Genetic transformation methods of Atractylodes lancea roots and application of ALTPSa47 gene in regulating biosynthesis of volatile oil from Atractylodes lancea

Abstract

The present invention belongs to the field of plants and their applications, and specifically discloses a method for genetic transformation of Atractylodes lancea roots and the application of the ALTPSa47 gene in regulating the biosynthesis of Atractylodes lancea volatile oil. The transformation method comprises the following steps: preparation of explants; preparation of Agrobacterium; infection; co-cultivation; and verification of gene function. The invention has the advantages of high efficiency, stability, broad spectrum, and no need for tissue culture conditions. The present invention also discloses a key gene ALTPSa47 for the biosynthesis of Atractylodes lancea volatile oil, the nucleotide sequence of which is shown in SEQ ID NO: 1; the sequence length is 2488 bp. The amino acid sequence expressed is shown in SEQ ID NO: 2; the sequence length is 546 aa. This creates conditions for cultivating new Atractylodes lancea resources with high yield of volatile oil and promoting the molecular improvement of Atractylodes lancea, and lays a solid foundation for the genetic transformation of Atractylodes lancea and the research on genetic engineering and metabolic engineering.

Description

Technical Field

[0001] The invention belongs to the field of plants and their application, and particularly relates to a method for genetic transformation of atractylodes lancea roots and application of an ALTPSa47 gene in regulating biosynthesis of atractylodes lancea volatile oil. Background Art

[0002] Atractylodes lancea is a traditional and major medicinal material with a long history of use in my country. It is a perennial herbaceous plant of the genus Atractylodes in the family Asteraceae. The dried rhizomes of Atractylodes lancea (Thunb.) DC. and Atractylodes chinensis (DC.) Koidz. are included in the Pharmacopoeia of the People's Republic of China. They have the effects of drying dampness and strengthening the spleen, dispelling wind and cold, and improving eyesight. They are used to treat dampness blocking the middle jiao, edema, rheumatic pain, colds, etc. Modern pharmacological studies have shown that Atractylodes lancea plays an important role in anti-tumor, anti-inflammatory, antibacterial and antiviral, antioxidant, digestive system, nervous system, etc.

[0003] Atractylodes volatile oil, as the main active ingredient of Atractylodes lancea, has pharmacological effects such as anti-tumor, anti-inflammatory, antibacterial and antiviral.

[0004] The research results showed that Atractylodes lancea volatile oil promoted the release of cytochrome c by inducing the activation of caspase-3 and caspase-9 and the cleavage of poly(ADP-ribose) polymerase; inhibited the proliferation of human umbilical vein endothelial cells and capillary formation; and caused cancer cells to remain in the S phase or G0 / G1 phase of the cell cycle, thereby inhibiting the proliferation of tumor cells.

[0005] It exerts an anti-inflammatory effect by attenuating the production of nitric oxide and inflammatory cytokines induced by lipopolysaccharide and inhibiting the expression of inducible nitric oxide synthase and cyclooxygenase-2; promoting the expression of autophagy genes Beclin 1 and P62 mRNA in colon tissue and marker proteins LC3Ⅰ and LC3Ⅱ on the autophagosome membrane; promoting the cell viability of human colon epithelial cells; increasing the level of anti-inflammatory factor IL-4, and reducing the expression of pro-inflammatory factors IL-6, IL-8 and TNF-α.

[0006] It inhibits the formation of Helicobacter pylori (H.pylori) biofilm; destroys the bacterial structure and changes the permeability of the cell membrane, causing the intracellular substances of the bacteria to leak out, causing the bacteria to rupture and die; inhibits the expression of the α-hemolysin virulence gene (Hla) and its regulatory gene (AgrA) of Staphylococcus aureus, and exerts an antibacterial effect. Atractylodes lancea and other volatile oil compounds in Atractylodes lancea have antiviral effects. Atractylodes lancea can reduce lung damage induced by influenza A virus (IAV), reduce serum interleukin (IL)-6, tumor necrosis factor-α and IL-1β, and increase interferon-β (IFN-β) levels.

[0007] In recent years, the use of Atractylodes lancea has been increasing. With the depletion of wild resources, it mainly relies on artificial cultivation. However, the quality of artificial cultivation has generally declined. Using biotechnologies such as genetic and metabolic engineering to increase the content of active ingredients in Atractylodes lancea is an important measure to solve its quality. However, due to the unknown biosynthetic pathways of active ingredients in Atractylodes lancea and the incomplete genetic transformation system, this has largely restricted the in-depth development of research on functional genes and synthetic biology of Atractylodes lancea. Therefore, we hope to study the biosynthesis of active ingredients through the excavation of key genes of active ingredients and the establishment of a genetic transformation system, thereby improving the quality of Atractylodes lancea.

[0008] TPSs (Terpene synthases) have been reported to be key enzymes in the biosynthesis of terpenoids in many medicinal plants, and they are also key enzymes in the biosynthesis of sesquiterpenoids in the volatile oil of Atractylodes lancea. Agrobacterium-mediated genetic transformation has been widely used in plant transgenics due to its advantages such as simplicity, high efficiency, low cost and good reproducibility. Summary of the invention

[0009] In view of the deficiencies in the prior art, the first object of the present invention is to provide the Atractylodes lancea ALTPSa47 gene and its application in regulating the biosynthesis of volatile oils. By introducing the screened key gene ALTPSa47 for the biosynthesis of volatile oils of Atractylodes lancea into Atractylodes lancea, transgenic positive roots are obtained, and the content of volatile oils such as germaene B, β-elemene, α-caryophyllene, β-caryophyllene, and atractylodesone in the roots of Atractylodes lancea is significantly increased.

[0010] To achieve the above-mentioned purpose, the technical scheme adopted by the present invention includes: the nucleotide sequence of the Atractylodes lancea ALTPSa47 gene is shown in SEQ ID NO: 1, and the sequence length is 2488bp; the amino acid sequence encoded by the Atractylodes lancea ALTPSa47 gene is shown in SEQ ID NO: 2; the sequence length is 546aa.

[0011] The second purpose of the present invention is to provide a method for genetic transformation of Atractylodes lancea roots; by establishing a method for rapid verification of Atractylodes lancea gene function, the screened Atractylodes lancea volatile oil biosynthesis key gene ALTPSa47 is introduced into Atractylodes lancea to obtain transgenic positive roots, which should be more widely used in improving the quality of Atractylodes lancea.

[0012] To achieve the above object, the technical solution adopted by the present invention includes:

[0013] A method for genetic transformation of atractylodes lancea roots, comprising the following steps:

[0014] (1) Explant preparation:

[0015] Atractylodes lancea seeds from different regions were collected for planting. The seedlings were dug out three weeks later, and the soil and other debris on the roots were washed off with water. The Atractylodes lancea seedlings were cut off with a scalpel, and only the above-ground part and the rhizome connected to the above-ground part were retained as explants for infection.

[0016] (2) Preparation of Agrobacterium

[0017] The plasmid with the reporter gene is transformed into the chemically competent cells of Agrobacterium rhizogenes by chemical transformation method to obtain the transformed Agrobacterium rhizogenes; the transformed Agrobacterium rhizogenes is subjected to liquid activation culture, a single clone is picked, and shake-cultured in a liquid culture medium at 28° C. overnight, and PCR detection is performed to obtain the engineered bacteria; the engineered bacteria are plated and cultured in the dark at 28° C. until the culture medium is covered with a uniform layer of colonies to obtain Agrobacterium plaques, and part of the plaques are scraped into the infection solution (i.e., the new liquid culture medium), and the OD600 is adjusted to 0.6-0.8 to obtain the Agrobacterium bacterial solution for standby use;

[0018] (3) Infection:

[0019] Dip the explant in the Agrobacterium plaque obtained in step (2), transplant it into moist soil for cultivation, and use 3-5 mL of the Agrobacterium liquid obtained in step (2) to flow along the stem to the base for a single further infection;

[0020] (4) Co-culture

[0021] Keep the soil moist, and after two weeks, positive roots will form at the injured site, and transgenic roots will be obtained;

[0022] (5) Gene function verification

[0023] The ALTPSa47 gene is isolated and cloned, and the expression vector is modified, that is, the target gene ALTPSa47 is integrated into the expression vector by homologous recombination, and the vector is transformed into the chemically competent cell K599 of Agrobacterium rhizogenes by chemical transformation to infect the explant obtained in step (1). After two weeks, the positive roots are identified to obtain transgenic roots. RNA is extracted, and gene expression analysis is performed after reverse transcription to obtain overexpressed transgenic Atractylodes lancea roots; further analysis of the compound content thereof can significantly increase the volatile oil content in the transgenic roots.

[0024] The optional culture temperature of Atractylodes lancea seeds is 20-25°C, the light intensity is 2000-3500Lx, and the light time is 16h / d;

[0025] The different Atractylodes seeds available come from Baokang, Hubei, Yingshan, Hubei, Chifeng, Inner Mongolia, and Chengde, Hebei;

[0026] The solid culture medium for Agrobacterium rhizogenes K599 is a YEB solid culture medium containing 10-50 mg / L Str + 50-100 μg / mL Spe;

[0027] The liquid culture medium for Agrobacterium rhizogenes K599 is a YEB liquid culture medium containing 10-50 mg / L Str + 50-100 μg / mL Spe;

[0028] The solid culture medium for Agrobacterium rhizogenes A4 is a YEB solid culture medium containing 10-50 μg / mL Knan + 50-100 μg / mL Spe;

[0029] The liquid culture medium of Agrobacterium rhizogenes A4 is a YEB liquid culture medium containing 10-50 μg / mL Knan + 50-100 μg / mL Spe;

[0030] The solid culture medium of Agrobacterium rhizogenes C58C1 is a YEB solid culture medium containing 10-50 μg / mLR If + 50-100 μg / mLSe;

[0031] The liquid culture medium of Agrobacterium rhizogenes C58C1 is a YEB liquid culture medium containing 10-50 μg / mLR If + 50-100 μg / mLSe.

[0032] The nucleotide sequence of the Atractylodes lancea ALTPSa47 gene is shown in SEQ ID NO: 1, with a sequence length of 2488 bp, wherein 47-2265 is the coding region.

[0033] The amino acid sequence encoded by the Atractylodes lancea ALTPSa47 gene is shown in SEQ ID NO:2.

[0034] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0035] 1. The present invention compares Atractylodes lancea from four different regions under the same background (same transformation vector, same inserted gene, same number of explants), and conducts genetic transformation research on representative varieties of Atractylodes lancea (Southern Atractylodes lancea and Northern Atractylodes lancea) in a relatively scientific and accurate manner, obtaining the Atractylodes lancea varieties and root-generating Agrobacterium strains with the highest transformation efficiency.

[0036] 2. The present invention can obtain transgenic roots without tissue culture conditions, saving time and labor.

[0037] 3. The invention takes five weeks at the fastest from explant infection to seedling emergence, and is highly efficient.

[0038] 4. The present invention uses GFP reporter gene for detection, which is natural and harmless, easy to observe and cost-saving.

[0039] 5. The present invention introduces exogenous genes into Atractylodes lancea roots through Agrobacterium to obtain stable transgenic Atractylodes lancea roots, and quickly and conveniently verifies candidate genes.

[0040] 6. The key gene ALTPSa47 for the biosynthesis of volatile oils in Atractylodes lancea was isolated, which can significantly increase the content of volatile oils such as germaene B, β-elemene, α-caryophyllene, β-caryophyllene, and atractylodesone in the roots of Atractylodes lancea; it should be more widely used in improving the quality of Atractylodes lancea. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 : Atractylodes lancea genetic transformation method, wherein a is an Atractylodes lancea plant; b is an Atractylodes lancea explant; c is infection; d is infection for 7 days; e is infection for 14 days; f is infection for 28 days;

[0042] Figure 2 : The map of the original vector pK7WG2D and the map of the recombinant vector pK7WG2D+ALTPSa47 constructed by the present invention; Figure a is the map of the original vector pK7WG2D; Figure b is the map of the recombinant vector pK7WG2D+ALTPSa47 constructed by the present invention;

[0043] Figure 3 : Identification of transgenic Atractylodes lancea roots, fluorescence detection of ALTPSa47 transgenic Atractylodes lancea roots;

[0044] Figure 4 : Gene expression analysis of Atractylodes lancea roots overexpressing ALTPSa47 gene;

[0045] Figure 5 : Analysis of the content of volatile oil components in the roots of Atractylodes lancea overexpressing the ALTPSa47 gene; among them, a is germaene B, b is β-elemene, c is α-caryophyllene, d is β-caryophyllene, and e is atractylodesone. DETAILED DESCRIPTION

[0046] In order to enable those skilled in the art to better understand the essence of the present invention, the applicant will now use specific embodiments to describe the technical content of the present invention in detail.

[0047] Example:

[0048] Sources of some experimental materials:

[0049] 35S RUBY plasmid: South China Agricultural University XIALAB; 35S RUBY plasmid contains spectinomycin resistance selection marker gene and RUBY reporter gene;

[0050] pK7WG2D vector: LIANGLAB, Huazhong Agricultural University; pK7WG2D vector contains spectinomycin resistance selection marker gene and GFP reporter gene;

[0051] LUYOR-3415 fluorescent protein excitation light source: WULAB, Huazhong Agricultural University;

[0052] Agrobacterium rhizogenes competent cells K599, C58C1, and A4 were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0053] The culture medium used in the examples is introduced as follows:

[0054] The basic YEB liquid culture medium used below is: CM2010L was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0055] The basic YEB solid culture medium used below is: CM2010S was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0056] The solid culture medium for Agrobacterium rhizogenes K599 was YEB solid culture medium containing 50 mg / L Str + 100 μg / mL Spe;

[0057] The liquid culture medium for Agrobacterium rhizogenes K599 was YEB liquid culture medium containing 50 mg / L Str + 100 μg / mL Spe;

[0058] The solid culture medium for Agrobacterium rhizogenes A4 was YEB solid culture medium containing 50 μg / mL Knan + 100 μg / mL Spe;

[0059] The liquid culture medium for Agrobacterium rhizogenes A4 was YEB liquid culture medium containing 50 μg / mL Knan + 100 μg / mL Spe;

[0060] The solid culture medium for Agrobacterium rhizogenes C58C1 is YEB solid culture medium containing 20 μg / mL Rif + 100 μg / mL Spe;

[0061] The liquid culture medium of Agrobacterium rhizogenes C58C1 is a YEB liquid culture medium containing 20 μg / mLR If + 100 μg / mLR Spe.

[0062] The present invention provides a method for quickly verifying the gene function of Atractylodes lancea based on transgenic roots of Atractylodes lancea, comprising:

[0063] (1) Explant preparation:

[0064] Atractylodes lancea seeds were collected from Baokang, Hubei, Yingshan, Hubei, Chifeng, Inner Mongolia, and Chengde, Hebei, and planted in plug trays. The temperature was controlled at 25°C, and the photoperiod was 16h / d with 2500Lx strong light. After three weeks of cultivation, the seedlings were dug out and the soil and other debris on the roots were gently washed with running water. After washing, the Atractylodes lancea seedlings were cut off with a scalpel, and only the aboveground part and the rhizome connected to the aboveground part were retained, and the wounded Atractylodes lancea were used as explants for infection.

[0065] (2) Preparation of Agrobacterium

[0066] The 35S RUBY plasmid was transformed into chemically competent cells of Agrobacterium rhizogenes by chemical transformation to obtain transformed Agrobacterium rhizogenes; the transformed Agrobacterium rhizogenes was activated and cultured, a single clone was picked, and cultured in a corresponding liquid culture medium of Agrobacterium rhizogenes at 28°C with shaking overnight, and PCR detection was performed to obtain engineered bacteria; the engineered bacteria was spread on a corresponding solid culture medium of Agrobacterium rhizogenes and cultured in the dark at 28°C until the culture medium was covered with a uniform layer of colonies to obtain Agrobacterium plaques, and part of the plaques were scraped into the infection solution (i.e., the new corresponding liquid culture medium of Agrobacterium rhizogenes), mixed by pipetting, and placed in a 28°C shaker until the OD 600 is 0.8, and the Agrobacterium liquid is obtained for later use;

[0067] The chemically competent cells of Agrobacterium rhizogenes are K599, C58C1, and A4;

[0068] The liquid culture medium of Agrobacterium rhizogenes is respectively the aforementioned liquid culture medium of Agrobacterium rhizogenes K599, liquid culture medium of Agrobacterium rhizogenes A4, and liquid culture medium of Agrobacterium rhizogenes C58C1;

[0069] The solid culture medium of Agrobacterium rhizogenes is respectively the solid culture medium of Agrobacterium rhizogenes K599, the solid culture medium of Agrobacterium rhizogenes A4 and the solid culture medium of Agrobacterium rhizogenes C58C1.

[0070] (3) Infection:

[0071] Dip the Atractylodes lancea explants from different regions into the Agrobacterium plaques in the K599, C58C1, and A4 solid culture media obtained in step (2), respectively, and transplant them into moist soil for culture. Use a rubber-tipped dropper to draw 3 mL of the Agrobacterium liquid obtained in step (2) and let it flow along the stem to the base for further infection.

[0072] (4) Co-culture

[0073] Keep the soil moist. After two weeks, positive roots will be generated at the damaged part, and transgenic roots will be obtained. Continue to grow, and a large number of transgenic roots will be obtained after four weeks. Figure 1 ). The transformation efficiency was statistically analyzed according to the test results, and the results are shown in Table 1. Among them, the hairy root induction efficiency of Atractylodes lancea in the three regions under the infection conditions of different Agrobacterium rhizogenes strains was not much different, but there were significant differences in transformation efficiency. Atractylodes lancea in Baokang region showed the highest transformation efficiency; the transformation efficiency of Agrobacterium rhizogenes was strongly correlated with the varieties of Atractylodes lancea in different regions, among which strain K599 showed the highest transformation efficiency. Therefore, strain K599 was used to infect Atractylodes lancea in Baokang region to obtain overexpression Atractylodes lancea roots (Table 1).

[0074] Table 1 Hairy root induction efficiency and transformation efficiency of different strains on Atractylodes lancea infected in different regions

[0075]

[0076] (5) Gene function verification

[0077] The ALTPSa47 gene was isolated and cloned. The plant samples were fully ground in liquid nitrogen and RNA was extracted. The dissolved RNA was electrophoresed on 1.2% agarose gel at a voltage of 120V and a current of 90mA for 20min to detect the integrity of the total RNA and whether there was genomic DNA contamination; at the same time, the concentration and purity of RNA were detected by ultra-micro spectrophotometer, and the RNA with good quality was reverse transcribed to synthesize cDNA.

[0078] The snapgene software was used to design the forward and reverse primers of ALTPSa47 (forward primer SEQ ID NO: 3: 5'-cgacctgcCAATTGCTCGAGATGTCTATGACAGAGGAAG-3'; reverse primer SEQ ID NO: 4: 5'-cgcggTTAATTAACTCGAGTCAGATCGTCATAGGACG-3') to amplify the full-length CDS of ALTPSa47. The amplified gene fragment was detected by 1.2% agarose gel electrophoresis and recovered from the gel for later use.

[0079] The expression vector pK7WG2D was modified. The fragments except ccdB in the expression vector pK7WG2D were amplified using the high-fidelity enzyme phanta, and the electrophoresis detection and gel recovery were performed. The modified plasmid and the cloned gene were homologously recombined and transformed into Escherichia coli DH5α. After PCR detection, the positive colonies were sent for sequencing, and then the sequencing results were compared with the DNA sequence to ensure the consistency of the gene sequence ( Figure 2 ).

[0080] The vector was transformed into chemically competent cells of Agrobacterium rhizogenes K599 by chemical transformation method to infect explants. Two weeks later, positive roots were identified by LUYOR-3415 fluorescent protein excitation light source, and green fluorescence ( Figure 3 ).

[0081] The transgenic roots of Atractylodes lancea with overexpression of ALTPSa47 were obtained by Agrobacterium-mediated transfection. Total RNA was extracted and reverse transcribed into cDNA. The primer ALTPSa47_qF (SEQ ID NO: 5) was used to generate the cDNA.

[0082] (GGTGTATACCATGAGCCCCG) and ALTPSa47_qR (SEQ ID NO: 6)

[0083] Gene expression analysis was performed using primers EF-F (SEQ ID NO: 7) (CAGGCTGATTGTGCTGTTCTTA) and EF-R (SEQ ID NO: 8)

[0084] (TGGTGGCATCCATCTTGT) was used as an internal reference.

[0085] The results are as follows Figure 4 As shown, two transgenic plants (PR-1 and PR-2) were randomly selected for gene expression analysis. The relative expression levels of ALTPSa47 were significantly increased, 143 and 449 times that of the control (NR), respectively. The results showed that overexpression of the ALTPSa47 gene by Agrobacterium-mediated genetic transformation can significantly increase its expression level in transgenic roots of Atractylodes lancea. The active ingredient content of the two selected transgenic Atractylodes lancea roots was further analyzed. The volatile oil components of the overexpressed Atractylodes lancea roots (PR-1 and PR-2), including germaene B, β-elemene, α-caryophyllene, β-caryophyllene, and atractylene ketone, were significantly increased compared with the negative roots (NR) ( Figure 5 The results showed that overexpression of ALTPSa47 gene in transgenic roots of Atractylodes lancea mediated by Agrobacterium tumefaciens could significantly increase the contents of volatile oil components such as germaene B, β-elemene, α-caryophyllene, β-caryophyllene and atractylodesone in transgenic roots (Table 2).

[0086] Table 2 Determination of the contents of volatile oil components such as germaene B, β-elemene, α-caryophyllene, β-caryophyllene, and atractylodesone in the overexpression roots (PR-1, PR-2) and negative roots (NR)

[0087]

[0088] The results show that:

[0089] (1) The present invention compares Atractylodes lancea from four different regions under the same background (same transformation vector, same inserted gene, same number of explants), and conducts a relatively scientific and accurate study on the genetic transformation of representative varieties of Atractylodes lancea (Southern Atractylodes lancea and Northern Atractylodes lancea), thereby obtaining the Atractylodes lancea varieties and root-inducing Agrobacterium strains with the highest transformation efficiency.

[0090] (2) The present invention can obtain transgenic roots without tissue culture conditions, saving time and labor.

[0091] (3) The present invention takes only five weeks from explant infection to seedling emergence, and is highly effective.

[0092] (4) The present invention uses the RUBY reporter gene for detection, which is natural and harmless, easy to observe, and saves costs.

[0093] (5) The present invention introduces exogenous genes into Atractylodes lancea roots through Agrobacterium to obtain stable transgenic Atractylodes lancea roots, and quickly and conveniently verifies candidate genes.

[0094] (6) ALTPSa47 gene can promote the synthesis of volatile oil components such as germanene B, β-elemene, α-caryophyllene, β-caryophyllene, and atractylodesone in Atractylodes lancea.

Claims

1. Atractylodes ALTPSa47 The application of the gene in regulating the biosynthesis of the volatile oil components of the root of Atractylodes lancea, including germaene B, β-elemene, α-caryophyllene, β-caryophyllene and atractylodesone, is characterized in that: Atractylodes macrocephala ALTPSa47 The gene nucleotide sequence is shown in SEQ ID NO: 1; Overexpression of Atractylodes macrocephala ALTPSa47 The gene significantly increases the content of the volatile oil component.

2. Atractylodes ALTPSa47 The application of gene overexpression in cultivating atractylodes lancea with increased content of volatile oil components such as germaene B, β-elemene, α-caryophyllene, β-caryophyllene and atractylodesone is characterized in that: Atractylodes macrocephala ALTPSa47 The gene nucleotide sequence is shown in SEQ ID NO: 1; Overexpression of Atractylodes macrocephala ALTPSa47 The gene significantly increases the content of the volatile oil component.

3. The use according to claim 1, characterized in that: Genetic transformation of Atractylodes lancea roots to obtain overexpressed Atractylodes lancea ALTPSa47 The method of producing a transgenic atractylodes lancea root comprises the following steps: (1) Preparation of explants: Three weeks after planting the Atractylodes lancea seeds, dig out the seedlings and wash them. Cut off the Atractylodes lancea seedlings and keep only the aboveground parts and the rhizomes connected to the aboveground parts as explants for infection. (2) Preparation of Agrobacterium: Use chemical transformation to transform the plasmid carrying the reporter gene into chemically competent cells of Agrobacterium rhizogenes to obtain transformed Agrobacterium rhizogenes; activate the transformed Agrobacterium rhizogenes, pick out a single clone, shake culture it at 28°C overnight, perform PCR detection, and obtain engineered bacteria; spread the engineered bacteria on a plate and culture it in the dark at 28°C until the culture medium is covered with a uniform layer of colonies to obtain Agrobacterium plaques, scrape part of the plaques into the infection solution, and adjust the OD 600 The pH value is 0.6-0.8, and the Agrobacterium liquid is obtained for standby use; (3) Infection: Dip the explant obtained in step (1) into the Agrobacterium plaque obtained in step (2), and transplant it into moist soil for cultivation. For each explant, use 3-5 mL of the Agrobacterium bacterial solution obtained in step (2) to flow along the stem to the base for further infection; (4) Co-cultivation: Keep the soil moist. After two weeks, positive roots will be generated at the damaged site, and transgenic roots will be obtained. (5) Gene function verification: ALTPSa47 After the gene is isolated and cloned, the target gene is transferred to ALTPSa47 The expression vector is integrated into the expression vector, and the integrated expression vector is transformed into the chemically competent cells of Agrobacterium rhizogenes by chemical transformation method to infect the explants obtained in step (1); after two weeks, the positive roots are identified to obtain transgenic roots; RNA is extracted, and gene expression analysis is performed after reverse transcription to obtain the overexpressed Atractylodes lancea. ALTPSa47 Genes of transgenic Atractylodes lancea roots.

4. The use according to claim 3, characterized in that: The culture temperature of the atractylodes seeds is 20-25°C, the light intensity is 2000-3500Lx, and the light time is 16h / d.

5. The use according to claim 3, characterized in that: In the step (2) and step (5), the chemically competent cells are selected from K599, C58C1 and / or A4, the plasmid carrying the reporter gene in the step (2) is 35SRUBY; and the expression vector in the step (5) is pK7WG2D.

Images