Application of stachyose in the preparation of drugs for preventing and alleviating myocardial ischemia-reperfusion injury

Abstract

The present invention provides an application of stachyose in the preparation of a drug for preventing and controlling myocardial ischemia-reperfusion injury, belonging to the field of biomedical technology. The effects of stachyose on cardiac function and cell death pathways were evaluated using in vivo and in vitro MIRI models. The results showed that stachyose can significantly improve the cardiac function of MIRI mice and reduce the infarct area; in terms of mechanism, stachyose regulates the ferroptosis pathway of cardiomyocytes by upregulating the expression of glutathione peroxidase 4 and reducing the levels of lipid peroxides and iron ions. In addition, stachyose inhibits the pyroptosis pathway of macrophages by downregulating the expression of NLRP3, GSMD‑N and cleaved‑caspase‑1, resulting in reduced levels of proinflammatory cytokines interleukin IL‑1β and IL‑18; stachyose has a protective effect on MIRI, can simultaneously target and inhibit ferroptosis and pyroptosis pathways, and has the potential to become a new therapeutic agent for the treatment of MIRI.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and particularly relates to application of stachyose in preparing medicines for preventing and alleviating myocardial ischemia-reperfusion injury. Background Art

[0002] Myocardial infarction (MI) is the result of myocardial ischemic necrosis due to interruption of blood flow or mismatch between myocardial oxygen supply and demand. Patients with MI often have a range of risk factors, including atherosclerosis, smoking, obesity, and inflammation. Interventional coronary reperfusion strategies are increasingly used to treat myocardial infarction. Although this treatment can alleviate the injury to some extent, reperfusion itself damages myocardial cells. Myocardial ischemia-reperfusion injury (MIRI) occurs when myocardial cells are damaged after blood supply is restored after coronary artery occlusion. The underlying mechanisms of MIRI are complex and involve calcium overload, reactive oxygen species (ROS) production, mitochondrial dysfunction, inflammatory responses, and impaired gut microbiota. These mechanisms have promoted the exploration of antioxidant and inflammation-modulating therapies, as well as the development of cardioprotective factors and stem cell therapies. However, the effectiveness of current drugs to treat MIRI is limited by several limitations, including poor biodistribution, rapid elimination, poor degradation / biotransformation, short half-life, and insufficient target specificity.

[0003] Traditional Chinese medicine offers various therapeutic strategies for the treatment and prevention of MIRI, often using herbal formulas with cardioprotective properties, such as Danshen, Ginseng, and Astragalus. Stachyose, a natural water-soluble oligosaccharide found in various herbal plants, has received increasing attention for its therapeutic potential. As a natural prebiotic substance, stachyose is easily absorbed by the human intestine, where it modulates the gut microbiota, improves intestinal inflammation, and alleviates oxidative stress. In addition, stachyose has anti-diabetic properties and can reduce the risk of atherosclerosis. Despite the well-established benefits of stachyose in various physiological processes, such as inflammation and metabolic regulation, the relationship between stachyose and post-MI effects remains unexplored. Therefore, this study aimed to investigate whether stachyose could attenuate myocardial ischemia-reperfusion injury by regulating ferroptosis and macrophage pyroptosis.

[0004] Ferroptosis is an independent mode of cell death characterized by iron-dependent cell death involving lipid peroxidation and oxidative stress. During MIRI, excessive ROS production leads to abnormal iron metabolism in cardiomyocytes, triggering lipid peroxidation and promoting ferroptosis. Ferroptosis can induce a significant inflammatory response and plays a crucial role in the pathology of MIRI, and inhibition of ferroptosis is considered a potential strategy for the treatment of MIRI. Pyroptosis is a form of programmed cell death that differs from another form of programmed cell death, apoptosis, because it involves cell swelling and rupture, releasing cellular contents into the extracellular space and triggering an immune response. Pyroptosis is mediated by a group of proteins called inflammasomes, which are multiprotein complexes that activate inflammatory responses in cells. In the context of MIRI, pyroptosis plays an important role in exacerbating tissue damage. Pyroptosis is activated during reperfusion, particularly in cardiomyocytes that are stressed during ischemia. The release of proinflammatory cytokines and damage-associated molecular patterns (DAMPs) from pyroptotic cells amplifies the inflammatory response, leading to cardiac injury and dysfunction. Understanding the mechanisms of ferroptosis and pyroptosis in MIRI may lead to the development of new therapeutic strategies to mitigate cardiac damage associated with ischemic events.

[0005] MIRI is a complex pathological process that results in the restoration of blood flow to the ischemic myocardium, leading to a series of deleterious effects including oxidative stress and inflammation. Stachyose, an oligosaccharide naturally present in traditional Chinese medicine, has been suggested to have therapeutic effects on various pathological conditions. However, its effect on MIRI and its underlying mechanisms have not been fully elucidated. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides an application of stachyose in the preparation of a myocardial ischemia-reperfusion injury drug. Stachyose significantly improves the cardiac function of MIRI mice and reduces the infarct area. Mechanistically, stachyose regulates the ferroptosis pathway of cardiomyocytes by upregulating the expression of glutathione peroxidase 4 (GPX4) and reducing the levels of lipid peroxidation and iron. In addition, stachyose inhibits the pyroptosis pathway in macrophages by downregulating the expression of NLRP3, GasderminD-N terminus (GSMD-N) and cleaved-caspase-1, resulting in a decrease in the levels of proinflammatory cytokines IL-1β and IL-18.

[0007] To achieve the above objectives, this scheme first provides an application of stachyose in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury.

[0008] Preferably, stachyose is used in the preparation of a drug for preventing and alleviating myocardial tissue damage caused by myocardial ischemia-reperfusion.

[0009] Preferably, the invention comprises the use of stachyose in the preparation of a drug for preventing and alleviating ferroptosis caused by myocardial ischemia-reperfusion.

[0010] Preferably, the invention comprises the use of stachyose in the preparation of a drug for preventing and alleviating cell pyroptosis caused by myocardial ischemia-reperfusion.

[0011] Preferably, the invention comprises the use of stachyose in the preparation of a medicine for preventing and alleviating inflammatory response caused by myocardial ischemia-reperfusion.

[0012] Preferably, the invention comprises the use of stachyose in the preparation of a medicament for preventing and alleviating oxidative stress caused by myocardial ischemia-reperfusion.

[0013] Preferably, the drug is any pharmaceutically approved preparation.

[0014] Preferably, the preparation is in the form of oral liquid, tablet, capsule or granule.

[0015] Preferably, the effective dose of stachyose is 1-5 g / kg / d.

[0016] The mechanism of the drug prepared by stachyose in this scheme for treating myocardial ischemia-reperfusion injury is as follows:

[0017] Stachyose can significantly improve the cardiac function of MIRI mice and reduce the infarct size. Figure 1 As shown, stachyose alleviated myocardial injury by targeting and inhibiting ferroptosis in cardiomyocytes and pyroptosis in macrophages. Stachyose regulated the ferroptosis pathway in cardiomyocytes by upregulating the expression of glutathione peroxidase 4 (GPX4) and reducing the levels of lipid peroxidation and iron ions. In addition, stachyose inhibited the pyroptosis pathway in macrophages by downregulating the expression of NLRP3, GSMD-N and cleaved-caspase-1, leading to a decrease in the levels of proinflammatory cytokines IL-1β and IL-18.

[0018] Stachyose inhibits Fe 2+ Induced lipid peroxidation accumulation in cardiomyocytes, while stachyose alleviated mitochondrial damage. In addition, stachyose was able to reduce the production of MDA in damaged cardiomyocytes and enhance the synthesis of GSH. Stachyose significantly increased the decreased GPX4 protein expression caused by MIRI and H / R in vitro and in vivo. The direct binding of stachyose to GPX4 further confirmed their interaction. In addition, stachyose upregulated the mRNA levels of ferroptosis-related genes GCLM and GPX4, while reducing the levels of PTSG2 and KRAS. Stachyose alleviated myocardial damage in MI mice by inhibiting ferroptosis.

[0019] The level of cell apoptosis was significantly reduced after stachyose treatment. In addition, stachyose could also reduce the levels of IL-1β and IL-18. Similarly, stachyose could reduce the protein expression levels of NLRP3, GSDMD-N and caspase-1 in the heart tissue of MIRI mice, while reducing the mRNA levels of NLRP3 and GSDMD. The direct binding of stachyose to NLRP3 may help inhibit NLRP3-mediated cell pyroptosis.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) This study demonstrated that stachyose has a protective effect against MIRI by inhibiting ferroptosis and pyroptosis pathways, which will help develop new treatment strategies for MIRI and provide a basis for the development and application of stachyose in clinical drug therapy.

[0022] (2) This study demonstrated that stachyose has a protective effect against MIRI by targeting ferroptosis and death pathways, and has the potential to become a new therapeutic drug for the treatment of MIRI.

[0023] (3) After stachyose intervention in the MIRI mouse model, the cardiac structure and function were significantly improved, further emphasizing the therapeutic potential of stachyose for MIRI. Treatment with stachyose can significantly reduce the area of ​​myocardial infarction and significantly enhance cardiac function.

[0024] (4) Stachyose can inhibit Fe 2+ Induced lipid peroxidation accumulation in cardiomyocytes. At the same time, stachyose can alleviate mitochondrial damage. In addition, stachyose can reduce the production of MDA in damaged cardiomyocytes and enhance the synthesis of GSH. Stachyose can significantly improve the decreased expression of GPX4 protein caused by MIRI and H / R in vivo and in vitro.

[0025] (5) Stachyose upregulated the mRNA levels of ferroptosis-related genes GCLM and GPX4, while decreasing the levels of PTSG2 and KRAS.

[0026] (6) Stachyose can also reduce the levels of IL-1β and IL-18. Similarly, stachyose can reduce the protein expression levels of NLRP3, GSDMD-N, and caspase-1 in the heart tissue of MIRI mice, and reduce the mRNA levels of NLRP3 and GSDMD. Therefore, in the case of MIRI, the blocking of pyroptosis by stachyose contributes to cardioprotection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 This is the mechanism diagram of this scheme;

[0029] Figure 2 In Experimental Example 2, stachyose alleviates myocardial tissue damage in mice with myocardial ischemia-reperfusion (IR). A is a representative heart section stained with 2,3,5-triphenyltetrazolium chloride (TTC), B is the statistical infarct area, CE is the ELISA analysis of serum CK-MB, LDH, and cTnl, F is a representative image of heart section HE staining, G is a representative image of heart section PI staining, H is a representative image of heart section DHE staining, I is a representative image of mouse echocardiography, J is the percentage of PI-positive cell nuclei, K is the relative change of DHE fluorescence intensity, LM is the determination of left ventricular ejection fraction (EF) and left ventricular short axis shortening (FS), NP is the relative mRNA level of mouse atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and β-myosin heavy chain (β-MHC), and scale bar = 50 μm;

[0030] Figure 3 Figure 2 shows that stachyose alleviates MIRI by inhibiting ferroptosis. AB are the molecular docking results of stachyose and GPX4. C is a representative JC-1 stained heart section. D is a representative FerroOrange stained heart section. E is a representative Liperfluo stained heart section. F is the relative Fe 2+ Content statistics, G is the statistical result of Liperfluo fluorescence intensity, H is the relative level of malondialdehyde (MDA) in heart tissue, I is the relative level of glutathione (GSH) in heart tissue, JK is the relative expression of GPX4 protein calculated by Western blot, LO is the relative mRNA level of mouse GPX4, GCLM, PTGS2 and KRAS, scale bar = 100 μm;

[0031] Figure 4The effect of stachyose on ferroptosis of H9c2 cells in Experimental Example 2, A is a representative H9c2 cell stained with JC-1 (scale = 100 μm), B is a representative image of MitoSOX stained H9c2 cells (scale = 100 μm), C is a representative image of H9c2 cells stained with FerroOrange (scale = 100 μm), D is a representative image of H9c2 cells stained with Liperfluo (scale = 50 μm), E is the relative Fe 2+ Content statistics, F is the correlation statistics of Liperfluo in H9c2 cells, G is the relative level of MDA in H9c2 cells, H is the relative level of GSH in H9c2 cells, IJ is the relative expression of GPX4 protein observed and calculated by Western blot method, KN is the relative mRNA levels of GPX4, GCLM, PTGS2 and KRAS in cells;

[0032] Figure 5 In Experimental Example 2, Erastin prevented the inhibitory effect of stachyose on ferroptosis. A is a representative H9c2 cell stained with JC-1 (scale bar = 100 μm), B is a representative image of H9c2 cells stained with mitoSOX (scale bar = 100 μm), C is a representative image of H9c2 cells stained with FerroOrange fluorescent dye (scale bar = 100 μm), D is a representative image of H9c2 cells stained with Liperfluo (scale bar = 50 μm), and E is the relative Fe 2+ Content statistics, F is the correlation statistics of Liperfluo in H9c2 cells, G is the relative level of MDA in H9c2 cells, H is the relative level of GSH in H9c2 cells, IJ is the relative expression of GPX4 protein observed and calculated by Western blot method, KN is the relative mRNA levels of GPX4, GCLM, PTGS2 and KRAS in cells;

[0033] Figure 6 In Experimental Example 2, stachyose inhibited pyroptosis of macrophages in MIRI mice. AB is the molecular docking result of stachyose and NLRP3. C is a representative electron microscopy image of cardiac mitochondria (scale bar = 1 μm). DG is the observation and calculation of the relative protein expression of GSDMD-N, NLRP3 and cleaved-caspase-1 in mice by Western blot analysis. HI is the relative mRNA level of GSDMD and NLRP3. JK is the expression of IL-1β and IL-18 in serum analyzed by ELISA.

[0034] Figure 7The inhibitory effect of stachyose on pyroptosis of RAW264.7 cells in Experimental Example 2, A is a representative image of PI-stained RAW264.7 cells (scale = 50 μm), B is the percentage of PI-positive cell nuclei, CD is the ELISA analysis of IL-1β and IL-18 expression in the supernatant of RAW264.7 cells, EH is the observation and calculation of the relative protein expression of NLRP3, GSDMD-N and cleaved capase-1 in RAW264.7 cells by Western blot method;

[0035] Figure 8 In Experimental Example 2, Polyphyllin VI prevented the inhibitory effect of stachyose on pyroptosis. A is a representative image of RAW264.7 cells stained with PI (scale = 50 μm), B is the percentage of PI-positive cell nuclei, CD is the ELISA analysis of the expression of IL-1β and IL-18 in the supernatant of RAW264.7 cells, and EH is the Western blot method to observe and calculate the relative expression levels of NLRP3, GSDMD-N and cleaved-capase-1 proteins in RAW264.7 cells. DETAILED DESCRIPTION

[0036] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0037] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0038] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0039] Experimental Example 1

[0040] Establishment of MIRI model mice and drug administration

[0041] Male C57BL / 6J mice, 6 weeks old, were purchased from Sibeifu Biotechnology Co., Ltd. (Nanjing, China). The mice were placed in a humidity- and temperature-controlled environment and provided with standard food and clean water for free in a 12-h light-dark cycle. After one week of acclimation, we evaluated the effect of stachyose on the MIRI mouse model. Metoprolol (250 mg / kg / day) or stachyose (1 or 5 g / kg / day) was gavaged for 3 consecutive days before sham or MIRI surgery. Metoprolol is an effective drug for alleviating MIRI and was selected as a positive control. All mice were raised at Jiangnan University.

[0042] All animal experiments in this study were approved by Jiangnan University. The MIRI model was established under clean and standardized conditions. Anesthesia was induced with 2% isoflurane (1.0 L / min flow rate). The mice were placed on a thermostatically controlled operating table and connected to a small animal ventilator. After adequate anesthesia, the left chest hair was trimmed and a thoracotomy was performed to expose the heart. The left coronary artery and its branches were ligated with 6.0 non-absorbable sutures. After the blood vessels were ligated, the chest cavity was emptied and the incision was sutured with 5.0 lines. After ligation for 30 minutes, the sutures were loosened and the mice were reperfused for 24 hours.

[0043] Experimental Example 2

[0044] To investigate the therapeutic effect of stachyose on MIRI

[0045] Echocardiography: Echocardiography was performed using a Vevo 3100LT echocardiography system (FUJIFILM, Canada). After a 24-hour reperfusion period, mice were anesthetized with 1.5% isoflurane and placed on a heated imaging platform to maintain a body temperature of 37 ± 0.5 °C. Rectal temperature, respiratory rate, and limb lead electrocardiograms were continuously monitored throughout the imaging process. Parasternal short-axis (PSAX) views and parasternal long-axis (PLAX) views were recorded in both B and M modes at the level of the papillary muscles. End-systole was defined as the maximum ventricular systolic diameter before aortic closure, and end-diastole was defined as the maximum left ventricular internal diameter before aortic closure. Key parameters, including left ventricular ejection fraction (LVEF), left ventricular fractional shortening (FS), cardiac output (CO), left ventricular volume, systolic diameter, and diastole, were measured on two anatomical views (PLAX and PSAX) using VevoLab software (Fujifilm VisualSonics). The arithmetic mean of each echocardiographic parameter was calculated for analysis.

[0046] TTC staining: After the completion of echocardiography, the mouse was euthanized by cervical dislocation, the chest skin and ribs were cut open, and the apex of the heart was rinsed with saline. The heart was then removed and frozen at -20°C for 20 minutes. After the heart was completely frozen, it was dissected using surgical tools. 37°C, 2,3,5-triphenyltetrazolium chloride (TTC dye) was soaked for 30 minutes. The necrotic area appeared white and the viable myocardium appeared red. After incubation in 4% paraformaldehyde for 24 hours, the heart was photographed against a white background.

[0047] Transmission electron microscopy: Extract about 1 mm 3 Myocardial tissue was immediately immersed in electron microscopy fixative (Servicebio, Wuhan, China) precooled to 4°C. After incubation in a dark room at room temperature for 2 hours, the samples were stored at 4°C. They were then washed three times with PBS, fixed with 1% osmium tetroxide (O2O4) at room temperature for 20 minutes, and then washed with PBS three times for 15 minutes. Subsequently, the samples were dehydrated, embedded, and sliced ​​into ultrathin sections of 60-80 nm. These sections were stained with 2% saturated aqueous uranyl acetate and lead citrate for 15 minutes. After drying, the samples were evaluated using a Hitachi HT7800 transmission electron microscope.

[0048] Histological analysis and staining: Myocardial tissue was obtained for hematoxylin and eosin (HE) staining. The heart tissue was fixed, embedded, and sliced ​​into 5 μm sections. These sections were mounted on glass slides, dewaxed, and stained with HE. The stained sections were analyzed using an optical microscope (Zeiss, Germany).

[0049] Real-time fluorescence quantitative PCR (RT-PCR): RNA was extracted using the Freezon Reagent kit (Vazyme, Nanjing, China), and the integrity and concentration of RNA were assessed using a NanoDrop spectrophotometer. Equal amounts of RNA (1 μg) were reverse transcribed using 1st Strand cDNA Synthesis SuperMix (yeasen Biotechnology, Shanghai, China). Real-time quantitative PCR was performed using SYBR Green PCR Master Mix (yeasen Biotechnology, Shanghai, China) on an Applied Biosystems QuantStudio3 (ThermoFisher, USA). -ΔΔCt The relative gene expression levels were analyzed by the method, where Ct represents the cycle threshold number normalized to β-actin. The primers are shown in Tables 1 and 2 below:

[0050] Table 1 H9c2 cell primer sequences

[0051] Gene Forwardprimer(5′->3′) Reverse primer (5′->3′) β-actin TGTCACCAACTGGGACGATA GGGGTGTTGAAGGTCTCAAA GPX4 ATTCCCGAGCCTTTCAACCC TATCGGGCATGCAGATCGAC GCLM GAAAAAGTGTCCGTCCACGC ATCAGGGCTGATTTGGGAGC PTGS2 AGTCCCTGAGCATCTACGGT CTCCACCAAAAGTGCTTGGC KRAS GGCAAGAGTGCCTTGACGATA AACCCAGGGAATACTGGCAC

[0052] Table 2. Mouse primer sequences

[0053] Gene Forwardprimer(5′->3′) Reverse primer (5′->3′) β-actin ACCGCTCGTTGCCAATAGTGATG ACCGCTCGTTGCCAATAGTGATG GPX4 CGCCAAAGTCCTAGGAAACG TATCGGGCATGCAGATCGAC GCLM CTCGGGTGAGGTTTCTGCTT CCATCTTCAATCGGAGGCGA PTGS2 CTTCGGGAGCACAACAGAGT AAGTGGTAACCGCTCAGGTG KRAS ATCCTCACTCTCACAGAGTTTATTC TCAAGGCGCTCTTGCCTAC GSMD CCCAGAAGCCCCACTATACC TAAAGTCATGCCGCCTCTGG NLRP3 ATTACCCGCCCGAGAAAGG TCGCAGCAAAGATCCACACAG

[0054] Western blotting: Tissue and cell samples were lysed. Equal amounts of proteins were then separated by sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) electrophoresis and subsequently electrochemically transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were then blocked with 5% skim milk for 2 h at room temperature. The blotted proteins were incubated with the required primary antibody at 4°C overnight, then incubated with anti-rabbit antibodies at room temperature for 2 h, blots were developed using enhanced chemiluminescence imaging buffer, and the relative expression of the target proteins was analyzed using ImageJ software. Antibodies used were anti-β-actin antibody (BM3873, Boster), anti-GPX4 antibody (BM5231, Boster), anti-NLRP3 antibody (ab72608, Abcam), anti-cleaved-caspase-1 antibody (89332S, CellSignaling Technology), and anti-GSMD-N antibody (ab215203, Abcam).

[0055] Quantitative detection of malondialdehyde (MDA) and glutathione (GSH): The samples were diluted with physiological saline to prepare 10% animal tissue homogenate, and then centrifuged at 3000 r / min for 10 min. MDA and GSH detection kits (Nanjing Jiancheng Bioengineering Institute, China) were used, and the absorbance was recorded at 450 nm using a microplate reader.

[0056] Prodium iodide (PI) staining: The collected cells were stained with PI working solution (Solarbio) for 30 minutes and DAPI working solution (Solarbio) for 10 minutes to observe the cell nucleus. Red fluorescence was observed under a fluorescence microscope (Zeiss, Germany), and blue fluorescence was observed by DAPI staining.

[0057] ROS measurement: The generation of ROS in H9c2 cells or cardiac tissue was evaluated using DHE working solution (Beyotime) at 37°C for 30 min. The DHE fluorescence intensity was photographed and measured. In addition, the mitochondrial ROS of H9c2 cells was detected using MitoROS fluorescent probe (10 μM). Red fluorescence was observed using a fluorescence microscope (Zessis, Germany).

[0058] Enzyme-linked immunosorbent assay (ELISA): The levels of interleukin (IL)-1β and IL-18 were detected by ELISA kits from Elabscience according to the manufacturer's instructions. Serum creatine kinase-MB (CK-MB), lactate dehydrogenase (LDH), and cardiac troponin l (cTnl) were detected using commercial ELISA kits (BOSTER, Wuhan, China) according to the manufacturer's protocol.

[0059] Detection of Fe 2+ , lipid oxidation and mitochondrial membrane potential: ferrous ions (Fe 2+ ) probe, FerroOrange, was used to measure free Fe in cell and tissue samples 2+ Mitochondrial membrane potential was assessed using the JC-1 kit (Beyotime) and Liperfluo (Dojindo). Samples were examined under a fluorescence microscope (Zessis, Germany), and the fluorescence intensity is shown.

[0060] Molecular docking of stachyose with GPX4 and NLRP3: The structure of stachyose was obtained using the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov / ), and the 3D structures of GPX4 and NLRP3 were obtained from the Protein Data Bank (PDB) (http: / / www.rcsb.org / ) database. AutoDock (http: / / autodock.scripps.edu / ) was used to predict the interaction between NLRP3 and GPX4 and stachyose.

[0061] Data analysis: All experiments and analyses were performed at least three times, and quantitative data are presented as mean ± standard deviation (SD). Data analysis was performed using GraphPadPrism 8. Unpaired t-test and one-way ANOVA were used to assess differences between groups, followed by Dunnett's multiple comparison test. p values ​​< 0.05 were considered statistically significant.

[0062] (1) Stachyose reduces MIRI-related myocardial tissue damage

[0063] The results are as follows Figure 2 As shown in AB, treatment of MIRI mice with two different concentrations of stachyose (1 g / kg / d and 5 g / kg / d) reduced myocardial infarct size. Of note, although the lower dose of stachyose (1 g / kg / d) resulted in a reduction in infarct size, the therapeutic effect was less pronounced compared with the higher dose (5 g / kg / d) and metoprolol-treated groups.

[0064] MIRI mice had higher serum CK-MB, LDH, and cTnI levels, and these upregulations were attenuated after stachyose treatment ( Figure 2 CE). HE staining results showed that myocardial tissue was disordered and inflammatory cells infiltrated after myocardial ischemia-reperfusion, and it returned to a normal and orderly state after stachyose treatment ( Figure 2 F).

[0065] Quantification of apoptotic cells showed that cardiomyocyte apoptosis was significantly reduced after stachyose treatment ( Figure 2 G, J). In addition, DHE staining was used to evaluate the generation of ROS in cardiomyocytes, and stachyose treatment significantly reduced the generation of ROS in the model mice ( Figure 2 H, K). Cardiac function was assessed by echocardiography, and the results of left ventricular long-axis echocardiography are shown in the figure ( Figure 2 I).

[0066] The ejection fraction and left ventricular short axis shortening rate were calculated, showing that stachyose significantly improved the cardiac function of the model mice ( Figure 2 LM). We also evaluated the gene expression levels of ANP, BNP, and β-MHC, which are markers of myocardial injury. Stachyose treatment reduced the expression of these genes compared with the model group ( Figure 2 NP). Together, these findings support the potential of stachyose as a therapeutic agent to reduce myocardial infarction and improve cardiac function after MIRI.

[0067] (2) Stachyose alleviates MIRI by inhibiting ferroptosis

[0068] Glutathione peroxidase 4 (GPX4) plays a key role in the regulation of ferroptosis, a form of programmed cell death characterized by iron-dependent lipid peroxidation. Molecular docking results showed that stachyose can effectively bind to GPX4 with a binding energy of -6.5 kcal / mol ( Figure 3 AB). The disruption of mitochondrial membrane potential can lead to an increase in ROS and lipid peroxidation, resulting in cellular ferroptosis, while intervention with stachyose helps prevent oxidative damage and cellular ferroptosis. Mitochondrial membrane potential was measured by JC-1 staining. After stachyose intervention, the membrane potential of MIRI mice increased significantly ( Figure 3 C) Reduced GSH levels impair GPX4 activity, leading to increased susceptibility to ferroptosis. FerroOrange-stained heart sections showed that Fe 2+ The content decreased ( Figure 3 D, F). In addition, lipid peroxides measured by liperfluo staining in MIRI mice were reduced after stachyose treatment, indicating that stachyose has an inhibitory effect on ferroptosis ( Figure 3E, G). GPX4 is a key cellular antioxidant that can use glutathione (GSH) as a reducing agent to remove lipid peroxides in cells. GSH acts as a cofactor for GPX4, enabling it to exert its protective function in MIRI. The inhibitory effect of stachyose on ferroptosis was further supported by the reduction of MDA content and the increase of GSH-Px activity ( Figure 3 HI). Western blot analysis showed that GPX4 protein expression was upregulated under stachyose treatment ( Figure 3 JK). In addition, stachyose regulated the mRNA levels of ferroptosis-related genes, such as increased GPX4 and GCLM mRNA levels and decreased PTGS2 and KRAS mRNA levels ( Figure 3 LO).

[0069] (3) Effect of stachyose on ferroptosis of H9c2 cells

[0070] Rat cardiomyocyte cell line H9c2 cells were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai). H9c2 cells were stored in DMEM medium supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2.

[0071] The ferroptosis agonist -erastin was given 24 h before the addition of stachyose (Shanghai Yuanye Biotechnology Co., Ltd., China) for 24 h, and sugar-free and serum-free medium was used at 37 °C under 1% O2 hypoxia for 6 h. After 6 h, complete medium was supplemented at 37 °C and 5% CO2 for 2 h.

[0072] The protective effect of stachyose was further evaluated by treating H9c2 cells induced by hypoxia / reoxygenation (H / R) with different concentrations of stachyose (2, 5, and 10 mM).

[0073] JC-1 staining showed that stachyose could prevent the decrease in mitochondrial membrane potential induced by H / R, and more obvious effects were observed at 5mM and 10mM doses ( Figure 4 A).

[0074] MitoSOX staining showed that mitochondrial ROS production was high in H / R cells, and this phenomenon was significantly reversed under the intervention of stachyose ( Figure 4 B).

[0075] Ferro Orange and liperfluo staining confirmed that Fe2 + and lipid peroxide contents decreased ( Figure 4 CF).

[0076] Consistent with the results of animal experiments, the MDA content in cells cultured with stachyose decreased and the GSH-Px activity increased ( Figure 4 GH). After stachyose treatment, the protein expression of GPX4 in H9c2 cells injured by H / R was significantly restored ( Figure 4 IJ). Figure 4 As shown in KN, stachyose regulated the mRNA levels of ferroptosis-related genes such as GPX4, GCLM, PTGS2, and KRAS.

[0077] (4) Erastin prevents the inhibitory effect of stachyose on ferroptosis

[0078] To further determine whether the therapeutic effect of stachyose in the MIRI environment is related to the inhibition of ferroptosis, we constructed an H / R cell model in which stachyose and the ferroptosis agonist erastin acted together. JC-1 staining showed that erastin inhibited the protective effect of stachyose on mitochondrial membrane potential ( Figure 5 A).

[0079] Similarly, MitoSOX staining showed that erastin inhibited the reduction of mitochondrial superoxide production by stachyose ( Figure 5 B) FerroOrange and Liperfluo staining confirmed the effect of stachyose on Fe 2+ and lipid peroxide content, an effect that was reversed by erastin ( Figure 5 CF).

[0080] In addition, erastin significantly counteracted the effects of stachyose on MDA content and GSH-Px activity ( Figure 5 GH). The upregulation of GPX4 protein expression and the regulation of ferroptosis-related genes by stachyose were significantly inhibited by erastin ( Figure 5 IN).

[0081] (5) Stachyose inhibits pyroptosis in MIRI mice

[0082] The NLRP3 inflammasome plays a central role in detecting danger signals and initiating inflammatory responses. Upon activation, it promotes the cleavage of caspase-1, which in turn activates proinflammatory cytokines and induces pyroptosis through GSDMD cleavage. Molecular docking confirmed the binding of stachyose to NLRP3 ( Figure 6 AB).

[0083] Electron microscopy showed pyroptotic features in MIRI mice, such as mitochondrial atrophy, reduced cristae, and outer membrane rupture, as well as features of pyroptosis, including nuclear condensation and endoplasmic reticulum edema ( Figure 6 C).

[0084] To investigate whether stachyose mediates pyroptosis in MIRI mice, we assessed the protein expression of pyroptosis-related proteins GSDMD-N, NLRP3, and cleaved-caspase-1. Stachyose treatment reduced the protein levels of these markers ( Figure 6 DG).

[0085] In addition, stachyose significantly reduced the mRNA expression of GSDMD and NLRP3 in the heart tissue of MIRI mice ( Figure 6 HI). ELISA analysis of mouse serum showed that stachyose reduced the release of pyroptosis markers such as IL-1β and IL-18 ( Figure 6 JK).

[0086] (6) Inhibitory effect of stachyose on pyroptosis of RAW264.7 cells

[0087] The cells were treated with stachyose. PI staining showed that stachyose significantly reduced cell apoptosis ( Figure 7 AB). In addition, stachyose significantly reduced the release of IL-1β and IL-18 in the cell supernatant under H / R conditions ( Figure 7 CD). Western blot analysis showed that the expression levels of NLRP3, GSDMD-N and cleaved-caspase-1 proteins were significantly decreased after the RAW264.7 cells were treated with fruit sugar ( Figure 7 EH).

[0088] (7) Polyphyllin VI prevented the inhibitory effect of stachyose on pyroptosis

[0089] PI staining showed that the pyroptosis agonist Polyphyllin VI abolished the anti-apoptotic effect of stachyose ( Figure 8 AB). In addition, the presence of PolyphyllinVI prevented the effect of stachyose on the release of IL-1β and IL-18 ( Figure 8 CD). Western blot analysis showed that the expression levels of NLRP3, GSDMD-N, and cleaved-caspase-1 proteins were significantly decreased after stachyose treatment, while the supplementation of PolyphyllinVI could reverse this situation ( Figure 8 FH).

[0090] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. The application of stachyose as the only active ingredient in the preparation of drugs for preventing and alleviating myocardial ischemia-reperfusion injury.

2. The use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: The invention includes the application of stachyose in preparing medicine for preventing and alleviating the related myocardial tissue damage caused by myocardial ischemia-reperfusion.

3. The use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: Including stachyose prevents and alleviates myocardial ischemia-reperfusion injury by inhibiting ferroptosis.

4. The use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: Including stachyose prevents and alleviates myocardial ischemia-reperfusion injury by inhibiting cell pyroptosis.

5. The use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: Including stachyose prevents and alleviates myocardial ischemia-reperfusion injury by inhibiting inflammatory response.

6. Use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: Including stachyose prevents and alleviates myocardial ischemia-reperfusion injury by inhibiting oxidative stress.

7. Use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: The effective dosage of stachyose is 1-5 g / kg / d.

8. Use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 1, characterized in that: The drug is any pharmaceutically acceptable preparation.

9. Use of stachyose as the sole active ingredient in the preparation of a drug for preventing and alleviating myocardial ischemia-reperfusion injury according to claim 8, characterized in that: The preparation is in the form of oral liquid, tablet, capsule or granule.

Images