size (width × length) was (1.28 - 1.60) μm × (2.4 - 8.0) μm.

[0039] (2) Identification of the 16S rRNA gene of the strain

[0040] The genomic DNA of the lactic acid bacteria fermentation broth cultured for 24 h was extracted according to the instructions of the bacterial DNA kit. The 16S rRNA gene of the strain was amplified with the universal primers for the 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCA; 1492R: AAGTCGTAACAAGGTAGCCGT). The PCR amplification product was sequenced, and the obtained sequence was submitted to the NCBI online database (https: / / www.ncbi.nlm.nih.gov / ) for homology comparison for preliminary identification.

[0041] The composition of the PCR system (20 μL): Premi×Taq, 10 μL; ddH2O, 7 μL; upstream and downstream primers (27F and 1492R), 1 μL each; genomic DNA, 1 μL.

[0042] PCR amplification conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 0.5 min; annealing at 58 °C for 0.5 min;

[0043] extension at 72 °C for 1 min; 32 cycles; 72 °C for 10 min.

[0044] The sequence analysis was performed using the software MEGA7.0, and the phylogenetic analysis was performed using the Neighbor-Joining method to construct an evolutionary tree to study the genetic relationship between the isolated strain and the type strain.

[0045] Figure 3 It was shown that the lactic acid bacteria isolated in the present invention had the closest genetic relationship with the species of Lactobacillus plantarum and belonged to the genus Lactobacillus plantarum.

[0046] Example 2: Antioxidant Analysis of Lactobacillus plantarum

[0047] (1) Determination of hydrogen peroxide tolerance

[0048] Take 20 μL of the bacterial suspension with the cell concentration adjusted to 1×10 8 CFU / mL and inoculate it into 2 mL of MRS liquid medium with a H2O2 concentration of 3.5 mmol / L. After culturing at 37 °C with constant shaking for 12 h, measure the absorbance value at 600 nm.

[0049] It was determined that Lactobacillus plantarum 19-4 can tolerate a certain concentration of hydrogen peroxide.

[0050] Table 1 Tolerance to H2O2

[0051] Strain <![CDATA[OD 600 > Strain OD600 Strain <![CDATA[OD 600 > 10-1 1.65±0.02 6-8 1.63±0.02 9-6 1.25±0.02 19-4 1.79±0.02 8-3 1.63±0.02 15-4 1.16±0.02 15-1 0.86±0.02 8-4 1.62±0.03 3-10 0.97±0.02 5-1 0.84±0.02 13-2 1.60±0.02 4-10 0.96±0.03 10-2 1.73±0.02 10-10 0.83±0.02 12-4 0.94±0.02 6-9 1.71±0.02 12-10 1.48±0.01 12-5 0.90±0.02 4-7 1.70±0.02 8-5 1.39±0.03 11-3 1.69±0.02 14-2 1.37±0.03 14-1 1.66±0.02 4-6 1.27±0.02

[0052] Note: The values are expressed as mean ± standard deviation.

[0053] (2) Preparation of cell-free extract

[0054] After culturing Lactobacillus plantarum for 24 h, take the fermentation broth and centrifuge it at 4000 rpm for 15 min to collect the bacterial cells. Wash the cells 3 times with double-distilled water and adjust the bacterial count of lactic acid bacteria to 1×10 9 CFU / mL. Then ultrasonically disrupt the cells in an ice bath. Centrifuge the disrupted solution at 6000 rpm for 10 min and collect the supernatant, which is the sample to be measured.

[0055] (3) Experiment on scavenging superoxide anion radicals

[0056] Take 4.5 mL of Tris-HCL solution (0.1 mol / L, pH = 8.2), 1 mL of EDTA solution (1 mmol / L), 2.4 mL of distilled water, and 1 mL of the sample. Mix them evenly and incubate in a water bath at 25 °C for 10 min. Add 1 mL of pyrogallol solution (9 mmol / L) and let it stand in the dark at room temperature for 60 min. Then add 100 μL of 12 mol / L HCL to terminate the reaction and detect the absorbance at 325 nm.

[0057] The calculation formula for the scavenging rate of superoxide anion radicals is:

[0058]

[0059] In the formula: A0 is the absorbance of the blank group; A1 is the absorbance of the experimental group; A2 is the absorbance of the control group.

[0060] It was determined that the scavenging rate of superoxide anion radicals of Lactobacillus plantarum 19-4 is 90.8%.

[0061] Table 2 Superoxide anion radical scavenging rate (%)

[0062] Strain Clearance rate Strain Clearance rate Strain Clearance rate 6-8 76.86±0.01 10-2 85.87±0.01 12-10 80.84±0.01 19-4 90.77±0.01 5-1 85.04±0.02 8-4 80.72±0.01 15-4 90.69±0.02 15-1 84.55±0.03 12-4 81.37±0.01 6-9 75.17±0.02 14-2 84.41±0.01 10-8 79.64±0.01 4-6 78.42±0.01 9-6 84.22±0.01 10-1 79.51±0.01 10-10 90.35±0.01 4-10 83.81±0.01 13-2 79.29±0.01 3-10 86.15±0.01 12-5 82.37±0.01 8-5 88.81±0.01 8-3 81.63±0.02 4-7 87.82±0.02 14-1 81.47±0.01

[0063] Note: Values are expressed as mean ± standard deviation.

[0064] (3) Determination of DPPH radical scavenging ability

[0065] Take 1 mL of the sample, add 1 mL of DPPH ethanol solution (0.4 mmol / L), mix well, let stand in the dark at room temperature for 30 min, centrifuge at 6000 rpm for 10 min, and measure the absorbance value of the sample at 517 nm.

[0066] The formula for calculating the DPPH radical scavenging rate is:

[0067]

[0068] Where: A0 is the absorbance of the blank group; A1 is the absorbance of the experimental group; A2 is the absorbance of the control group

[0069] After determination, the DPPH scavenging rate of this Lactobacillus plantarum was 89.5%.

[0070] Table 3 DPPH scavenging rate (%)

[0071] Strain Clearance rate Strain Clearance rate Strain Clearance rate 8-3 68.243±0.09 4-7 87.16±0.01 12-5 86.486±0.09 19-4 89.47±0.02 4-10 87.06±0.01 9-6 86.389±0.04 14-1 89.38±0.03 6-9 87.06±0.02 4-6 86.178±0.02 6-8 88.32±0.01 15-4 87.06±0.02 14-2 87.25±0.03 10-1 86.48±0.05 5-1 86.96±0.02 15-1 86.107±0.02 13-2 87.83±0.02 12-10 86.87±0.06 10-2 86.004±0.03 8-5 87.64±0.01 8-4 84.653±0.01 3-10 85.811±0.07 12-4 80.792±0.03 10-10 87.45±0.01 10-8 86.58±0.09

[0072] Note: Values are expressed as mean ± standard deviation.

[0073] Combined with the above hydrogen peroxide tolerance experiment, superoxide anion radical scavenging and DPPH scavenging experiments, this Lactobacillus plantarum 19-4 has a high antioxidant effect, so it can be used for the preparation of subsequent probiotic agents.

[0074] Example 3: Characterization of Lactobacillus plantarum

[0075] (1) Tolerance of Lactobacillus plantarum 19-4 to acid and bile salts

[0076] Inoculate the Lactobacillus plantarum 19-4 bacterial suspension into MRS liquid medium at pH 3.0 and MRS liquid medium containing 0.3% (w / v) bile salts, and incubate in an environment at 37 °C for 2 h or 4 h. Take the culture solutions at 0 h, 2 h and 4 h, dilute them in gradients and inoculate them on MRS agar medium, and calculate the total viable count.

[0077] The formula for calculating the bacterial survival rate:

[0078]

[0079] Where: A0 is the number of viable bacteria at 0 h of inoculation; A1 is the number of viable bacteria at the experimental time (2 or 4 h).

[0080] The results are shown in Table 4. After incubation for 2 h, the survival rates of the strain in MRS medium with pH 3.0 and containing 0.3% bile salts were 75% and 83.333% respectively.

[0081] Table 4 Survival rate of the strain

[0082]

[0083]

[0084] Note: The values are expressed as mean ± standard deviation.

[0085] (2) Tolerance of Lactobacillus plantarum 19-4 to artificial gastric juice and artificial intestinal juice

[0086] The bacterial suspension of Lactobacillus plantarum 19-4 was inoculated into artificial gastric juice (pH = 3) and artificial intestinal juice respectively, and incubated in an environment of 37 °C for 2 h or 4 h. The culture solutions at 0 h, 2 h and 4 h were taken, gradient diluted and then inoculated onto MRS agar medium to calculate the total number of viable bacteria.

[0087] Calculation formula for bacterial survival rate:

[0088]

[0089] Where: A0 is the number of viable bacteria at 0 h of inoculation; A1 is the number of viable bacteria at the experimental time (2 or 4 h).

[0090] The results are shown in Table 5. After incubation for 2 h, the survival rates of the strain in artificial gastric juice and artificial intestinal juice were 69.2% and 100% respectively.

[0091] Table 5 Survival rate of the strain

[0092] 19-4 Time Viable cell count (CFU / mL) Survival rate (%) Artificial gastric juice (pH = 3) 0h <![CDATA[1.3×10 9 > 100 2h <![CDATA[9×10 8 > 69.2 4h <![CDATA[8×10 8 > 61.5 Artificial intestinal juice 0h <![CDATA[1.7×10 9 > 100 2h <![CDATA[1.7×10 9 > 100 4h <![CDATA[1.6×10 9 > 94.10

[0093] Note: The values are expressed as mean ± standard deviation.

[0094] (3) Adhesion-related experiments of Lactobacillus plantarum 19-4

[0095] Hydrophobicity of the strain surface: The lactic acid bacteria suspension was mixed with PBS buffer at a certain ratio so that the OD value of the mixed solution was about 0.8 at a wavelength of 600 nm, denoted as A0. 1 mL of hydrophobic agent (xylene) was added to 3 mL of the adjusted-concentration lactic acid bacteria suspension, mixed well, pre-incubated at room temperature for 10 min, vortexed for 2 min, and left standing at room temperature for 15 min. After stratification, the lower aqueous phase was taken to measure the OD value at 600 nm, denoted as A1.

[0096] Calculation formula for strain hydrophobicity:

[0097]

[0098] In the formula: A0 is the OD of the lactic acid bacteria suspension with the initial adjusted concentration 600 ; A1 is the OD measured in the experiment 600

[0099] The results are shown in Table 6. The average auto-aggregation ability of strain 19-4 is 85.41%.

[0100] Table 6 Surface hydrophobicity of 19-4

[0101] Strain Hydrophobicity rate (%) 19-4 85.41±0.04

[0102] Note: The values are expressed as mean ± standard deviation.

[0103] Auto-aggregation ability: Mix the lactic acid bacteria solution and PBS buffer in a certain proportion so that the OD value of the mixed solution is about 0.8 at a wavelength of 600 nm, denoted as A0. Take 4 ml of the adjusted lactic acid bacteria suspension, mix well, and incubate at room temperature for 5 h. Pipette 1 ml of the bacterial suspension and measure the OD value at 600 nm using PBS buffer as a control, denoted as A1.

[0104] Auto-aggregation ability calculation formula:

[0105]

[0106] In the formula: A0 is the OD of the lactic acid bacteria suspension with the initial adjusted concentration 600 ; A1 is the OD measured in the experiment 600

[0107] The results are shown in Table 7. The average auto-aggregation ability of strain 19-4 is 86.56%.

[0108] Table 7 Auto-aggregation ability of 19-4 (%)

[0109] Time Self-aggregation rate (%) 5h 86.56±1.35

[0110] Note: The values are expressed as mean ± standard deviation.

[0111] Co-aggregation ability: Four pathogenic bacteria, Escherichia coli, Staphylococcus epidermidis, methicillin-resistant Staphylococcus epidermidis, and Salmonella enteritidis, were cultured in LB liquid medium at 37 °C for 18 h. Centrifuge at 3000 rpm for 10 min and discard the supernatant. Add an equal volume of sterilized PBS buffer, resuspend and mix well, centrifuge at 3000 rpm for 10 min, and repeat this step 2 - 3 times. Add a small amount of PBS buffer and resuspend and mix well. Mix the bacterial suspension and PBS buffer in a certain ratio so that the OD value of the mixed solution is about 0.8 at a wavelength of 600 nm. Mix the lactic acid bacteria suspension and the pathogenic bacteria suspension in equal volumes (2 mL each) and incubate at room temperature for 5 h. Culture the control group containing 4 mL of single-bacterial suspension under the same growth conditions and measure the OD value at 600 nm.

[0112] Co-aggregation ability calculation formula:

[0113]

[0114] In the formula: Ax and Ay represent the OD600 of the lactic acid bacteria suspension and the pathogenic bacteria suspension, and A(x + y) means the OD600 of the mixed bacterial suspension.

[0115] The results are shown in Table 8. Strain 19 - 4 can co-aggregate with four different pathogenic bacteria. Among them, the co-aggregation effect with Staphylococcus epidermidis is the best (41.62%), and the co-aggregation effect with Escherichia coli is also good (30.05%). This indicates that after colonizing the intestine, 19 - 4 can aggregate pathogenic bacteria and play an antibacterial role.

[0116] Table 8 Co-aggregation ability of 19 - 4 with different pathogenic bacteria (%)

[0117] Strain Co-aggregation rate (%) Escherichia coli 30.05±0.28 Staphylococcus epidermidis 41.62±0.41 Drug-resistant Staphylococcus epidermidis 25.26±0.43 Salmonella enteritidis 29.24±0.35

[0118] Note: The values are expressed as mean ± standard deviation.

[0119] (4) Determination of antimicrobial susceptibility of Lactobacillus plantarum 19 - 4

[0120] Using the disk diffusion method, spread 50 μL of the fermentation supernatant to be tested evenly on the MRS solid plate, place the antimicrobial susceptibility test disks in a plum blossom shape, incubate at 37 °C for 24 h, and measure the diameter of the inhibition zone to analyze the drug resistance of the strain to be tested. In this experiment, drug susceptibility tests were performed on eight categories and 13 antibiotics, including β-lactams (amoxicillin, ampicillin, cefixime), macrolides (tivantinib, tylosin tartrate), aminoglycosides (amikacin, gentamicin sulfate), chloramphenicols (chloramphenicol, florfenicol), fluoroquinolones (enrofloxacin), sulfonamides (sulfadiazine), lincosamides (lincomycin), and pleuromutilins (tiamulin fumarate).

[0121] The results are shown in Table 9. Strain 19-4 is sensitive to all of the above 13 antibiotics, indicating that 19-4 has broad antibiotic sensitivity.

[0122] Table 9 Results of drug sensitivity test for Strain 19-4

[0123]

[0124]

[0125] Note: The values are presented as mean ± standard deviation.

[0126] Note: An inhibition zone diameter > 2.0 cm indicates extremely sensitive, 1.5 - 2.0 cm indicates highly sensitive, 1.0 - 1.4 cm indicates moderately sensitive, < 1.0 cm indicates low sensitivity, and 0 indicates insensitive.

[0127] (5) Determination of the ability of Lactobacillus plantarum 19-4 to inhibit common pathogenic bacteria

[0128] The antibacterial activity of the screened strain was detected by the Oxford cup method. The concentrations of Escherichia coli, Staphylococcus epidermidis, methicillin-resistant Staphylococcus epidermidis, Salmonella enteritidis, and Salmonella typhimurium were adjusted to 1×10 8 CFU / mL. Using the dilution coating plate method, 50 μL of the pathogenic bacteria solution was evenly coated on the LB solid plate, and then a sterile Oxford cup was gently placed on the culture medium. 200 μL of the Lactobacillus plantarum 19-4 bacterial solution at 1×10 9 CFU / mL was added to the Oxford cup, and it was incubated at 37 °C for 12 h. The diameter of the inhibition zone was measured to analyze the antibacterial ability.

[0129] The results are as Figure 5 shown in Table 10. Strain 19-4 has good inhibitory effects on the common pathogenic bacteria tested, among which the inhibitory effect on methicillin-resistant Staphylococcus epidermidis is the best.

[0130] Table 10 Inhibition zone diameter (cm) after 12 h

[0131]

[0132] Note: The values are presented as mean ± standard deviation.

[0133] Example 4: Comparison of the inhibitory effects of Lactobacillus plantarum from different sources on methicillin-resistant Staphylococcus epidermidis

[0134] The antibacterial ability of different Lactobacillus plantarum strains against methicillin-resistant Staphylococcus epidermidis was detected by the Oxford cup method. The concentration of methicillin-resistant Staphylococcus epidermidis was adjusted to 1×10 8CFU / mL. Using the dilution plating method, 50 μL of the pathogenic bacterial solution was evenly spread on an LB solid plate, and then a sterile Oxford cup was gently placed on the medium. 200 μL of the supernatant of 19-4 and the supernatants of the other 4 Lactobacillus plantarum strains were added to the Oxford cups respectively, and incubated at 37 °C for 12 h. The diameter of the inhibition zone was measured to analyze the antibacterial ability.

[0135] The results are as Figure 6 shown in Table 11. Lactobacillus plantarum strains other than strain 19-4 had no obvious inhibitory effect on methicillin-resistant Staphylococcus epidermidis.

[0136] Table 11 Diameter of the inhibition zone at 12 h (cm)

[0137] Strain Drug-resistant Staphylococcus epidermidis 19-4 2.3±1.08 L.p / antarum-1 0.8±1.32 L.p / antarum-2 0.7±1.28 L.p / antarum-3 0.6±0.41 L.p / antarum-4 0.7±0.31

[0138] Note: The values are presented as mean ± standard deviation.

[0139] Example 5: Inhibition of biofilm formation of methicillin-resistant Staphylococcus epidermidis by Lactobacillus plantarum (1) Inhibition of biofilm formation of methicillin-resistant Staphylococcus epidermidis by Lactobacillus plantarum 19-4

[0140] A biofilm refers to a multicellular complex composed of microbial cells and the polymers secreted by them, which is formed by microorganisms adhering to a solid surface during growth. In most infectious diseases, pathogenic microorganisms exist mainly in the form of biofilms. Staphylococcus epidermidis is extremely prone to forming biofilms. The formation of biofilms enhances the resistance of pathogenic microorganisms to adverse environments, host immunity, and antibacterial drugs, and is the main cause of chronic long-term infections and repeated infections. Therefore, it is speculated that Lactobacillus plantarum can inhibit the growth of methicillin-resistant Staphylococcus epidermidis by inhibiting biofilm formation.

[0141] In a 96-well polystyrene microplate, 100 μL of LB culture medium was added to each well in the control group, and 100 μL of the supernatant of Lactobacillus plantarum 19-4 was added to each well in the experimental group. 10 μL of the overnight cultured methicillin-resistant Staphylococcus epidermidis bacterial solution was inoculated into each well, and incubated statically at 37 °C for 36 h. The culture medium was aspirated out, 200 μL of sterile PBS buffer was added to each well and washed 3 times, then 100 μL of methanol was added to fix for 15 min, and then the methanol in the culture wells was aspirated out and air-dried naturally. Subsequently, 100 μL of 1% crystal violet solution was added to each well, stained at room temperature for 5 min, the excess dye was rinsed off with running water, the microplate was inverted on filter paper to remove the residual water, and dried in an oven at 37 °C or air-dried at room temperature. After complete drying, 100 μL of 33% glacial acetic acid solution was added to each well, and incubated in a 37 °C incubator for 30 min to dissolve the crystal violet. Finally, the OD value of the solution in the culture wells was measured with a microplate reader at 590 nm.

[0142] The results are as Figure 7 shown in Figure 8As shown, 19-4 has a significant inhibitory effect on the biofilm formation of drug-resistant Staphylococcus epidermidis.

[0143] Example 6: Evaluation of the effect of feeding the probiotic preparation of the present invention to DSS-induced mice

[0144] A DSS colitis model was constructed using C57BL / 6 mice, and Lactobacillus plantarum 19-4 bacterial suspension was given by gavage intervention (100 μL / mouse by gavage, with a bacterial amount of about 1×10 9 CFU).

[0145] Experimental design: Experimental mice at 8 weeks of age were acclimated for 1 week in an SPF environment at 25°C with a 12 h light / dark cycle, and were fed with ordinary rodent feed and sterilized water. They were randomly divided into 4 groups (n = 6), namely the control group (CON group), the model group (DSS group), and the solid probiotic preparation and liquid probiotic preparation intervention groups (groups I and II). From day -21 to day 0, groups I and II were respectively gavaged with 1×10 10 CFU / day of 19-4; mice in the DSS group were gavaged with an equal volume of PBS suspension every day. From day 0 to day 7, the DSS group, groups I and II drank 2.5% (w / v) DSS. At the same time, groups I and II were respectively gavaged with 1×10 9 CFU / day of 19-4; mice in the DSS group were gavaged with an equal volume of PBS suspension every day. The body weight, fecal traits, and occult blood status of the mice were recorded daily, and the disease activity index (DAI) was calculated according to the scoring criteria shown in Table 11 and the formula. After the experiment, the mice were sacrificed by cervical dislocation, the colon was isolated, the colon phenotype was observed and the length was measured, photographed and recorded, and the distal colon tissue was fixed with 4% paraformaldehyde for H&E staining. The pathological scoring criteria are shown in Table 12.

[0146] Table 12 DAI scoring criteria

[0147] Score Weight loss (%) Fecal characteristics Occult blood condition 0 0 Normal No fecal occult blood 1 1-5 Soft but still formed / 2 6-10 Loose stool Positive fecal occult blood 3 11-15 Diarrhea / 4 >15 Watery stool Visible rectal bleeding

[0148] Note: / indicates no such item for scoring. DAI = body weight loss score + fecal trait score + occult blood status score.

[0149] Table 13 Pathological scoring criteria

[0150]

[0151] The results are as Figure 9 、 Figure 10 、 Figure 11 、 Figure 12 shown, strain 19-4 has no obvious toxic and side effects on experimental animals and can effectively relieve the symptoms of murine colitis (UC). Figure 9It was shown that no death occurred in mice after intragastric administration of the bacterial suspension of strain 19-4 for 21 days (-21 to -1 day). The average body weight of the mice was relatively stable as determined by daily weighing, and their activity and mental state were good. There was no difference in body weight change between the intervention group and the control group. Compared with the CON group, different degrees of weight loss occurred in the DSS group and groups I and II after DSS intervention (i.e., 0 to 7 days). The body weight of the mice in the DSS group began to decrease significantly on the 5th day, and this phenomenon persisted until the end of the experiment. However, strain 19-4 could slow down the weight loss of the mice, and the weight loss of the mice began to ease compared with the DSS group from the 5th day. Compared with the CON group, the DAI score of the mice in the DSS group increased significantly from the 5th day (P < 0.05), and this phenomenon persisted until the end of the experiment. However, strain 19-4 could reduce the DAI score of the mice, and there was no significant difference compared with the control group, and this phenomenon persisted until the end of the experiment.

[0152] In addition, Figure 11 It was shown that the colon length of the DSS group was significantly shorter than that of the CON group (P < 0.01). At the same time, the colon of the mice in the CON group had good elasticity, and the feces in the intestine were granular. The colon of the mice in the DSS group had poor elasticity, there was no feces or bloody stools in the intestine, and obvious edema was observed. There was no significant difference in the colon length of the 19-4 group compared with the CON group, and the elasticity of the colon of the mice in the 19-4 group was significantly restored compared with the DSS group. Granular feces were visible in the intestine, and there was no obvious edema and bloody stools. The results of histopathology Figure 12 It was shown that compared with the CON group, the pathological scores of the 19-4 group (P < 0.05) and the DSS group (P < 0.0001) were significantly increased, but the pathological score of the 19-4 group was significantly alleviated. Among them, the colon tissue structure of the mice in the CON group was intact, and no obvious inflammatory changes were observed. Severe pathological damage was observed in the colon tissue of the mice in the DSS group, with diffuse mucosal ulcers, and the mucosal epithelium and crypt structure disappeared. Mild pathological damage was observed in the colon tissue of the mice in the 19-4 group, with focal mucosal necrosis, milder inflammatory reaction, and a small amount of lymphocyte infiltration.

[0153] Detection of antioxidant indexes in serum and colon tissue: 1 mg of the colon was cut and ground, centrifuged at 3000 rpm for 20 min, and the supernatant and serum were taken together to detect the activities of antioxidant enzymes: SOD (superoxide dismutase), CAT (catalase), GSH-Px (glutathione peroxidase). At the same time, the level of lipid peroxidation product malondialdehyde (MDA) was detected to indirectly judge the severity of cell attack by free radicals. As Figure 13 shown, compared with the CON group, feeding the probiotic preparation restored the activities of antioxidant enzymes in the serum and colon of the mice to normal levels, and at the same time alleviated the significant increase in the level of MDA caused by DSS, indicating that feeding 19-4 could significantly improve the antioxidant activity of the mice.

[0154] The contents of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6) and anti-inflammatory factor (IL-10) were detected in the supernatant of ground colon tissues of mice in the antioxidant experiment of colon tissues. Results Figure 10 As shown, compared with the DSS group, feeding 19-4 restored the release of pro-inflammatory cytokines and anti-inflammatory cytokines in the colon of mice to normal levels, indicating that 19-4 can relieve the inflammatory response in the colon of mice.

[0155] Example 7: Treatment of canine enteritis (IBD) with Lactobacillus plantarum 19-4

[0156] Five diseased dogs diagnosed with chronic canine enteritis (IBD) in clinical diagnosis and treatment were collected. The main symptoms were diarrhea (yellow loose stools), sudden weight loss. Laboratory diagnosis showed no parasite infection, relatively high proportions of white blood cells and neutrophils, and insufficient pancreatic enzyme secretion. Antibiotics, digestive system special drugs (V-Power), and pet Yi Baol for dogs were used for treatment, and the diarrhea symptoms improved to some extent. However, once the antibiotics were stopped, the diarrhea symptoms reappeared. The antibiotics (and / or hormonal drugs) were repeatedly treated twice, and the diarrhea symptoms still occurred after drug withdrawal. The weight of the pet continued to decline during the treatment period. After obtaining the consent of the pet owner, a probiotic agent of Lactobacillus plantarum 19-4 independently developed in the laboratory was used for treatment, once a day, a total of 1×10 9 CFU. After four weeks of feeding, according to the feedback of the pet owner, the diarrhea symptoms of the pet improved. After six weeks of feeding, the pet had no diarrhea symptoms, the fecal form was normal, and the weight increased by 1 kg compared with that before diagnosis.

[0157] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A strain of Lactobacillus plantarum, characterized in that: The Lactobacillus plantarum is Lactobacillus plantarum 19-4, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on June 24, 2024, with a deposit number of GDMCC No: 64788.

2. Use of Lactobacillus plantarum according to claim 1 in preparing a functional preparation for treating inflammatory bowel disease.

3. The use of Lactobacillus plantarum according to claim 1 in preparing a preparation having an antibacterial function, characterized in that: The plant lactobacillus can inhibit Escherichia coli, Staphylococcus epidermidis, methicillin-resistant Staphylococcus epidermidis, Salmonella enteritidis and Salmonella typhimurium.

Citation Information

Patent Citations

  • Use of ldh gene-containing lactobacillus plantarum in preparing product for relieving enteritis

    WO2024056027A1

  • KR20230153911A

Cited By

  • Lactobacillus plantarum ZFML004 with bacteriostatic activity and intestinal micro-ecological regulation function and application of lactobacillus plantarum ZFML004

    CN120796153A

  • Lactobacillus plantarum zFML004 with antibacterial activity and intestinal microecological regulation function and application thereof

    CN120796153B