A kit, method of use, and storage medium

By detecting the PNPLA3 gene and constructing a model, combined with specific primers and probes, the problems of low sensitivity and high cost of existing fatty liver detection methods are solved, achieving high sensitivity and specific diagnosis of fatty liver, simplifying the operation steps and reducing costs.

CN118813778BActive Publication Date: 2025-10-21GENETRON HEALTH (BEIJING) CO LTD +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410868667.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-01
Publication Date
2025-10-21
Estimated Expiration
2044-07-01

AI Technical Summary

Technical Problem

Existing methods for detecting fatty liver, such as ultrasound diagnosis, have low sensitivity, high cost, and low accessibility. They cannot effectively detect mild fatty liver and are subjective, which limits their widespread application.

Method used

By detecting the PNPLA3 gene, using specific primers and probes for fatty liver diagnosis, and combining factors such as age, BMI, and gender to build a model, accurate diagnosis of mild, moderate, and severe fatty liver can be achieved. Rapid PCR testing is performed using oral swabs or blood samples.

Benefits of technology

It achieves high sensitivity and specificity in the diagnosis of fatty liver, reduces testing costs, simplifies operating steps, and improves the accessibility and accuracy of testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813778B_ABST
    Figure CN118813778B_ABST
Patent Text Reader

Abstract

The application provides a kit, a use method and a storage medium, belongs to the technical field of biology, and comprises reagents suitable for detecting a PNPLA3 gene; with hg38 as a reference genome, a target region of the PNPLA3 gene is selected as chr22:43928769-43928882; and the reagents comprise primers and a probe. Through selection of specific genes and gene sequences, diagnosis of fatty liver is achieved, and through different cut off values, accurate diagnosis of mild, moderate and severe fatty liver is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a kit, a method for use and a storage medium. Background Art

[0002] Fatty liver disease (FLD), also known as fatty liver, is a highly heterogeneous group of diseases caused by a complex interplay of multiple factors, including susceptibility genes, epigenetics, diet, and lifestyle. It encompasses two main categories: alcoholic-related liver disease (ALD) and non-alcoholic fatty liver disease (NAFLD). Pathologically, fatty liver disease is primarily characterized by diffuse fatty degeneration of hepatocytes. Normally, the liver contains a small amount of fat, but it does not exceed 5% of the liver. Mild fatty liver disease is defined as hepatic steatosis of 5% to 33%; moderate fatty liver disease is defined as 33% to 66%; and severe fatty liver disease is defined as greater than 66%. Numerous studies have shown that FLD, particularly moderate to severe fatty liver disease, increases the risk of liver decompensation and liver cancer, as well as cardiovascular, renal, and metabolic diseases and non-hepatic malignancies.

[0003] Ultrasound imaging is the most commonly used imaging technique for the diagnosis of fatty liver disease. However, its primary drawback is its low sensitivity for detecting initial steatosis. For example, when the percentage of hepatic steatosis is <30%, the sensitivity of ultrasound for detecting fatty liver disease is approximately 60% and the specificity is approximately 77%. Detection is difficult in obese patients (a common finding in patients with fatty liver disease), and interpretation is operator-dependent and subject to significant subjectivity. Because a negative ultrasound result does not exclude mild steatosis, in such cases, alternative, more sensitive methods, computed tomography (CT) and magnetic resonance imaging (MRI), should be used. Both can also detect moderate to severe steatosis, but are expensive, less readily available, and CT examinations involve radiation. Magnetic resonance imaging-derived proton density fat fraction (MRI-PDFF) objectively assesses whole-liver fat content and has been used in clinical trials to assess changes in liver fat content. MRI-PDFF ≥ 5% and 10% indicate significant and moderate-to-severe hepatic steatosis, respectively. However, high cost and limited availability limit its widespread application. Therefore, there is an urgent need to develop new methods for detecting fatty liver that are low-cost, highly accurate, and widely accessible. Summary of the Invention

[0004] To address the above problems, the present invention provides a kit, method of use, and storage medium. The kit enables diagnosis of fatty liver by selecting specific genes and gene sequences, and accurately diagnoses mild, moderate, and severe fatty liver by using different cutoff values.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] A kit for diagnosing fatty liver disease, comprising a reagent suitable for detecting the PNPLA3 gene; using hg38 as a reference genome, the target region of the PNPLA3 gene is selected as chr22:43928769-43928882; the reagent comprises primers and a probe; the primers comprise an upstream primer and a downstream primer, the upstream primer being shown in SEQ ID No: 1, and the downstream primer being shown in SEQ ID No: 2; the probes comprise a first probe and a second probe, the first probe being shown in SEQ ID No: 3, and the second probe being shown in SEQ ID No: 4.

[0007] Furthermore, the first probe and the second probe are in the same reaction system and have different fluorescent reporter groups.

[0008] Furthermore, the kit further comprises at least one of the following: a sample collection container, a blank control module, and a positive control module.

[0009] The present invention also provides a method for using the above-mentioned kit, determining the genotype based on the collected biomarkers; processing age, BMI, genotype and gender, constructing a model and training it; and diagnosing fatty liver based on the model.

[0010] Furthermore, the biomarker is blood or oral swab.

[0011] Furthermore, age, BMI, genotype, and gender were processed, including: Age: less than 30 years old is level 0, not less than 30 years old and less than 40 years old is level 1, not less than 40 years old and less than 50 years old is level 2, not less than 50 years old and less than 60 years old is level 3, and not less than 60 years old is level 4; BMI: less than 18.5 kg / m 2 Grade 0, not less than 18.5kg / m 2 And less than 24kg / m 2 Grade 1, not less than 24kg / m 2 And less than 28kg / m 2 Grade 2, not less than 28kg / m 2 The level is 3; genotype: CC type level 0, CG type level 1, GG type level 2; gender: male level 1, female level 0.

[0012] Furthermore, the first probe is a mutant probe for the target region of the PNPLA3 gene, and the second probe is a wild-type probe for the target region of the PNPLA3 gene. The genotype determination criteria are: GG: Ct of the first probe ≤ 35, and Ct of the second probe > 38; CG: Ct of the first probe ≤ 35, and Ct of the second probe ≤ 35; CC: Ct of the first probe > 38, and Ct of the second probe ≤ 35. If there is no amplification curve for the first and second probes, the Ct value is 45.

[0013] Furthermore, FLscan = -9.0638 + 0.1885 Age - 0.4647 Gender + 2.5617 PNPLA3 + 3.5636 BMI. When the model score is less than -2.293, the judgment result is healthy; when the model score is not less than -2.293 and less than -0.559, the judgment result is mild fatty liver; when the model score is not less than -0.559 and less than 3.832, the judgment result is moderate fatty liver; when the model score is not less than 3.832, the judgment result is severe fatty liver.

[0014] Furthermore, quality control products are included; the quality control products include blank control products and positive control products; the quality control standard of the positive control product is: genotype is CG, Ct of the first probe is ≤35 and Ct of the second probe is ≤35.

[0015] The present invention also provides a computer-readable storage medium, which stores one or more programs. The one or more programs can be executed by one or more processors to implement the method of use based on the above-mentioned kit.

[0016] The beneficial effects brought about by the technical solution provided by the embodiment of the present invention include:

[0017] (1) The present invention achieves the diagnosis of different degrees of fatty liver by detecting the PNPLA3 gene with high sensitivity and specificity.

[0018] (2) Specific primers and probes were set for the PNPLA3 gene, which can be directly amplified without extracting DNA. Compared with the traditional method of extracting DNA and then amplifying the test, it reduces the consumption of reagents, reduces the cost of consumables, reduces the number of operating steps for the experimenter, is fast and reduces the error rate of the experiment.

[0019] (3) Compared with ultrasound testing, qPCR testing of oral swab samples is simple, convenient, low-cost, and highly accessible, and can be performed at home. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The ROC curve of the FLscan model provided in Example 2 of the present invention for diagnosing moderate and severe fatty liver disease;

[0022] Figure 2 This is the ROC curve for diagnosing fatty liver using the FLscan model provided in Example 2 of the present invention;

[0023] Figure 3 This is the ROC curve of the FLscan model provided in Example 2 of the present invention for diagnosing severe fatty liver. DETAILED DESCRIPTION

[0024] The present invention will be further described in detail below by way of specific embodiments. However, it will be understood by those skilled in the art that the following examples are intended only to illustrate the present invention and should not be construed as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or the product instructions are used. Where the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0025] As used herein, the words "comprises," "includes," "has," or any other variations thereof are intended to encompass a non-exclusive inclusion. For example, a process, method, article, or apparatus that comprises listed elements is not necessarily limited to those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0026] Example 1

[0027] A first aspect of the present invention provides a kit for diagnosing fatty liver, comprising reagents suitable for detecting the PNPLA3 gene; using hg38 as a reference genome, the target region of the PNPLA3 gene is selected as chr22:43928769-43928882; the reagents include primers and probes.

[0028] Applicants discovered that the PNPLA3 gene, located on chromosome 22q13.31, is a member of the PNPLA family. The proteins encoded by these genes contain a highly conserved Gly-X-Ser-X-Gly patatin domain at their N-termini, endowing them with nonspecific acyl hydrolase activity, promoting triglyceride hydrolysis. Human PNPLA3 is primarily expressed in hepatocytes, followed by skin and adipose tissue. At the subcellular level, it is primarily localized to the cell membrane and intracellular lipid droplets. PNPLA3 regulates intracellular lipids. Under normal circumstances, PNPLA3 primarily functions as a lipolytic enzyme. However, when lipid synthesis is inhibited, such as when triglyceride lipase is knocked out, PNPLA3 can synthesize triglycerides from triolein. Numerous studies have shown that the I148M variant at locus rs738409 in this gene impairs triglyceride hydrolysis in hepatocytes, increasing their accumulation there, making it a key genetic factor in NAFLD. It is important to note that chr22 selects the positive strand.

[0029] Specifically, the primers include an upstream primer and a downstream primer, the upstream primer is shown as SEQ ID No: 1, and the downstream primer is shown as SEQ ID No: 2.

[0030] Upstream primer: aggaaaattaaaagggtgctct (SEQ ID No: 1)

[0031] Downstream primer: ctgaaggaaggagggataagg (SEQ ID No: 2)

[0032] The probe includes a first probe and a second probe, the first probe is shown as SEQ ID No: 3, and the second probe is shown as SEQ ID No: 4.

[0033] First probe: FAM-tgcttcatgcccttctacagt-MGB (SEQ ID No: 3)

[0034] Second probe: VIC-tgcttcatccccttctacagt-MGB (SEQ ID No: 4)

[0035] The first probe is a mutant probe of the target region of the PNPLA3 gene, and the second probe is a wild-type probe of the target region of the PNPLA3 gene.

[0036] The first probe and the second probe are in the same reaction system and have different fluorescent reporter groups. As shown above, the probes have FAM and VIC fluorescent reporter groups at their 5' ends, respectively, so that the first probe and the second probe react in the same reaction system, thereby improving detection efficiency.

[0037] The kit further comprises at least one of the following: a sample collection container, a blank control module, and a positive control module.

[0038] The sample collection container is used to collect samples, and the samples can be urine, saliva, cerebrospinal fluid, blood (whole blood), plasma, serum, feces, tissue, etc. The embodiment of the present invention uses throat swabs and blood for testing.

[0039] The blank control module is filled with a certain amount of buffer or nucleic acid-free water, and the positive control module is filled with a positive control substance.

[0040] The present invention also provides a computer-readable storage medium, which stores one or more programs. The one or more programs can be executed by one or more processors to implement the method of use based on the above-mentioned kit.

[0041] Example 2

[0042] The present invention also provides a method for using the kit, including:

[0043] S1. Determine genotype based on collected biomarkers.

[0044] Oral swab direct amplification qPCR

[0045] 1. Oral swab sample preparation

[0046] Add 600 μL of Direct PCR Lysis Buffer (RLB15 1X, Cretaceous) or 600 μL of Direct PCR Lysis and Stabilization Buffer (Swab DNA, Cretaceous) to a 2 mL sampling tube. Place the oral swab into the sampling tube containing the preservation solution. Break the swab tip along the break point and retain it in the preservation tube. Secure the cap. Vortex the sampling tube containing the swab for 5-10 seconds. Quickly remove any liquid from the tube wall and cap. The tube is then ready for use as a template.

[0047] Direct PCR Lysis Buffer is used to pretreat test samples, releasing the analyte from its bound state, facilitating detection using in vitro diagnostic reagents or instruments. It can be used to release nucleic acids from samples such as bacterial suspensions, serum, plasma, urine, and swab fluids. The treated sample can be directly used as a PCR template for amplification without the need for heating or other nucleic acid extraction procedures. It can be used for rapid pathogen detection and rapid release of genomic DNA.

[0048] 2. System configuration

[0049] Universal Direct Taqman qPCR Master Mix (2×) (Cretaceous) and PNPLA3 primer probe were thawed at room temperature, mixed thoroughly, and then rapidly centrifuged for 15 seconds. The PNPLA3 oral swab direct amplification reaction mixture was prepared according to Table 1.

[0050] Table 1 Preparation of PNPLA3 oral swab direct amplification reaction mixture system

[0051]

[0052] In the table, PNPLA3-F is the upstream primer of the PNPLA3 gene, PNPLA3-R is the downstream primer of the PNPLA3 gene, PNPLA3-WP is the wild-type probe of the PNPLA3 gene, and PNPLA3-MP is the mutant-type probe of the PNPLA3 gene.

[0053] Thoroughly mix the PNPLA3 buccal swab direct amplification reaction mixture, centrifuge, and add 11.6 μL to the corresponding reaction wells of a 96-well plate (or 8-well strip). Add 4 μL of template to the reaction wells containing 11.6 μL of the PNPLA3 buccal swab direct amplification reaction mixture, and bring the total volume up to 20 μL with 4.4 μL of nuclease-free water. Add 2 μL each of the positive control (PC) (gDNA extracted from A375 cells) and the blank control (NTC) to the reaction wells containing 11.6 μL of the PNPLA3 buccal swab direct amplification reaction mixture, and bring the total volume up to 20 μL with 6.4 μL of nuclease-free water.

[0054] 3. Reaction procedure

[0055] Set up the reaction program according to Table 2 (Roche Cobas z480):

[0056] Table 2 qPCR reaction procedure

[0057]

[0058] Analyze the data using the Abs Quant / 2nd Derivative Max mode. If there are no amplification curves for the FAM and VIC channels, the default Ct value is 45.

[0059] 4. Quality Control

[0060] (1) The FAM and VIC channels of the blank control NTC should have no amplification curve.

[0061] (2) Calculate the Ct values ​​of the FAM and VIC channels of the positive control substance PC. The quality control standards should meet the requirements shown in Table 3.

[0062] (3) Quality control (1) and (2) should be met at the same time, otherwise the test results will be invalid and should be retested.

[0063] Table 3 Quality control standards for positive controls

[0064]

[0065] 5. Genotype determination

[0066] The Ct values ​​of the FAM and VIC channels of the samples were calculated. If there were no amplification curves for the FAM and VIC channels, the default Ct value was 45. The genotype of the samples was determined according to Table 4.

[0067] Table 4 Sample genotype determination criteria

[0068]

[0069] S2 processes age, BMI, genotype, and gender, builds a model, and performs training.

[0070] Age, gender, PNPLA3 and BMI data were standardized according to the rules in Table 5:

[0071] Table 5 Data normalization rules

[0072]

[0073] The present invention was used to detect oral swab samples from 35 patients with moderate and severe fatty liver disease, 23 patients with mild fatty liver disease, and 85 healthy people.

[0074] The test samples are divided into training set and validation set in a ratio of approximately 2:1. The sample situation of the training set and validation set is shown in Table 6, and the specific samples are shown in Table 7.

[0075] Table 6: Training set and validation set division

[0076] training set Validation set total Severe fatty liver 3 1 4 Moderate fatty liver 22 9 31 Mild fatty liver 14 9 23 Healthy people 57 28 85 total 96 47 143

[0077] Table 7 Training set and validation set data

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] S3. Model-based diagnosis of fatty liver disease.

[0085] The sample data of the training set is used to build a logistic regression model. The logistic regression model FLscan is developed using the logistic regression model package {glmnet} of R version 4.3.2. The model formula is:

[0086] FLscan=-9.0638+0.1885Age-0.4647Gender+2.5617PNPLA3+3.5636BMI

[0087] When the model score is less than -2.293, the judgment result is healthy; when the model score is not less than -2.293 and less than -0.559, the judgment result is mild fatty liver; when the model score is not less than -0.559 and less than 3.832, the judgment result is moderate fatty liver; when the model score is not less than 3.832, the judgment result is severe fatty liver.

[0088] When analyzing model performance, the following formula is used:

[0089] Sensitivity (%) = true positive / [true positive + false negative]

[0090] Specificity (%) = true negative / [true negative + false positive]

[0091] like Figure 1 As shown in the figure, the AUC (area under the curve) of the model in the training set is 0.930, and the optimal cutoff is -0.559. The sensitivity of the model in comprehensively judging moderate and severe fatty liver is 22 / (22+3)=88%, and the specificity is 64 / (64+7)=90.1%. Figure 1 As shown, the performance of the logistic regression model FLscan was verified using the validation set data. The AUC of the model was 0.939, the sensitivity of the model for comprehensively judging moderate or severe fatty liver was 10 / (10+0)=100%, and the specificity was 31 / (31+6)=83.8%.

[0092] like Figure 2 and 3At different cutoff values, the FLscan model demonstrated good diagnostic performance for both fatty liver (including mild, moderate, and severe) and non-fatty liver (healthy), as well as severe fatty liver and non-severe fatty liver (including mild, moderate, and healthy). In the training set, when the cutoff was -2.293, the sensitivity for determining fatty liver (including mild, moderate, and severe) was 31 / (31+8) = 79.5%, the specificity was 47 / (47+10) = 82.5%, and the AUC was 0.839. When the cutoff was 3.832, the sensitivity for determining severe fatty liver was 3 / (3+0) = 100%, the specificity was 91 / (91+2) = 97.8%, and the AUC was 0.978. In the above validation set, when cut off = -2.293, the sensitivity for determining fatty liver (including mild, moderate and severe) was 17 / (17+2) = 89.5%, the specificity was 21 / (21+7) = 75%, and the AUC was 0.835; when cut off = 3.832, the sensitivity for determining severe fatty liver was 1 / (1+0) = 100%, the specificity was 46 / (46+0) = 100%, and the AUC was 1.

[0093] Example 3

[0094] S1. Determine genotype based on collected biomarkers.

[0095] Blood direct amplification qPCR

[0096] 1. Blood sample preparation

[0097] Add 20 μL of Blood Nucleic-Acid Release Buffer (Cretaceous) to an 8-well PCR strip (or 96-well PCR plate); add an equal volume (20 μL) of the blood sample to be tested to the Blood Nucleic-Acid Release Buffer, vortex to mix or slowly pipette 3-5 times, and briefly centrifuge before use as a template. Add the template to the mix rather than to the tube wall.

[0098] 2. System configuration

[0099] Blood-Direct SNP Genotyping qPCR Enhanced Master Mix II (2×) (Cretaceous) and PNPLA3 primer probe were thawed at room temperature, mixed thoroughly, and then rapidly centrifuged for 15 seconds. The PNPLA3 blood direct amplification reaction mixture was prepared according to Table 8.

[0100] Table 8 Preparation of PNPLA3 blood direct amplification reaction mixture system

[0101] Reagents Volume required for 1 reaction (μL) Blood-Direct SNP Genotyping qPCR Enhanced 10 PNPLA3-F (10 μM) 0.5 PNPLA3-R (10 μM) 0.5 PNPLA3-WP (10 μM) 0.3 PNPLA3-MP (10 μM) 0.3

[0102] Thoroughly mix the PNPLA3 blood direct amplification reaction mixture, centrifuge, and add 11.6 μL to each corresponding reaction well of a 96-well plate (or 8-well strip). Add 1 μL of template to the reaction well containing 11.6 μL of the PNPLA3 blood direct amplification reaction mixture, and bring the total volume up to 20 μL with 7.4 μL of nuclease-free water. Add 2 μL each of the positive control, PC (gDNA extracted from A375 cells), and the blank control, NTC, to the reaction well containing 11.6 μL of the PNPLA3 blood direct amplification reaction mixture, and bring the total volume up to 20 μL with 6.4 μL of nuclease-free water.

[0103] The reaction procedure, quality control, and genotype determination were the same as those for the oral swab direct amplification qPCR in Example 2.

[0104] Steps S2 and S3 are the same as those in Example 2.

[0105] The blood sample and the oral swab sample in Example 2 were from the same source.

[0106] The test results of the blood samples are shown in the table below, and the consistency with the results of the oral swab samples is 100%, as shown in Table 9.

[0107] Table 9 Test results of Example 3 and Example 2

[0108]

[0109]

[0110]

[0111] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A computer-readable storage medium, characterized in that The computer-readable storage medium stores one or more programs, which can be executed by one or more processors to implement a method for using the kit, wherein the method is for non-disease diagnosis and treatment purposes. The kit includes reagents suitable for detecting the PNPLA3 gene; hg38 is used as a reference genome, and the target region of the PNPLA3 gene is selected as chr22:43928769-43928882; the reagents include primers and probes; the primers include an upstream primer and a downstream primer, the upstream primer is shown in SEQ ID No: 1, and the downstream primer is shown in SEQ ID No: 2; the probes include a first probe and a second probe, the first probe is shown in SEQ ID No: 3, and the second probe is shown in SEQ ID No: 4; The kit further comprises at least one of the following: a sample collection container, a blank control module, and a positive control module; The method comprises: Determine genotype based on collected biomarkers; Process age, BMI, genotype, and gender, build a model, and train it; Model-based diagnosis of fatty liver disease; Age, BMI, genotype, and sex were processed, including: Age: Level 0 for those under 30 years old, Level 1 for those not less than 30 years old and less than 40 years old, Level 2 for those not less than 40 years old and less than 50 years old, Level 3 for those not less than 50 years old and less than 60 years old, Level 4 for those not less than 60 years old; BMI: less than 18.5 kg / m 2 Grade 0, not less than 18.5kg / m 2 And less than 24kg / m 2 Grade 1, not less than 24kg / m 2 And less than 28kg / m 2 Grade 2, not less than 28kg / m 2 Level 3; PNPLA3 genotype: CC type at rs738409 is ranked as 0, CG type at rs738409 is ranked as 1, and GG type at rs738409 is ranked as 2; Gender: male is ranked as 1, female is ranked as 0; The first probe is a mutant probe of the target region of the PNPLA3 gene, and the second probe is a wild-type probe of the target region of the PNPLA3 gene; The criteria for determining the genotype are: GG: Ct of the first probe ≤ 35, and Ct of the second probe > 38; CG: Ct of the first probe ≤ 35, and Ct of the second probe ≤ 35; CC: Ct of the first probe > 38, and Ct of the second probe ≤ 35; If there is no amplification curve for the first and second probes, the Ct value is 45; The model is: FLscan = -9.0638 + 0.1885 Age - 0.4647 Gender + 2.5617 PNPLA3 genotype + 3.5636 BMI When the model score is less than -2.293, the result is judged as healthy; When the model score is not less than -2.293 and less than -0.559, the result is judged as mild fatty liver; When the model score is not less than -0.559 and less than 3.832, the result is judged as moderate fatty liver; When the model score is not less than 3.832, the result is severe fatty liver; The quality control standard of the positive control module is: genotype is CG, Ct of the first probe is ≤35, and Ct of the second probe is ≤35.

Citation Information

Patent Citations

  • Non-alcoholic fatty liver susceptibility relevant gene detecting kit

    CN110079597A