A SNP molecular marker related to salt tolerance in wheat and its application

Abstract

The invention discloses a SNP molecular marker related to wheat salt tolerance and its application, and belongs to the technical field of agricultural molecular biology. The invention obtains a SNP molecular marker related to wheat salt stress trait by using a whole genome association analysis method, and the SNP molecular marker is located in the 3'UTR region of the TraesCS2B02G375100 gene of wheat chromosome 2B, the base T / C at position 536639185 of chromosome 2B, wherein CC is a salt-tolerant genotype and TT is a salt-sensitive genotype; it can be used as an auxiliary selection marker for salt tolerance traits in the wheat breeding process, can effectively improve the accuracy of wheat variety selection, and accelerate the variety breeding process.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural molecular biology, and in particular to a SNP molecular marker related to salt tolerance of wheat and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is an important source of protein and carbohydrates for humans. Crop yields are affected by a variety of biological and abiotic factors; salt stress is one of the important abiotic limiting factors. At present, more than 20% of my country's arable land is affected by salinization, which seriously threatens my country's food production security. Breeding salt-tolerant varieties is the most economical and effective way to utilize and control the occurrence of salinization. Accelerating the process of salt-tolerant breeding is of great significance to increasing crop yields.

[0003] DNA molecular markers refer to DNA fragments that can directly reflect the difference characteristics between the genomes of different biological individuals or populations. Molecular markers are co-dominant, which is very convenient for the selection of recessive traits. Molecular markers do not affect the expression of target traits and are not linked to undesirable traits; the detection method is simple and rapid. With the continuous development of high-throughput sequencing technology, the increase in sequencing speed and the reduction in sequencing costs, and the rapid development of molecular biology, dozens of molecular markers have been developed so far, including (RFLP, AFLP, SSR, SNP). Among them, simple sequence repeats (SSR) are widely used. SSR refers to a short and repetitive nucleotide sequence that exists in the entire genome of eukaryotic organisms, generally consisting of 2-6 nucleotides as a repeating unit. However, the development and synthesis of new SSR primers are high-investment and difficult. Single nucleotide polymorphism (SNP) mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. Compared with SSR, SNP has the advantages of being widely distributed in the individual genome, a large number, easy genotyping (SNP dimorphism), and suitable for rapid and large-scale screening.

[0004] Due to the widespread use of SNPs, genome-wide association analysis (GWAS) based on SNPs has been widely used to detect genetic loci of important agronomic traits of crops. Single nucleotide polymorphisms (SNPs) are widely present in the wheat genome, which can meet the requirements of GWAS for large samples and high-density markers. Compared with traditional QTLs, GWAS has higher resolution and can more accurately identify and locate new genes. Peng et al. used 118 wheat germplasm resources as experimental materials and mined 14 SNP sites related to wheat quality based on 55K chip data. Wu et al. used a natural population composed of 404 wheat germplasm resources as experimental materials, combined with phenotypic data measured by 11 seed vitality-related traits (germination potential, germination rate and seed vitality, etc.), and mined 28 SNP sites related to wheat seed vitality. Qu et al. used 183 spring wheat natural populations as experimental materials, combined with 55K gene chips to conduct genome-wide association analysis on the drought resistance coefficient of root traits, and mined a total of 54 SNP sites related to drought resistance. However, there are few studies on SNP loci related to wheat salt tolerance. Therefore, finding a SNP related to wheat salt tolerance and developing KASP markers will provide an important technical basis for reducing the complexity and cost of detecting important agronomic traits of wheat and improving the efficiency of molecular marker-assisted breeding for wheat salt tolerance. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to salt tolerance of wheat and its application, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a SNP molecular marker related to salt tolerance of wheat. The SNP molecular marker is located in the 3'UTR region of the TraesCS2B02G375100 gene on wheat chromosome 2B, at position 536639185 of chromosome 2B, and has a base polymorphic site T / C.

[0008] The second technical solution of the present invention is a specific primer, comprising upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0009] The third technical solution of the present invention is a product for identifying salt tolerance of wheat, comprising the specific primers.

[0010] A fourth technical solution of the present invention is the application of the SNP molecular marker or the specific primer in wheat breeding.

[0011] The fifth technical solution of the present invention is a method for identifying the salt tolerance of wheat using the SNP molecular marker, extracting the genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and the salt tolerance of wheat plants with a genotype of CC is significantly higher than that of individuals with a genotype of TT.

[0012] The sixth technical solution of the present invention is a method for screening salt-tolerant wheat, which comprises extracting genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and the salt tolerance of wheat plants with genotype CC is significantly higher than that of individuals with genotype TT.

[0013] Based on the above technical solution, the present invention has the following technical effects:

[0014] The present invention obtains a SNP molecular marker related to the salt stress trait of wheat by using a whole genome association analysis method. The SNP molecular marker is located in the 3'UTR region of the TraesCS2B02G375100 gene on wheat chromosome 2B, at the base T / C at position 536639185 of chromosome 2B, wherein CC is a salt-tolerant genotype and TT is a salt-sensitive genotype. The SNP molecular marker can be used as an auxiliary selection marker for the salt-tolerant trait in the wheat breeding process, can effectively improve the accuracy of wheat variety selection, and accelerate the variety breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 This is a Manhattan plot of the whole genome association analysis of wheat salt tolerance in an embodiment of the present invention, where the horizontal axis represents the position of each SNP on the chromosome; the vertical axis represents the negative logarithm of the P value of each SNP site under the MLM model with the base 10. RFL_Contig2925_631 is a significant SNP site.

[0017] Figure 2 This is a QQ diagram of the whole genome association analysis related to wheat salt tolerance in an embodiment of the present invention. The horizontal axis represents the negative logarithm of the expected SNP site P value with base 10, and the vertical axis represents the negative logarithm of the actual SNP site P value with base 10.

[0018] Figure 3 This is the KASP genotyping diagram of the embodiment of the present invention, the red dots represent the TT genotype, the blue dots represent the CC genotype, and the green dots represent the TC genotype.

[0019] Figure 4This is a violin analysis diagram of the D values ​​of three wheat genotypes in the embodiment of the present invention. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0026] The embodiment of the present invention provides a SNP molecular marker related to salt tolerance of wheat. The SNP molecular marker is located in the 3'UTR region of the TraesCS2B02G375100 gene on wheat chromosome 2B, located at position 536639185 of chromosome 2B, and has a base polymorphic site T / C.

[0027] The embodiment of the present invention also provides specific primers, including upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and a downstream primer as shown in SEQ ID NO.4.

[0028] The embodiment of the present invention also provides a product for identifying salt tolerance of wheat, including the specific primers.

[0029] The embodiment of the present invention also provides the application of the SNP molecular marker or the specific primer in wheat breeding.

[0030] The embodiment of the present invention also provides a method for identifying salt tolerance of wheat using the SNP molecular marker, extracting the genomic DNA of the wheat to be tested, detecting the genotype of the SNP molecular marker, and the salt tolerance of wheat plants with genotype CC is significantly higher than that of individuals with genotype TT.

[0031] The embodiment of the present invention also provides a method for screening salt-tolerant wheat, wherein the genomic DNA of the wheat to be tested is extracted, and the genotype of the SNP molecular marker is detected. The salt tolerance of wheat plants with the genotype CC is significantly higher than that of individuals with the genotype TT.

[0032] The present invention provides a method for identifying SNP molecular markers of wheat salt tolerance, comprising the following steps:

[0033] (1) A GWAS population was constructed by using 275 wheat materials from different regions. The population was planted in 0.3% salt ponds and control ponds to identify the heading date, plant height, single plant yield, 1000-grain weight, number of grains per ear, dry matter weight, and sub-ear node length of the natural population;

[0034] Because the measurement units of different traits are different, different degrees of variation will be caused. Therefore, in order to prevent the abnormal change of a single trait from affecting the overall result, it is necessary to first calculate the salt tolerance coefficient of a certain indicator, and then use the membership function method to expand the salt tolerance coefficient of each material to the closed interval [0,1], so that different indicator data can be calculated uniformly. The salt tolerance index of each phenotypic trait of each material is calculated using formula (I), the membership function value is calculated using formula (II), and the D value is calculated using formula (III). The D value is used as the phenotypic data for GWAS analysis:

[0035] ① Salt tolerance index = (salt treatment value / control value) × 100%;

[0036] ②U(X j )=(X j -X jmin ) / (X jmax -X jmin ), j=1, 2, 3, 4, 5...;

[0037]

[0038] (2) Fresh young leaves of wheat were used as samples for DNA extraction, and the genomic DNA was digested and connected with adapters to construct a genomic sequencing library. The sequencing library was subjected to double-end sequencing using the HiSeq2500 sequencing platform;

[0039] (3) Perform quality control and filtering on the sequencing data, compare the qualified data to the Chinese Spring reference genome sequence, and obtain SNP information in the population;

[0040] (4) The obtained SNP information was used to perform genome-wide association analysis using the mixed linear model MLM (P+K) to obtain SNP molecular markers that were significantly associated with wheat salt tolerance.

[0041] The obtained SNP information was used to perform genome-wide association analysis using the mixed linear model MLM (P+K) to obtain SNP molecular markers that were significantly associated with wheat salt tolerance.

[0042] Example 1

[0043] 1. Mining of salt stress-related SNP markers and development of KASP markers in wheat under salt stress conditions

[0044] 1.1 Constructing natural groups

[0045] A total of 275 wheat germplasm resources from home and abroad were collected to form a natural population. This population has a wide range of sources, rich genetic variation, and large differences in salt tolerance, making it suitable for genome-wide association analysis of salt tolerance-related traits.

[0046] Table 1275 wheat germplasm information

[0047]

[0048]

[0049] 1.2 Experimental design

[0050] Salt pond test: In 2019 / 2020, the test was conducted in an artificial salt pond (0.3% NaCl) at the Qianying Experimental Station of Cangzhou Academy of Agricultural and Forestry Sciences (38°13′N, 116°44′E, 8.2m above sea level). The size of the salt pond is 6m×2m×2m (length×width×depth). Except for the flow of water and nutrients between the upper mouth and the outer boundary, the rest is exchanged with the surrounding soil anhydrous salt (organic matter 11.24g / kg, total nitrogen 1.28g / kg, available phosphorus 35.37mg / kg, available potassium 211.45mg / kg, total salt content 0.3%, pH 9.24). Each material was planted in 2 rows, with a row length of 1m and a row spacing of 0.25m. The crops were randomly grouped and repeated 3 times. The sowing date was October 7, and other management was the same as the field.

[0051] Control salt pond test: In 2019 / 2020, the test was conducted in the control pond of Qianying Experimental Station of Cangzhou Academy of Agricultural and Forestry Sciences. The size of the control pond is 6m×2m×2m (length×width×depth). Except for the flow of water and nutrients between the upper mouth and the outer boundary, the rest is exchanged with the surrounding soil anhydrous salt (organic matter 11.24g / kg, total nitrogen 1.28g / kg, available phosphorus 35.37mg / kg, available potassium 211.45mg / kg, pH 9.24). Each material was planted in 2 rows, with a row length of 1m and a row spacing of 0.25m. The crops were randomly grouped and repeated 3 times. The sowing date was October 7, and other management was the same as the field.

[0052] 1.3 Identification of salt tolerance-related traits in wheat

[0053] After the wheat matures, it is tested to identify the heading period, plant height, single plant yield, 1000-grain weight, number of grains per ear, dry weight, and length of nodes below the ear of the natural population.

[0054] Because the measurement units of different traits are different, different degrees of variation will be caused. Therefore, in order to prevent the abnormal change of a single trait from affecting the overall result, it is necessary to first calculate the salt tolerance coefficient of a certain indicator, and then use the membership function method to expand the salt tolerance coefficient of each material to the closed interval [0,1], so that different indicator data can be calculated uniformly. The salt tolerance index of each material phenotypic trait is calculated using formula (I), the membership function value is calculated using formula (II), and the D value is calculated using formula (III). The D value is used as the phenotypic data for GWAS analysis. Cluster analysis of the D value was performed and divided into 5 categories, namely: D values ​​greater than 0.455 are highly salt-tolerant materials; 0.399-0.455 are salt-tolerant materials; 0.350-0.399 are moderately salt-sensitive materials; 0.310-0.350 are sensitive materials; D values ​​less than 0.310 are highly sensitive materials. The calculation results of the D values ​​of 275 wheat samples are shown in Table 2.

[0055] (i) Salt tolerance index = (measured value of salt treatment / measured value of control) × 100%;

[0056] (2) U(Xj)=(Xj-Xjmin) / (Xjmax-Xjmin), j=1, 2, 3, 4, 5...;

[0057]

[0058] Table 2 D values ​​of 275 wheat samples

[0059]

[0060]

[0061]

[0062]

[0063] 1.4 Genome-wide association analysis of traits related to salt tolerance in wheat

[0064] The salt tolerance-related traits were used as relevant identification indicators, and the mixed linear model (PCA+K) in the GAPIT package was used for genome-wide association analysis. The P value threshold was calculated according to the method described by Li et al. (P = 1 / n, n = the total number of SNPs used), and the criterion for identifying significant SNPs was -log 10 P>4.

[0065] The Manhattan plot was drawn using the CMplot (https: / / cran.r-project.org / web / packages / CMplot / ) package in R language to visualize the sites. Figure 1 .

[0066] The results showed that the 3'UTR region of the TraesCS2B02G375100 gene located on chromosome 2B of wheat, at position 536639185, contained a base polymorphism site T / C, and this SNP site was significantly associated with the D value.

[0067] The sequence of the SNP molecular marker is shown in SEQ ID NO.1:

[0068] SEQ ID NO.1: TGGTAAGACCAAACGCAAAGCTCAAATTAGCATCAACAAGT CACTTCGATTGCATCAAATTCATGAAAGTGTGCGGCGATATGGTAGGCAATGGAG CCAC [C] GAGCCCCTTTGCTAAGTAACAACTACAAAATTCCAATAACATAAGAAAC CACGACACAAGCGCCTACTGCAGGACCCTCCCTCTGACTTATATGATGCCG.

[0069] Note: The underlined positions are base polymorphic sites.

[0070] 1.5KASP marker development and primer design

[0071] The KASP primer set was designed based on RFL_Contig2925_631, including 2 specific primers and 1 universal primer. Specific primer:

[0072] WWW-KASP-F15'-3' (SEQ ID NO.2): GAAGGTGACCAAGTTCATGCTTGTTACTTAGCAAAGGGGCTCG;

[0073] Specific primer WWW-KASP-F2 5′-3′ (SEQ ID NO. 3): GAAGGTCGGAGTCAACGGATTTTGTTACTTAGCAAAGGGGCTCA;

[0074] Universal primer WWW-KASP-R 3'-5' (SEQ ID NO. 4): CATGAAAGTGTGCGGC GATATGGTA.

[0075] Specific primers were connected to FAM and HEX fluorescent linker sequences respectively.

[0076] 1.5.1 DNA quality inspection: Test the purity and integrity of the 275 DNA samples in Table 2.

[0077] a) Basic purity test: Spectrophotometer is used to measure the purity and concentration of DNA samples. 260 / 280: 1.8-2.2; 260 / 230>=1.0.

[0078] b) DNA integrity: DNA integrity was determined by agarose gel electrophoresis, with the main DNA band being evident.

[0079] 1.5.2 DNA dilution: DNA of samples that pass the quality inspection is diluted to a concentration range of 5-50ng.

[0080] 1.5.3 PCR reaction system is shown in Table 3.

[0081] Table 3 KASP detection PCR reaction system

[0082]

[0083] After the DNA is packaged into the PCR reaction container, it needs to be dried. Different systems use different drying methods. The LGC platform places the packaged DNA in an oven at 65°C for 30 minutes until the DNA is completely dry; the Doulgas system uses two built-in drying modules of Nexar to complete DNA drying.

[0084] 1.5.4PCR reaction procedure:

[0085] a. Denaturation at 94°C for 15 mins;

[0086] b. Enrichment of template DNA containing SNP sites;

[0087] 1) Denaturation at 94°C for 20 seconds;

[0088] 2) Annealing / extension: 61-55°C for 60 seconds (0.6°C lowered in each cycle);

[0089] 3) Repeat 10 times.

[0090] (4) Fluorescence signal amplification

[0091] 1) Denaturation at 94°C for 20 seconds;

[0092] 2) Annealing / extension at 55°C for 60 seconds;

[0093] 3) Repeat 26 times.

[0094] (5) Optional step: If the typing is not obvious, add 3 more cycles for amplification

[0095] 1) Denaturation at 94°C for 20 seconds;

[0096] 2) Annealing / extension at 57°C for 60 seconds;

[0097] 3) Repeat 3 times.

[0098] (6) Reading of fluorescence signals

[0099] After the KASP detection PCR reaction program is completed, the 96-well plate is placed on the Omega fluorescent signal reader and Araya to convert the fluorescent signal into analyzable values, and then the genotype analysis is performed using the analysis software KrakenTM provided by LGC.

[0100] 1.6 KASP typing and haplotype analysis

[0101] The specific genotypes of 275 materials were detected by KASP ( Figure 3 ), based on the phenotypic D value data of 275 materials, of which 73 were CC type with D ≥ 0.439; 85 were TC type with 0.360 ≤ D < 0.400; and the largest number of TT types was 117 with D < 0.360 (see Table 2).

[0102] The present invention utilizes 275 excellent germplasm resources from all over the country, which are rich and diverse in types.

[0103] Example 3

[0104] The 94 germplasm resources in Table 4 were used to verify the efficiency of KASP markers, detect the DNA of wheat germplasm resources, and calculate their D values, and then group them according to genotypes. The violin plot of haplotype analysis was drawn using Prism software ( Figure 4 ), ***P<0.001, CC is the salt-tolerant genotype, and TT is the salt-sensitive genotype.

[0105] Table 4 D values ​​of 94 wheat germplasm resources

[0106]

[0107]

[0108] The efficiency of KASP marker was verified based on 94 germplasm resources in Table 4. Among them, 21 CC types had D values ​​greater than 0.40; 15 TC types had D values ​​less than 0.4 and greater than 0.36; and 58 TT types had D values ​​less than 0.36. The accuracy of this marker in selecting salt-tolerant materials was 95%.

[0109] The above results indicate that the SNP molecular markers provided by the present invention can be applied to molecular marker-assisted selection in wheat salt tolerance genetic breeding to improve the accuracy of selection.

[0110] In summary, the present invention obtains a SNP molecular marker related to wheat salt stress traits, which is located in the 3'UTR region of the TraesCS2B02G375100 gene on wheat chromosome 2B, at position 536639185 of chromosome 2B, and has a base polymorphic site T / C, wherein CC is a salt-tolerant genotype and TT is a salt-sensitive genotype.

[0111] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of specific primers in wheat salt tolerance related breeding, characterized in that, The genotype of SNP molecular markers in the tested wheat genomic DNA was detected using specific primers. The salt tolerance of wheat plants with CC genotype was significantly higher than that of individuals with TT genotype. The specific primers include upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3 and downstream primers as shown in SEQ ID NO.4; The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G375100 The 3'UTR region of the gene is located at position 536639185 of chromosome 2B, and its bases are T / C.

2. A method for identifying salt tolerance of wheat, characterized in that: The genotype of the SNP molecular marker in the wheat genome DNA was detected. The salt tolerance of wheat plants with genotype CC was significantly higher than that of individuals with genotype TT. The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G375100 The 3'UTR region of the gene is located at position 536639185 of chromosome 2B, and its bases are T / C.

3. A method for screening salt-tolerant wheat, characterized in that: The genotype of the SNP molecular marker in the wheat genome DNA was detected. The salt tolerance of wheat plants with genotype CC was significantly higher than that of individuals with genotype TT. The SNP molecular marker is located on wheat chromosome 2B TraesCS2B02G375100 The 3'UTR region of the gene is located at position 536639185 of chromosome 2B, and its bases are T / C.

Images