A histone deacetylase 6 inhibitor and its preparation and use in treating ischemic stroke

Abstract

The present invention belongs to the field of biomedicine technology, and discloses a novel histone deacetylase 6 inhibitor, a preparation method thereof, and an application in the prevention and / or treatment of ischemic stroke. The present invention is based on 4-isopropylbenzene-1,3-diol to design and synthesize a novel histone deacetylase 6 inhibitor, which can specifically dock with the active site of HDAC6, thereby improving the prognosis after ischemic stroke and exerting a new mechanism of neuroprotection. The histone deacetylase 6 inhibitor of the present invention has the activity of regulating and promoting polarization of anti-inflammatory microglia and exerting a neuroprotective effect, has an improving effect on early brain damage after ischemic stroke, and is a potential clinical application drug for the treatment of ischemic stroke. The present invention also provides the application of the above-mentioned histone deacetylase 6 inhibitor in the preparation of drugs for the prevention and / or treatment of ischemic stroke, preparation products for neuroinflammation, and preparation products for neuronal degeneration.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a novel histone deacetylase 6 inhibitor and a preparation method thereof and application thereof in preventing and / or treating ischemic stroke. Background Art

[0002] The main treatment strategy for ischemic stroke is reperfusion. However, reperfusion further induces neuroinflammation, and excessive inflammatory response can lead to further neuronal damage, resulting in secondary brain injury after ischemic stroke, leading to poor clinical prognosis. Studies have shown that the neuroinflammatory response induced by ischemic stroke in brain tissue is mainly regulated by microglia. Under pathological conditions, microglia play a vital role in maintaining brain hemostasis, mediating neuroinflammation or neuroprotection. During the progression of brain injury, branched microglia are activated and move to the damaged site and regulate immune responses. Microglia undergo phenotypic changes corresponding to the microenvironment within the brain parenchyma. Microglia can play a phagocytic role in clearing debris at the infarct site. At the same time, microglia can also aggravate the inflammatory response by secreting a variety of cytokines and promote the recruitment of peripheral immune cells to the site of injury. Therefore, microglia are the first line of defense against brain injury. In addition, previous studies have shown that microglia-mediated immune responses are regulated by multiple signaling pathways. Therefore, a better understanding of the polarization and regulation of microglia during ischemic stroke is necessary. However, there is still a lack of effective drug treatment strategies for early brain damage in ischemic stroke. Therefore, anti-inflammatory treatment may have potential utility.

[0003] Microglia are the main immune cells in the central nervous system and play a key role in regulating brain homeostasis. To achieve these different functions, microglia must undergo extensive morphological and functional reprogramming to meet the needs of the brain. Among them, selective activation of the microglial M2 phenotype can assist in tissue repair under various acute brain injury conditions, including ischemic stroke, traumatic brain injury, intracerebral hemorrhage, and subarachnoid hemorrhage. In addition, a large amount of evidence shows its important role in the early inflammatory response after ischemic stroke. It has also been reported that M2 microglia can promote neuronal survival and reduce brain damage. Therefore, the underlying mechanisms of the inflammatory response are crucial for designing new anti-inflammatory treatments for patients with ischemic stroke.

[0004] Epigenetic regulation and subsequent gene expression or silencing are strictly arranged. Among all epigenetic regulatory modes, acetylation as a reversible post-translational modification is the most critical one. Histone acetylases (HATs) and histone deacetylases (HDACs) are both epigenetic regulators responsible for chromatin compaction and subsequent gene regulation. As "erasing" enzymes in epigenetics, HDACs are responsible for removing acetyl groups from lysine residues in their substrates. Therefore, inhibition of HDACs leads to histone hyperacetylation, which in turn promotes gene transcription and ultimately produces a variety of biological behaviors. HDACs consist of 18 enzymes, which can be divided into four categories based on sequence similarity, cellular localization, expression pattern, and enzymatic mechanism, including class I (HDAC1, 2, 3, and 8), class II (IIa HDAC4, 5, 7, 9, and IIb HDAC6, 10), class III (SIRT1-7), and class IV (HDAC11). Since HDACs play a vital role in the progression of various diseases, the development of their inhibitors has attracted attention. Accumulating evidence suggests that pan- or isoform-specific HDAC inhibitors (HDACi) have beneficial effects on a variety of brain disorders.

[0005] HDAC6 is a unique member of class IIb HDACs with two catalytic domains and is mainly localized in the cytoplasm. HDAC6 is involved in a variety of cellular processes, such as cell motility, endocytosis, cell migration, and autophagy. Increasing evidence suggests that HDAC6 is a promising target for neuroprotection and regeneration in central nervous system (CNS) diseases. It has been reported that elevated expression of HDAC6 can be observed during cerebral ischemia, followed by disruption of microtubule transport and reduction of motor protein levels. This microtubule-based transport disorder will eventually lead to mitochondrial dysfunction and subsequent cell death. In addition, in a cerebral ischemia model, selective knockdown of HDAC6 has a neuroprotective effect on hypoxic and glucose-deprived cortical neurons and restores microglial homeostasis. Currently, various HDAC inhibitors have been shown to have immunosuppressive effects on microglia-mediated neuroinflammation and show significant benefits in different diseases, especially ischemic stroke. However, the neuroprotective mechanism of HDAC inhibitors and their potential functions in targeting microglia are still unclear. Summary of the invention

[0006] In order to overcome the above-mentioned shortcomings and deficiencies of the prior art, the primary purpose of the present invention is to provide a novel histone deacetylase 6 (HDAC6) inhibitor.

[0007] The histone deacetylase 6 inhibitor of the present invention has the activity of regulating and promoting polarization of anti-inflammatory microglia and exerting a neuroprotective effect, has an improving effect on early brain damage after ischemic stroke, and is a potential clinically applied drug for treating ischemic stroke.

[0008] Another object of the present invention is to provide a method for preparing the above-mentioned histone deacetylase 6 inhibitor.

[0009] The present invention designs and synthesizes a novel histone deacetylase 6 inhibitor based on 4-isopropylbenzene-1,3-diol, and endows it with stronger anti-inflammatory activity through the design of the molecular structure. Molecular modeling proves that the inhibitor of the present invention can efficiently and selectively dock with the active site of HDAC6, thereby exerting a new mechanism of neuroprotection in the treatment of ischemic stroke.

[0010] Another object of the present invention is to provide use of the above-mentioned histone deacetylase 6 inhibitor in preventing and / or treating ischemic stroke.

[0011] Another object of the present invention is to provide use of the above-mentioned histone deacetylase 6 inhibitor in the preparation of a drug for preventing and / or treating ischemic stroke.

[0012] The purpose of the present invention is achieved through the following solutions:

[0013] In a first aspect, a novel histone deacetylase 6 (HDAC6) inhibitor or a pharmaceutically acceptable salt thereof is provided, wherein the structural formula thereof is shown in Formula I:

[0014]

[0015] Wherein, R0 is selected from hydrogen, a halogen atom, a hydroxyl group, a substituted or unsubstituted C1-C20 straight or branched alkyl group, a substituted or unsubstituted C3-C20 cycloalkyl group, a C1-C20 haloalkyl group, a substituted or unsubstituted C1-C20 alkoxy group, a substituted or unsubstituted aryl group, a substituted or unsubstituted C2-C20 heterocyclic group or heterocyclic aromatic group containing one or more of N, O and S;

[0016] R1 and R2 can be one or more substituents on the benzene ring, independently selected from hydrogen, halogen atoms, hydroxyl, carboxyl, cyano, nitro, amino, mercapto, substituted or unsubstituted C1-C20 straight or branched alkyl, substituted or unsubstituted C3-C20 cycloalkyl, C1-C20 haloalkyl, substituted or unsubstituted C1-C20 alkoxy, substituted or unsubstituted C1-C20 N-alkyl substituted amino, substituted or unsubstituted C1-C20 N,N-dialkyl substituted amino, substituted or unsubstituted a substituted C1-C20 acyl group, a substituted or unsubstituted C1-C20 amide group, a substituted or unsubstituted C1-C20 ester group, a sulfonic acid group, a substituted or unsubstituted C1-C20 sulfonamide group, a substituted or unsubstituted C1-C20 aminosulfonyl group, a substituted or unsubstituted C1-C20 sulfonylamino group, a substituted or unsubstituted C1-C20 sulfonyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted C2-C20 heterocyclic group or heterocyclic aromatic group containing one or more of N, O and S.

[0017] Wherein, the above-mentioned substituents are independently selected from hydrogen, halogen, hydroxyl, cyano, nitro, amino, C1-C20 straight or branched alkyl, C3-C20 cycloalkyl, C1-C20 haloalkyl, C2-C20 ester, C2-C20 alkenyl, C2-C20 alkynyl, C1-C20 hydrocarbonoxy, C1-C20 hydrocarbonthio, aryl, C1-C20 N-hydrocarbon substituted amine, C1-C20 N,N-dihydrocarbon substituted amine, substituted or unsubstituted C2-C20 heterocyclic or heterocyclic aromatic groups containing one or more of N, O and S.

[0018] Furthermore, one or more hydrogen atoms in R0, R1, and R2 may be substituted by a halogen atom, an oxygen atom, a sulfur atom, a C1-C20 straight or branched alkyl group, a C3-C20 cycloalkyl group, a C1-C20 haloalkyl group, an alkenyl group, an alkynyl group, an aryl group, a hydroxyl group, an amino group, a carbonyl group, a carboxyl group, an ester group, a cyano group, a nitro group, a C1-C20 alkoxy group, or a C2-C20 heterocyclic group or heterocyclic aromatic group containing one or more of N, O and S.

[0019] Furthermore, the novel histone deacetylase 6 (HDAC6) inhibitor of the present invention or a pharmaceutically acceptable salt thereof has a structural formula as shown in Formula II:

[0020]

[0021] R1 and R2 can be one or more substituents on the benzene ring, independently selected from hydrogen, halogen atoms, hydroxyl, carboxyl, cyano, nitro, amino, mercapto, substituted or unsubstituted C1-C20 straight or branched alkyl, substituted or unsubstituted C3-C20 cycloalkyl, C1-C20 haloalkyl, substituted or unsubstituted C1-C20 alkoxy, substituted or unsubstituted C1-C20 N-alkyl substituted amino, substituted or unsubstituted C1-C20 N,N-dialkyl substituted amino, substituted or unsubstituted a substituted C1-C20 acyl group, a substituted or unsubstituted C1-C20 amide group, a substituted or unsubstituted C1-C20 ester group, a sulfonic acid group, a substituted or unsubstituted C1-C20 sulfonamide group, a substituted or unsubstituted C1-C20 aminosulfonyl group, a substituted or unsubstituted C1-C20 sulfonylamino group, a substituted or unsubstituted C1-C20 sulfonyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted C2-C20 heterocyclic group or heterocyclic aromatic group containing one or more of N, O and S.

[0022] Wherein, the above-mentioned substituents are independently selected from hydrogen, halogen, hydroxyl, cyano, nitro, amino, C1-C20 straight or branched alkyl, C3-C20 cycloalkyl, C1-C20 haloalkyl, C2-C20 ester, C2-C20 alkenyl, C2-C20 alkynyl, C1-C20 hydrocarbonoxy, C1-C20 hydrocarbonthio, aryl, C1-C20 N-hydrocarbon substituted amine, C1-C20 N,N-dihydrocarbon substituted amine, substituted or unsubstituted C2-C20 heterocyclic or heterocyclic aromatic groups containing one or more of N, O and S.

[0023] Furthermore, one or more hydrogen atoms in R1 and R2 may be substituted by a halogen atom, an oxygen atom, a sulfur atom, a C1-C20 straight or branched alkyl group, a C3-C20 cycloalkyl group, a C1-C20 haloalkyl group, an alkenyl group, an alkynyl group, an aryl group, a hydroxyl group, an amino group, a carbonyl group, a carboxyl group, an ester group, a cyano group, a nitro group, a C1-C20 alkoxy group, or a C2-C20 heterocyclic group or heterocyclic aromatic group containing one or more of N, O and S.

[0024] Furthermore, the novel histone deacetylase 6 (HDAC6) inhibitor of the present invention or a pharmaceutically acceptable salt thereof has a structure as shown in the following formula III.

[0025]

[0026] The histone deacetylase 6 inhibitor of the present invention has the activity of regulating and promoting polarization of anti-inflammatory microglia and exerting a neuroprotective effect, has an improving effect on early brain damage after ischemic stroke, and is a potential clinically applied drug for treating ischemic stroke.

[0027] In a second aspect, a method for preparing the above-mentioned histone deacetylase 6 (HDAC6) inhibitor is provided.

[0028] The histone deacetylase 6 (HDAC6) inhibitor of the present invention or a pharmaceutically acceptable salt thereof can be synthesized by the following route:

[0029]

[0030] The present invention designs and synthesizes a novel histone deacetylase 6 inhibitor based on 4-isopropylbenzene-1,3-diol, and endows it with stronger anti-inflammatory activity through the design of the molecular structure. Molecular modeling proves that the inhibitor of the present invention can efficiently and selectively dock with the active site of HDAC6, thereby exerting a new mechanism of neuroprotection in the treatment of ischemic stroke.

[0031] In a third aspect, there is provided use of the above-mentioned histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in preventing and / or treating ischemic stroke.

[0032] The present invention studies the effect of the histone deacetylase 6 inhibitor of the present invention on IS and the potential mechanism of microglia regulation by using a mouse ischemic stroke model. The experiment shows that the histone deacetylase 6 inhibitor of the present invention promotes the secretion of the anti-inflammatory factor IL10 by upregulating H3K9ac expression in microglia, further activates the IL10 / STAT3 axis mediation, and regulates microglia polarization through the IL10 / STAT3 signaling pathway, thereby improving the prognosis after ischemic stroke, and exerting a new mechanism of neuroprotection.

[0033] Another object of the present invention is to provide use of the above-mentioned histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and / or treating ischemic stroke.

[0034] Furthermore, the drugs are the same or different and include a therapeutically effective amount of a histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof.

[0035] Furthermore, the drug can be made into various pharmaceutical dosage forms by conventional methods, including: tablets, sugar-coated tablets, film-coated tablets, enteric-coated tablets, capsules, hard capsules, soft capsules, oral liquids, lozenges, granules, granules, pills, pills, suspensions, wine preparations, tinctures, drops and other oral dosage forms and injections and other dosage forms other than oral administration, such as injections.

[0036] Furthermore, the drug may also contain one or more pharmaceutically acceptable carriers or excipients.

[0037] Furthermore, the carrier or auxiliary material may include a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler, a disintegrant, a preservative, and the like.

[0038] In a fourth aspect, a pharmaceutical composition for preventing and / or treating ischemic stroke is provided, comprising a histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof.

[0039] In a fifth aspect, provided is the use of the above-mentioned histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a drug for improving the prognosis of ischemic stroke.

[0040] The present invention designs and synthesizes a novel histone deacetylase 6 inhibitor based on 4-isopropylbenzene-1,3-diol, which can specifically dock with the active site of HDAC6, thereby improving the prognosis after ischemic stroke and exerting a new mechanism of neuroprotection.

[0041] In a sixth aspect, there is provided a use of the above-mentioned histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a preparation product for preventing and / or treating neuroinflammation.

[0042] In a seventh aspect, provided is a use of the above-mentioned histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a preparation product for preventing and / or treating neuronal degeneration.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] (1) The present invention independently designed and developed a novel HDAC6 inhibitor and studied its novel mechanism of neuroprotection in a mouse ischemic stroke model, which is mediated by upregulating H3K9ac expression in microglia, promoting the secretion of the anti-inflammatory factor IL10, and further activating the IL10 / STAT3 axis.

[0045] (2) Treatment with the HDAC6 inhibitor of the present invention: can effectively reduce the cerebral infarction area after ischemic stroke in mice, improve the neurological function of mice with cerebral infarction, and relieve brain edema; can reduce neuronal degeneration and apoptosis after stroke; can reduce the release of proinflammatory factors in microglia after stroke, and promote the polarization of anti-inflammatory microglia; promote the expression of H3K9ac in microglia, promote the secretion of anti-inflammatory factor IL10, and further activate the IL10 / STAT3 axis-mediated. These research results show that the HDAC6 inhibitor of the present invention can regulate microglial polarization through the IL10 / STAT3 signaling pathway, thereby improving the prognosis after ischemic stroke. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0047] Figure 1 The figure shows the cell survival results.

[0048] Figure 2 Schematic diagram of the model of the binding of the histone deacetylase 6 inhibitor to HDAC6. 2+ Represented by spheres; hydrogen bonds are represented by dotted lines.

[0049] Figure 3 A modified neurological deficit score diagram for mouse experiments.

[0050] Figure 4 This is a staining image of brain sections from a mouse experiment and a statistical graph of cerebral infarction and brain edema volumes.

[0051] Figure 5 The effect of the histone deacetylase 6 inhibitor intervention on hippocampal neurons after cerebral infarction. Representative images of ipsilateral cortical TUNEL (A) and hippocampal FJC staining (B) 24 hours after ischemic stroke, magnification 200X, scale bar = 20 μm.

[0052] Figure 6 ELISA was used to analyze the content of anti-inflammatory factors in mouse plasma and brain tissue.

[0053] Figure 7-Figure 9 Double immunofluorescence staining was used to detect the morphology and phenotype of microglia.

[0054] Figure 10-12 Compound 13-7 of the present invention intervenes in the expression of H3K9ac in microglia after MACO. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. The materials involved in the following examples can be obtained from commercial channels unless otherwise specified. The methods described are conventional methods unless otherwise specified.

[0056] Example 1: Synthesis of histone deacetylase 6 inhibitors

[0057] The synthetic route of compound 13-7 is as follows:

[0058]

[0059] (1) Synthesis of Compound A (1-(2,4-dihydroxy-5-isopropylphenyl)ethan-1-one)

[0060]

[0061] 4-Isopropylbenzene-1,3-diol (3.0 g, 26.3 mmol) was dissolved in boron trifluoride diethyl ether (20 mL), acetic acid (3 mL) was added, and the mixture was heated at 90 ° C for 16 h. After the reaction, the mixture was cooled to room temperature, and an appropriate amount of 10% sodium acetate solution was added. The mixture was stirred at room temperature for 0.5 h. Ethyl acetate was added for extraction, and the mixture was washed with saturated sodium chloride three times. Anhydrous sodium sulfate was added to the organic layer, and the mixture was dried for 0.5 h. The dried solution was concentrated and purified by silica gel column. Compound A (1.9 g, 49.9%) was obtained as a brown solid by separation and purification with petroleum ether: ethyl acetate = 30:1. 1 HNMR (400MHz, DMSO-d6) δ12.47(s,1H),10.62(s,1H),7.55(s,1H),6.30(s,1H),3.09(p,J=6.9Hz,1H),2.54(s,3H),1.18(d,J=6.9Hz,6H).

[0062] (2) Synthesis of compound B (1-(2,4-bis(benzyloxy)-5-isopropylphenyl)ethan-1-one)

[0063]

[0064] Compound A (3.42 g, 1.0 eq, 17.6 mmol) was dissolved in anhydrous N, N-dimethylformamide, and anhydrous potassium carbonate (5.48 g, 2.2 eq, 38.72 mmol) and benzyl bromide (4.7 mL, 2.2 eq, 38.72 mmol) were added at room temperature. The argon gas was replaced and heated and stirred at 150 ° C for 16 h. The mixture was cooled to room temperature, and water was added to the reaction solution to precipitate a solid. The filter cake was washed three times with water and three times with petroleum ether to obtain a chocolate-colored solid as a crude product. Purification by silica gel column, petroleum ether: ethyl acetate = 20: 1, to obtain pure khaki compound B (5.1 g, 77.4%). 1 H NMR(400MHz,Chloroform-d)δ7.76(s,1H),7.47-7.30(m,10H),6.51(s,1H),5. 09(d,J=4.9Hz,4H),3.28(m,J=7.0Hz,1H),2.56(s,3H),1.22(d,J=6.9Hz,6H).

[0065] (3) Synthesis of compound C ((Z)-4-(2,4-bis(benzyloxy)-5-isopropylphenyl)-2-hydroxy-4-oxobut-2-enoate)

[0066]

[0067] Compound B (3.4 g, 1.0 eq, 9 mmol) was dissolved in anhydrous tetrahydrofuran under argon. Sodium hydroxide (1.47 g, 4.0 eq, 36 mmol) was added. After the reaction was stirred for 0.5 h, diethyl oxalate (1.86 mL, 1.5 eq, 13.5 mmol) was slowly added, refluxed for 4 h, the reaction was terminated, cooled to room temperature, the pH was adjusted to a weak acid (pH ≈ 5) with acetic acid, water was added, ethyl acetate was extracted, the organic layer was washed three times with a saturated sodium chloride solution, dehydrated with anhydrous sodium sulfate for 0.5 h, and the dried organic solution was concentrated to obtain a crude compound. Purification by silica gel column, petroleum ether: ethyl acetate = 15: 1, to obtain pure bright yellow compound C (2.07 g, 48%). 1 H NMR(400MHz,DMSO-d6)δ7.77(s,1H),7.52(dd,J=10.9,7.1Hz,4H),7.49-7.33(m,8H),7.03(s,1H) ,5.32(d,J=6.7Hz,4H), 4.20(q,J=7.1Hz,2H), 3.20(p,J=6.9Hz,1H), 1.17(dd,J=7.0,4.6Hz,9H).

[0068] (4) Synthesis of compound D (Ethyl 5-(2,4-bis(benzyloxy)-5-isopropylphenyl)isoxazole-3-carboxylate)

[0069]

[0070] Compound C (2.36 g, 1.0 eq, 5 mmol) was dissolved in ethanol, hydroxylamine hydrochloride (0.51 g, 1.5 eq, 7.5 mmol) was added at room temperature, refluxed at 90 ° C for 4 h, the reaction was stopped, and cooled to room temperature. The reaction solution was concentrated, water was added, extracted with ethyl acetate, the organic layer was washed with saturated sodium chloride solution, and dehydrated with anhydrous sodium sulfate. The dried organic solution was concentrated to obtain a crude compound, which was purified on silica gel with petroleum ether: ethyl acetate = 10:1 to obtain pure compound D (2.12 g, 90.6%). 1H NMR(400MHz,DMSO-d6)δ7.70(s,1H),7.56-7.47(m,4H),7.47-7.40(m,5H),7.40-7.35(m,1H),7.07(s,1H),6.92(s,1H ),5.33(s,2H),5.26(s,2H),4.33(q,J=7.1Hz,2H),3.26(p,J=6.9Hz,1H),1.30(t,J=7.1Hz,3H),1.21(d,J=6.9Hz,6H).

[0071] (5) Synthesis of compound E (5-(2,4-bis(benzyloxy)-5-isopropylphenyl)-N-ethylisoxazole-3-carboxamide)

[0072]

[0073] Compound D (2g, 1.0eq, 4.2mmol) was dissolved in tetrahydrofuran (40mL) at room temperature. Lithium hydroxide (0.3g, 3.0eq) and water (20mL) were added to the obtained solution, stirred for 24h, the reaction was stopped, the reaction solution was concentrated, 20mL of water was added, the pH was adjusted to weak acidity (pH≈5) with 1M HCl, and the corresponding acid was collected by filtration. The acid (1.04g, 1.0eq, 2.4mmol) was dissolved in anhydrous dichloromethane, ethylamine hydrochloride (0.29g, 1.5eq, 3.6mmol), HOBT (0.48g, 1.5eq, 3.6mmol), EDCI (0.9g, 2.0eq, 4.8mmol), triethylamine (1.14mL, 3.5eq, 8.4mmol) were added under ice bath conditions, and the mixture was transferred to room temperature after 0.5h and stirred for 24h. The reaction mixture was concentrated and purified on silica gel using petroleum ether:ethyl acetate=8:1 to obtain pure compound E (0.69 g, 62.6%). 1 H NMR (400MHz, DMSO-d6) δ8.73(t,J=5.8Hz,1H),7.67(s,1H),7.52-7.46(m,4H),7.43(t,J=7.7Hz,4H),7.40-7.33(m,2H ),7.05(s,1H),6.89(s,1H),5.35(s,2H),5.24(s,2H),3.32-3.18(m,3H),1.20(d,J=6.9Hz,6H),1.11(t,J=7.2Hz,3H).

[0074] (6) Synthesis of Compound F (5-(2,4-bis(benzyloxy)-5-isopropylphenyl)-N-ethyl-4-iodoisoxazole-3-carboxamide)

[0075]

[0076] NIS (0.31 g, 2.0 eq, 1.4 mmol) and CAN (0.02 g, 0.05 eq, 0.035 mmol) were added to an anhydrous acetonitrile solution of compound E (0.33 g, 1.0 eq, 0.7 mmol) and stirred at room temperature in the dark for 24 h. After the reaction was completed, acetonitrile was evaporated, extracted with ethyl acetate, and the organic layer was washed three times with saturated sodium chloride solution and dehydrated with anhydrous sodium sulfate. The crude product was purified on silica gel with petroleum ether: ethyl acetate = 10:1 to obtain pure compound F as a white solid (0.17 g, 79%). 1 H NMR(500MHz,DMSO-d6)δ8.85(t,J=5.7Hz,1H),7.48-7.30(m,11H),7.02(s,1H) ,5.22(s,4H),3.29-3.21(m,3H),1.17(d,J=6.9Hz,6H),1.11(t,J=7.2Hz,3H).

[0077] (7) Synthesis of Compound G (5-(2,4-dihydroxy-5-isopropylphenyl)-N-ethyl-4-iodoisoxazole-3-carboxamide)

[0078]

[0079] After dissolving compound F (0.3 g, 1.0 eq, 0.5 mmol) in anhydrous dichloromethane, slowly add boron trichloride (2.0 mL, 4.0 eq, 2.0 mmol) at -78°C, stir for 1 h, and continue stirring at room temperature for 2 h. Concentrate the reaction solution, dissolve it in methanol, and concentrate it again. Repeat 3 times. Dissolve the remaining dichloromethane and purify it by silica gel column chromatography (petroleum ether: ethyl acetate = 3:1) to obtain pure product G as a light yellow oil (0.1784 G, 85.4%). 1H NMR(500MHz,DMSO-d6)δ9.87(s,1H),9.84(s,1H),8.80(t,J=5.7Hz,1H),7.10(s,1H),6.50(s, 1H),3.30-3.23(m,2H),3.10(p,J=6.9Hz,1H),1.17(td,J=7.2,0.8Hz,2H),1.15-1.09(m,7H).

[0080] (8) Synthesis of compound H(Methyl 4-((5-(2,4-dihydroxy-5-isopropylphenyl)-3-(ethylcarbamoyl)isoxazol-4-yl)ethynyl)benzoate)

[0081]

[0082] Compound G (0.208 g, 1.0 eq, 0.5 mmol) was dissolved in 10 mL DMF. Methyl 4-ethylbenzoate (0.12 g, 1.5 eq, 0.75 mmol), Pd(PPh3)2Cl2 (10 mg), CuI (5 mg) and TEA (140 μL, 2 eq, 1 mmol) were added in sequence. The mixture was stirred at 90 ° C under argon for 12 h, the reaction was cooled to room temperature, water was added, and the mixture was extracted with ethyl acetate. The crude product was purified by petroleum ether: ethyl acetate = 4:1 to obtain pure compound H as a yellow solid with a yield of 58%. 1 H NMR (600MHz, DMSO-d6) δ10.09(d,J=10.3Hz,2H),8.83(t,J=5.7Hz,1H),7.99(d,J=8.3Hz,2H),7.63-7.51 (m,3H),6.56(s,1H),3.87(s,3H),3.32-3.23(m,2H),3.10(p,J=6.9Hz,1H),1.13(dd,J=22.6,7.0Hz,9H).

[0083] (9) Synthesis of histone deacetylase 6 inhibitor (5-(2,4-dihydroxy-5-isopropylphenyl)-N-ethyl-4-((4-(hydroxycarbamoyl)phenyl)ethynyl)isoxazole-3-carboxamide)

[0084]

[0085] Compound H (44.8 mg, 1.0 eq, 0.1 mmol) was dissolved in 5 mL of saturated methanol NH2OK solution. Stir at room temperature for 12 h, remove methanol in vacuo, and add 5 mL of water. Adjust the pH to weak acidity (pH ≈ 5) with 1 M HCl, and collect the solid by filtration. The crude product was purified by DCM: methanol = 15: 1 to obtain a histone deacetylase 6 inhibitor, named compound 13-7, as a pure yellow solid, with a yield of 68%. 1 H NMR (400MHz, DMSO-d6) δ11.31(s,1H),10.09(s,2H),9.11(s,1H),8.82(t,J=5.8Hz,1H),7.78(d,J=8.4Hz,2H ),7.57(s,1H),7.50(d,J=8.4Hz,2H),6.56(s,1H),3.33-3.27(m,2H),3.13-3.06(m,1H),1.16-1.10(m,9H). 13 C NMR (126MHz, DMSO-d6) δ172.18,163.79,159.18,158.79,158.37,155.58,133.03,131.44,127.68,127. 34,126.64,125.40,104.51,103.33,96.91,93.68,81.43,34.27,26.19,23.03,14.98.HRMS(AP-ESI)m / z Calcd for C 24 H 23 N3O6[M+H] + 450.1660, found:450.1659.

[0086] Example 2: Cell survival analysis

[0087] The cell viability of mouse microglial cell line (BV2) stimulated by compound 13-7 with a concentration gradient was measured in 96-well plates using SYTOX Green Nucleic Acid Stain (Invitrogen), with 3 replicates. The luminescence intensity was measured in EnSpire Multimode Plate Reader (PerkinElmer), with 8,000 cells per well, and cell survival was detected 24 hours after drug stimulation. Cytotoxicity was expressed as the percentage of cells surviving in each well after deducting the background signal in non-induced cells. The results are shown in Figure 1 .

[0088] Example 3: Molecular Modeling

[0089] Compound 13-7 was docked into the active site of HDAC6 using Tripos SYBYL-X 2.1 (PDB entry: 5WGL). The schematic diagram of the binding mode is shown in Figure 2 Before docking, the HDAC6 structure retrieved from the PDB website was processed by deleting water molecules and FF99 charges. The protein structure was further optimized by a 100-step minimization process. The molecular structure was generated using the Sybyl / Sketch module and optimized using the Powell method. The Tripos force field (convergence criterion was set to 0.05 kcal / ( mol), and the Gasteiger_Hückel method was used for charge distribution. Molecular docking was performed using the Sybyl / Surflex-Dock module. Other docking parameters remained at default values. The crystal structure of the complex of HDAC6 catalytic domain 2 and the highly selective HDAC6 inhibitor HPB was used as a template (PDB code: 5WGL). It can be seen from the figure that the active pocket of HDAC6 can accommodate compound 13-7.

[0090] Example 4: Ischemic Stroke Mouse Model Experiment

[0091] 1.8-10 weeks old male C57BL / 6N mice, weighing approximately 25-28 g. Animals were housed in a standard animal room at a temperature of 25±1°C and a humidity of 50-60%, with free access to food and water. Animals were regularly maintained with 12 h of light and 12 h of darkness. All C57BL / 6NX mice were purchased from Shanghai Slake Animal Experiment Center (Shanghai).

[0092] Mice were used to construct the middle cerebral artery ischemia-reperfusion (MCAO / R) model. Forty 8-week-old C57 male mice were divided into three groups and randomly divided into cerebral infarction model group (MCAO group, only injected with normal saline, Vehicle group), compound a group (control group), compound 13-7 group (intervention group) and Sham group (sham operation control group), with 6 mice in each group.

[0093] All data in the following experiments are presented as mean ± standard deviation (SD). All statistical analyses were performed using GraphPad PRISM 8.0 statistical software. Unpaired t-test was used to compare the differences between the two groups. Each treatment was performed independently. P values ​​less than 0.05 were considered statistically different. P values ​​less than 0.01 were considered statistically significant.

[0094] 2. Establishment of MCAO model

[0095] First, turn on the air pump of the anesthesia machine (R510-29, Shenzhen Ruiwode Life Science Co., Ltd., China), use isoflurane, and continue anesthesia until the end of the operation. After anesthesia, the neck hair of the mouse was shaved and disinfected, and the skin was cut open with scissors in the middle of the neck to separate the muscles and surrounding tissues. The internal carotid artery (ICA), external carotid artery (ECA) and common carotid artery (CCA) were found and separated. The electrocoagulation pen was required to burn off the side branch of the external carotid artery (occipital artery), and then the common carotid artery was tied with a slip knot. The external carotid artery needed to be wrapped with two wires, one of which was tied with a knot at the distal end, and the other was tied with a slip knot to prepare for the subsequent fixation of the ligature. At the same time, the internal carotid artery was clamped with an artery clamp. A 45-degree incision was made on the external carotid artery, and the ligature was inserted into the direction of the common carotid artery and the fixing line was tightened. Then the external carotid artery was burned with an electrocoagulation pen so that the external carotid artery and the internal carotid artery were in a straight line. After the ligature was slightly withdrawn, the ligature was inserted into the internal carotid artery until the beginning of the middle cerebral artery. The nylon thread and ECA were ligated with 6-0 silk thread, and the external carotid artery was cut open with nylon thread and rotated. The nylon thread was advanced until the tip of the nylon thread was >6 and <9mm away from the internal carotid artery-pterygopalatine artery branch and the internal carotid artery-external carotid artery branch, respectively. After surgery, the skin of the rat's neck was sutured and the rat was placed on a constant temperature insulation table (37°C) to maintain body temperature. After 1 hour of ischemia, the wound was opened, the suture was carefully pulled out, a knot was tied at the incision of the external carotid artery, the sliding knot of the common carotid artery was opened, and blood flow was allowed to flow from the common carotid artery to the internal carotid artery to complete ischemia-reperfusion. After suturing the muscle layer and the skin layer, the MCAO model was completed. In addition to the use of silk embolism and reperfusion, the other steps of the sham operation group were the same as those of the MCAO group. After the completion of reperfusion, the model group was injected with normal saline, compound 13-7 (2 mg / kg), and compound a (2 mg / kg, control group, the structural formula is shown below) through the tail vein.

[0096]

[0097] 3. Modified Neurological Deficit Score (mNSS) Behavioral Assessment

[0098] In order to explore the effect of compound 13-7 of the present invention on the neurological function of mice with cerebral infarction, mNSS was used to evaluate the neurological behavior of mice after 1 hour of middle cerebral artery occlusion and 23 hours of reperfusion. The design principles of the mNSS system include movement (muscle strength and abnormal movement), sensation (vision, touch and proprioception), reaction and balance tests. The neurological function grade is divided into 0 to 14 points, and the lower the score, the more sound the function. 0 points represent normal and sound mice, and 14 points represent mice with the greatest functional impairment.

[0099] The mNSS scoring criteria are as follows:

[0100] 3.1 Tail-lift test (maximum = 3 points): lift the mouse tail more than 30 cm off the ground, observe the flexion of the forelimbs (1 point for abnormal limbs on the affected side), flexion of the hind limbs (1 point for abnormal limbs on the affected side), and the head rotation deviates from the vertical axis by more than 10° within 30 seconds (1 point for abnormal deviation to the affected side). The total score of this item is 3 points.

[0101] 3.2 Walking on flat ground (normal = 0; maximum = 3): The mice were placed on an open flat ground and allowed to walk freely. Normal walking was scored as 0 points; inability to walk in a straight line was scored as 1 point; turning in circles toward the paralyzed side was scored as 2 points; and falling toward the paralyzed side was scored as 3 points.

[0102] 3.3 Balance beam test (normal = 0; maximum = 6) The mice were placed on a balance beam with a width of 1.5 cm and allowed to walk freely. Maintaining balance was scored as 0 points; grasping the edge of the beam was scored as 1 point; holding the beam tightly and one foot slipping off was scored as 2 points; holding the beam tightly and both feet slipping off, or rotating on the beam (maintaining time>30 seconds), scored as 3 points; trying to maintain balance but still slipping off (maintaining time>20 seconds), scored as 4 points; trying to maintain balance but slipping off (maintaining time>10 seconds), scored as 5 points; slipping off, but not trying to maintain balance or grasping the balance beam (maintaining time<10 seconds), scored as 6 points.

[0103] 3.4 Reflex loss: 1 point for the auricular reflex (shaking the head when the ear canal is touched); 1 point for the corneal reflex (blinking when the cornea is gently touched with a cotton ball).

[0104] Results Figure 3 The results showed that after 3 days of intervention, the neurological function scores of mice in the compound 13-7 group of the present invention were lower than those in the vehicle group and the compound a group, indicating that the neurological function was restored, and the difference was statistically significant (P < 0.001). Behavioral tests including modified neurological deficit scores showed that the compound 13-7 of the present invention improved the neurological function of mice after MCAO.

[0105] 4.TTC staining and brain edema test

[0106] In order to explore the effect of compound 13-7 of the present invention on cerebral infarction in mice, TTC staining was performed and ImageJ was used to calculate the infarct area and the changes in brain edema in mice.

[0107] 4.1 TTC staining

[0108] Mice were killed 3 days after reperfusion. After being anesthetized with isoflurane, the mice were perfused with normal saline. The rat brains were removed, frozen at -20°C for 30 minutes, and cut into slices with a thickness of 2 mm. The brain slices were quickly placed in a 2% 2,3,5-triphenyltetrazolium chloride (TTC) dye solution, then transferred to a 37°C incubator for 20 minutes and photographed with a digital camera. ImageJ software was used to analyze and calculate the infarct volume.

[0109] 4.2 Measurement of brain water content

[0110] The brain water content was measured by the dry and wet method. The specific experimental method is as follows: After the mouse is anesthetized with isoflurane, it is quickly decapitated and the brain is immediately removed from the skull. The wet weight of each part of the brain tissue is measured on an electronic analytical balance (weight is recorded to an accuracy of 0.01 mg). Note that during the process, avoid touching the brain tissue with your hands to interfere with the water content on the surface of the brain tissue. Subsequently, each brain tissue is placed in an electric constant temperature forced air drying oven (100°C) and baked for 1 day (24 hours) to constant weight, and weighed a second time (dry weight). The calculation formula for brain water content is: Brain tissue water content (%) = [(brain tissue wet weight - brain tissue dry weight) / (wet weight)] × 100%.

[0111] Results Figure 4 , where A is the TTC staining image, and the cerebral infarction volume (B) and cerebral edema volume (C) were calculated. As can be seen from the figure, compared with the Vehicle group and the compound a group, the percentage of infarction area of ​​the mice in the compound 13-7 group of the present invention was lower, indicating that the compound 13-7 of the present invention can reduce the infarction volume after ischemic stroke and the difference is statistically significant (P < 0.001). The brain edema test showed that the brain edema of the mice in the compound 13-7 group of the present invention was significantly improved, indicating that the compound 13-7 of the present invention can alleviate brain edema with significant statistical differences.

[0112] 5. TUNEL staining

[0113] In order to further explore the effect of the compound 13-7 of the present invention on neurons in the hippocampus of mice with cerebral infarction, FJC staining and TUNEL (Terminal-deoxynucleoitidyl Transferase / (TdT-)Mediated Nick End Labeling) were used.

[0114] According to the manufacturer's instructions, TUNEL was stained at 24h I / R using an in situ apoptosis detection kit (Roche, Indianapolis, USA) to quantify cell apoptosis. The number of TUNEL-positive cells in the ipsilateral cortex was analyzed. Four random fields of view for each slide were observed by a blind observer using a microscope at 200 times magnification. FJC staining was performed at 24h I / R using a modified FJC staining kit (Millipore, Billerica, MA, USA) to assess the number of degenerated neurons. According to the manufacturer's instructions, the slides were rinsed with PBS, incubated with FJC working solution for 20 minutes, and then observed under a fluorescent microscope. FJC-positive neurons in the hippocampus were manually counted using a 200x magnifying glass and ImageJ software (ImageJ 1.5, NIH, USA).

[0115] Results Figure 5 . As can be seen from the figure, compared with the Vehicle group and the compound a group, the compound a group had more neuronal loss in the hippocampus, and the morphology was in a shrunken state; while the neuronal degeneration in the hippocampus of the compound 13-7 group of the present invention was improved. The results show that the compound 13-7 of the present invention can reduce neuronal degeneration and apoptosis after stroke. The results showed that treatment with compound 13-7 after ischemic stroke can reduce TUNEL-positive neurons and improve short-term neurobehavioral outcomes in rats. Studies have shown that treatment with compound 13-7 can regulate and promote the polarization of anti-inflammatory microglia and play a neuroprotective role. The research results of the present invention explored the changes in microglia and the conversion of polarization patterns after ischemic stroke, and verified the improvement effect of compound 13-7 treatment on early brain damage after ischemic stroke, which shows that compound 13-7 is a potential drug for clinical application.

[0116] 6. Effect of compound 13-7 intervention on polarization of anti-inflammatory microglia after cerebral infarction

[0117] Mice were killed 3 days after reperfusion, and whole blood was obtained by eye sampling after isoflurane anesthesia. Then, plasma was obtained by centrifugation at 3500 rpm for 10 minutes for ELISAs. Cytokine detection was performed using ELISA kits for TNF-α, IL-6, and IL-10 (Fancovi) according to the instructions. The results are shown in Figure 6, the figure shows the expression analysis of cytokine proteins (TNF-α, IL-6 and IL-10) in mouse plasma (A) and ipsilateral brain tissue (B). The content of anti-inflammatory factors in mouse plasma and brain tissue was analyzed by enzyme-linked immunosorbent assay (ELISA). It was found that compared with the Vehicle group and compound a group, the pro-inflammatory factors (TNF-α and IL-6) in the post-stroke plasma and brain tissue of the compound 13-7 group of the present invention showed a downward trend, which was statistically significant, while the anti-inflammatory factor (IL-10) showed an upward trend, which was statistically significant. The results confirmed the association between the compound 13-7 of the present invention and the inhibition of neuroinflammation.

[0118] The effect of compound 13-7 on the phenotype of microglia after cerebral infarction was further investigated after 3 days of intervention. Double immunofluorescence staining (Iba-1 and Nos2, TNF-α and IL-10 proteins) was used to detect the morphology and phenotype of microglia. Iba-1 is a marker of resting and activated microglia, while Nos2, TNF-α and IL-10 are markers of pro-inflammatory or anti-inflammatory microglia. The results are shown in Figure 7-Figure 9 , Nos2 in activated microglia in the cortex of mice with cerebral ischemia ( Figure 7 )、TNF-α( Figure 8 ) and IL-10( Fig. 9 ) Representative immunofluorescence images, DAPI (blue) staining of cell nuclei. The results showed that compared with the Vehicle group and the compound a group, there were more Iba-1 and Nos2, TNF-α double immunofluorescence staining positives. The compound 13-7 group of the present invention had more Iba-1 and IL-10 double immunofluorescence staining positives. These data indicate that the compound 13-7 of the present invention can reduce the release of proinflammatory factors in microglia after stroke and promote the polarization of anti-inflammatory microglia. Figure 7-Figure 9 In the above, HDACi refers to compound 13-7, that is, MCAO+HDACi refers to the compound 13-7 group, and the same applies below.

[0119] 7. Compound 13-7 intervention on anti-inflammatory microglial polarization and H3K9ac downstream regulatory mechanism after cerebral infarction

[0120] Immunofluorescence was used to detect the expression of histone 3-lysine 9-acetylation (H3K9ac); immunofluorescence was used to detect histones to detect the synthesis and release of the anti-inflammatory factor IL-10 in microglia in vitro.

[0121] 7.1 Polyacrylamide gel electrophoresis and transfer

[0122] Temporal and basal brain tissue samples were homogenized and then lysed in cell lysis buffer RIPA for 30 min, then centrifuged at 12,000 g for 10 min at 4 °C, and the supernatant was collected. The protein content was determined using a BCA assay kit (Biyuntian, Shanghai, China). Protein samples (30 μg / lane) and molecular weight markers (4 μL / well; Thermo Fisher Scientific, Waltham, MA, USA) were loaded on prepared 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels, then separated and transferred to PVDF membranes (Millipore Corporation, Billerica, USA) for electrophoresis. The membrane was incubated with 5% skim milk at room temperature for 1 hour, and then incubated with target antibodies (pSTAT3, ab76315, 1:1000, Abcam; STAT3, ab68153, 1:1000, Abcam; IL10, ab310329, 1:1000, Abcam; β-Actin, ab6276, 1:5000, Abcam) at 4°C overnight. Next, horseradish peroxidase (HRP)-linked secondary antibodies (SantaCruz Biotechnology, Santa Cruz, CA, USA) were incubated with the membrane at room temperature for 1 hour and washed three times with PBST (PBS + 0.1% Tween 20). Finally, the gray value of the membrane was detected with enhanced chemiluminescence (ECL) detection reagent (Clinx Scientific Instruments). ImageJ software (NIH, Bethesda, MA, USA) was used to analyze the grayscale changes of protein bands.

[0123] 7.2 Immunofluorescence staining

[0124] After taking out the 8μm slices stored in the -80℃ refrigerator, place them in a wet box and rewarm them at room temperature (15 minutes); wash them with 0.1M PBS buffered saline solution 3 times, 5 minutes each time, in order to wash off the covering embedding agent; circle the brain tissue staining range with an immunohistochemistry pen to avoid liquid outflow and keep it moist during the staining process. Incubate at room temperature for 15-30 minutes with 0.3% Trixon-100 to allow the cells to penetrate the membrane. Finally, wash them with PBS buffered saline solution 3 times, 5 minutes each time; block: block the staining area with 5% donkey serum to avoid nonspecific binding of antibodies, and place it at room temperature for 1 hour; add the corresponding primary antibody of appropriate concentration and place it at 4℃ overnight. The next day, place the wet box at room temperature for 30 minutes and wash it with PBS buffered saline solution 3 times, 5 minutes each time. The corresponding primary antibodies and specific dilution ratios are as follows: IL33, ab187060, 1:200, Abcam; ST2, ab194113, 1:200, Abcam; NEUN, ab104224, 1:200, Abcam; GFAP, ab302644, 1:200, Abcam; Iba-1, ab283319, 1:200, Abcam. Donkey anti-rabbit IgG conjugated with FITC and donkey anti-mouse IgG conjugated with Texas Red (1:200) were added respectively; or donkey anti-rabbit IgG conjugated with FITC and donkey anti-goat IgG conjugated with Texas Red (1:200). After incubation with the secondary antibody, the cells were incubated at room temperature in the dark for 2 hours, and finally washed 3 times with PBS buffered saline solution, each for 5 minutes; anti-quenching mounting medium with DAPI was added, and the cells were developed and analyzed using a fluorescence microscope after mounting.

[0125] 7.3 Chromatin immunoprecipitation-quantitative polymerase chain reaction

[0126] Chromatin immunoprecipitation (ChIP) was performed using the EZ-ChIP Chromatin Immunoprecipitation Kit (No.17371, Millipore) according to the manufacturer's guidelines. Protein-DNA was cross-linked in cultured BV2 microglia cells with 1% paraformaldehyde for 10 min, and the reaction was quenched with 2.5 mM glycine. Cells were lysed on ice, crude extracts were sonicated (Bioruptor, Diagenode), and cross-linked DNA was sheared into smaller fragments (200-1000 bp) and visualized by gel electrophoresis. Sheared DNA was then incubated with protein A agarose / salmon sperm (No.16-157, Merck Millipore) beads to pre-clear nonspecific interactions. Subsequently, aliquots were incubated with relevant antibodies H3K9ac (No.07-352, Millipore) and IgG (No.SC2027X, Santa Cruz) at 4°C overnight with shaking. Protein A agarose / salmon sperm beads pulled down antibody-bound protein-DNA and were subsequently washed before elution. The crosslinks were then reversed, and immunoprecipitated DNA fragments were purified and amplified using the QIAquick PCR purification kit (No. 28,104; Qiagen). Samples were then subjected to qRT-PCR using primers and analyzed with reference to 1% input DNA. Rabbit IgG was used as a negative control.

[0127] Table 1. Primers used for chromatin immunoprecipitation

[0128] Gene name Forward primer Reverse primer F AAATCCTGCTGATGCCCCC ATGCCTCCAACCTCTACCGA Il10 GCCTGCTCTTACTGACTGGC AGCTCTAGGAGCATGTGGCT Il6 TGTGGGATTTTCCCATGAGTCT TATCGTTCTTGGTGGGCTCC Nos2 GGGGACTCTCCCTTTGGGAA GGGGCCAGAGTCTCAGTCTT Stat1 GTCTGTCAAAGCTCCCTGG CTCACTCACTCACTGCACG Tnf-α GCCAGTGAGTGAAAGGGAC CTAGCCAGGAGGGAGAACAG

[0129] Results Figure 10-12 . Fig.10 In the figure, A is a coronal brain section of a mouse with 1h ischemia and 24h reperfusion (24I / R) after MCAO, and immunofluorescence staining of H3K9ac (red), Iba-1 microglial marker (green), and DAPI nuclei (blue). B is morphologically activated microglia (Iba-1, green) observed in the cortex, striatum, and hippocampal infarct areas of 24I / RMCAO, and the expression of histone marker H3K9ac (red) was detected. DAPI (blue) stains the nucleus. Scale bar, 50μm. C is an immunofluorescence staining of H3K9ac (red), Iba-1 microglial marker (green), and DAPI nuclei (blue) in BV2 microglia activated by LPS (lipopolysaccharide, 1mg / kg). Scale bar (white) indicates 50μm (Control refers to the MCAO model group, and HDACi refers to the compound 13-7 group in the figure). D is the average H3K9ac pixel intensity of each nucleus is consolidated and a treatment-related graph is drawn. Fig.11In the figure, A shows the enrichment of H3K9ac / H3 on Il10, Fcrlb, Tnf-α, Stat1, Nos2 and Il6 after HDAC6 inhibition by compound 13-7. B shows the increased expression of IL-10 and pSTAT3 (Y705) after compound 13-7 treatment compared with control and LPS-activated microglia. Fig.12 In the figure, A and B are representative images of the increased expression of the IL-10 / STAT3 axis in microglia after treatment with compound 13-7. C is a representative blot of the expression of pSTAT1, STAT1, and IL-10 in activated microglia.

[0130] As can be seen from the figure, the expression of H3K9ac in the compound 13-7 group of the present invention increased, with statistical significance. The results show that the compound 13-7 of the present invention can upregulate the expression of H3K9ac in microglia, which is manifested as an overall change in the H3K9ac pattern in microglia. H3K9ac is enriched in the promoters of the pro-inflammatory genes Tnf-α, Stat1, interleukin-6 (Il-6), Nos2 and the anti-inflammatory gene Il10. Figure 11-Figure 12 It can be seen that in microglia, after treatment with compound 13-7, the H3K9ac / H3 level of the IL-10 gene promoter was significantly increased, while the H3K9ac / H3 enrichment on the Tnf-α and IL6 promoters was significantly reduced. The compound 13-7 group of the present invention promotes an upward trend in the expression level of IL10, and further promotes the activation of the STAT3 signaling pathway. Through WB detection (Western blot) research, it was found that the expression levels of IL-10 and p-STAT3 increased significantly, further verifying that the compound 13-7 of the present invention may play a role through H3K9ac, and the IL-10 / STAT3 signaling pathway is also significantly activated. The compound 13-7 of the present invention can significantly upregulate the expression of the anti-inflammatory cytokine IL10 in activated microglia, indicating that compound 13-7 has an immunosuppressive effect.

[0131] The above results show that after the intervention of the compound 13-7 of the present invention, the polarization level of anti-inflammatory microglia in mice with cerebral infarction increased significantly, and the degeneration of neurons in the hippocampus was improved. It can be seen that the protective effect of the compound 13-7 of the present invention can inhibit the production of inflammatory factors through the H3K9ac / IL10 / STAT3 pathway, thereby exerting a protective effect. H3K9ac can promote the expression of IL10 through H3K9ac, thereby activating the activation of the STAT3 pathway and inhibiting the release of downstream inflammatory factors TNFα, thereby exerting an anti-inflammatory effect and playing a neuroprotective role. This proves that the compound 13-7 of the present invention has the prospect of being used in the preparation of preparation products for the prevention or treatment of ischemic stroke, especially in the case of neuroinflammation or neuronal deformation.

[0132] In summary, the histone deacetylase 6 inhibitor of the present invention or its pharmaceutically acceptable salt can be used in the preparation of drugs for preventing and / or treating ischemic stroke. The histone deacetylase 6 inhibitor of the present invention or its pharmaceutically acceptable salt can be used in the preparation of preparation products for preventing and / or treating neuroinflammation. The histone deacetylase 6 inhibitor of the present invention or its pharmaceutically acceptable salt can be used in the preparation of preparation products for preventing and / or treating neuronal degeneration. The histone deacetylase 6 inhibitor of the present invention or its pharmaceutically acceptable salt provides a basis for the prevention and treatment of stroke by promoting anti-inflammatory microglial polarization intervention.

[0133] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of a histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a drug for preventing and / or treating ischemic stroke, characterized in that The structural formula of the histone deacetylase 6 inhibitor is shown in Formula I: Wherein, R0 is selected from hydroxyl group; R1 and R2 are one or more substituents on the benzene ring, independently selected from hydrogen, halogen atoms, hydroxyl, carboxyl, cyano, nitro, amino, mercapto, substituted or unsubstituted C1-C20 straight or branched alkyl, substituted or unsubstituted C3-C20 cycloalkyl, C1-C20 haloalkyl, substituted or unsubstituted C1-C20 hydrocarbonoxy; the substituted substituents are independently selected from hydrogen, halogen, hydroxyl, cyano, nitro, amino, C1-C20 straight or branched alkyl, C3-C20 cycloalkyl, C1-C20 haloalkyl.

2. The use according to claim 1, characterized in that: One or more hydrogen atoms in R0, R1, and R2 may be replaced by a halogen atom, an oxygen atom, a sulfur atom, a C1-C20 straight or branched alkyl group, a C3-C20 cycloalkyl group, a C1-C20 haloalkyl group, a carboxyl group, a cyano group, a nitro group, or a C1-C20 hydrocarbonoxy group.

3. Use of the histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 2 in the preparation of a drug for improving the prognosis of ischemic stroke.

4. Use of the histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 2 in the preparation of a preparation product for preventing and / or treating neuroinflammation.

5. Use of the histone deacetylase 6 inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 2 in the preparation of a preparation product for preventing and / or treating neuronal degeneration.

Images