Use of faecalibacterium prausnitzii dsm 17677 in the preparation of a product for the prevention and treatment of porcine epidemic diarrhea virus infection
By preparing a drug containing Faecalibacterium prausnitzii DSM 17677, the problems of prevention and treatment of porcine epidemic diarrhea virus infection were solved, viral replication inhibition and titer reduction were achieved, and a new treatment approach was provided.
Patent Information
- Application Number
- CN202410876775.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-01
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2044-07-01
AI Technical Summary
In the existing technology, the alleviating and therapeutic effects of Faecalis prausnitzii DSM 17677 on porcine epidemic diarrhea virus (PEDV) infection have not been fully studied, and there is a lack of effective prevention and treatment approaches.
Faecalibacterium prausnitzii DSM 17677 is used to prepare drugs, inhibit PEDV virus replication through competitive adhesion, reduce virus titer, protect target cells, and prepare pharmaceutical dosage forms including pharmaceutical excipients such as isotonic agents, buffers, flavorings, excipients, fillers, binders, disintegrants and lubricants.
It significantly inhibits PEDV virus replication, reduces virus titer, and protects cells, providing a new way to prevent and treat PEDV and has economic value.
Smart Images

Figure CN118845848B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of Faecalibacterium prausnitzii DSM 17677 in preparation of a product for preventing and treating porcine epidemic diarrhea virus (PEDV) infection. BACKGROUND
[0002] Porcine epidemic diarrhea virus (PEDV) belongs to the family of Coronaviridae and the genus of alphacoronavirus. The genome of PEDV is about 28 kb, and is translated and transcribed from 5' to 3' end in sequence, including 5' untranslated region (5' UTR), open reading frame 1a / b (orf1ab), spike protein (S), accessory protein (ORF3), envelope protein (E), membrane protein (M), nucleocapsid protein (N), 3' UTR and poly(A) tail. Each structure and non-structure protein plays an important role in virus replication, transcription and translation, and virus-host cell interaction. PEDV mainly includes two genotypes: genotype I and genotype II, and the genotype I is divided into two gene subtypes GIa and GIb, and the genotype II is divided into three gene subtypes GIIa, GIIb and GIIc.
[0003] PEDV can infect pigs of various ages, causing villus atrophy, thereby leading to malabsorption, diarrhea and anorexia, and causing clinical symptoms of intestinal function disorder and diarrhea. The infection of PEDV causes intestinal homeostasis imbalance of pigs, and remodeling or regulating intestinal flora homeostasis is likely to be an effective way for future prevention and treatment of PEDV.
[0004] Probiotics are living microorganisms, which can bring benefits to the health of the host when administered in sufficient doses. Probiotics can resist the invasion of pathogenic microorganisms by improving the function of the mucosal barrier. Studies have shown that probiotics can prevent pathogenic microorganisms from entering the cell by inhibiting viral adhesion or competing for cell receptors, and more importantly, probiotics can clear pathogenic microorganisms by regulating the immune system. Faecalibacterium prausnitzii, also known as Faecalibacterium prausnitzii DSM 17677, is a non-spore-forming, strictly anaerobic, non-motile gram-positive bacillus. Faecalibacterium prausnitzii DSM 17677 is mainly distributed in the intestinal tract of humans and animals, and accounts for about 5% to 15% of the total flora abundance, and is one of the main dominant flora in the human intestinal tract. Supplementing Faecalibacterium prausnitzii DSM 17677 can regulate the immune system and relieve inflammatory diseases, and it has many probiotic functions such as anti-inflammatory, immune regulation, antioxidant, and maintenance of intestinal mucosal barrier integrity. Faecalibacterium prausnitzii DSM 17677 has good immune regulation and anti-inflammatory activity. However, whether Faecalibacterium prausnitzii DSM 17677 has a relieving and treating effect on porcine epidemic diarrhea virus is still unclear, and there is no report on any related research. SUMMARY
[0005] Therefore, the application aims to provide an application of Faecalibacterium prausnitzii DSM 17677 in preparing a product for preventing and treating porcine epidemic diarrhea virus (PEDV) infection.
[0006] In order to achieve the above-mentioned application purposes, the application provides the following technical solutions.
[0007] The application provides an application of Faecalibacterium prausnitzii DSM 17677 in preparing a product for preventing and treating porcine epidemic diarrhea virus (PEDV) infection.
[0008] The application also provides an application of Faecalibacterium prausnitzii DSM 17677 in preparing a product for inhibiting replication of porcine epidemic diarrhea virus (PEDV).
[0009] The application also provides an application of Faecalibacterium prausnitzii DSM 17677 in preparing a product for reducing titer of porcine epidemic diarrhea virus (PEDV).
[0010] Preferably, the type of the product comprises a medicine.
[0011] Preferably, the medicine comprises a pharmaceutical excipient, and the pharmaceutical excipient comprises at least one of an isotonic agent, a buffer, a flavoring agent, an excipient, a filler, a binder, a disintegrant and a lubricant.
[0012] The application also provides a medicine for preventing and treating porcine epidemic diarrhea virus (PEDV) infection, and the active ingredient of the medicine comprises Faecalibacterium prausnitzii DSM 17677.
[0013] Preferably, the content of Faecalibacterium prausnitzii DSM 17677 in the medicine accounts for 0.01% to 100% of the mass percentage of the medicine.
[0014] Preferably, the medicine comprises a pharmaceutical excipient.
[0015] Preferably, the dosage form of the medicine comprises a powder, a tablet, a granule, a capsule, a solution, an emulsion or a suspension.
[0016] The application has the following beneficial effects:
[0017] The application first proposes that Faecalibacterium prausnitzii DSM 17677 can inhibit replication of PEDV and reduce virus titer, and thus can effectively prevent or treat diseases caused by PEDV infection. The application first proposes that Faecalibacterium prausnitzii DSM 17677 can significantly inhibit PEDV infection by competitive adhesion, and produce a protective effect on viral target cells. The application provides a theoretical basis for using Faecalibacterium prausnitzii DSM 17677 as an antiviral drug, has economic value, and provides a new way and scheme for prevention and treatment of PEDV. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1Fig. 1 is a schematic diagram of the morphology and gram staining of Faecalibacterium prausnitzii DSM 17677 cultured according to the present application, wherein the left drawing is a morphology diagram of Faecalibacterium prausnitzii DSM 17677 under electron microscope observation, and the right drawing is a gram staining diagram of Faecalibacterium prausnitzii DSM 17677;
[0019] Figure 2 Fig. 6 is a CCK-8 detection result of cell viability of Vero-E6 infected by Faecalibacterium prausnitzii DSM 17677 and viruses co-incubated;
[0020] Figure 3 Fig. 7 is a cell toxicity evaluation result of Vero-E6 by different concentrations of Faecalibacterium prausnitzii DSM 17677;
[0021] Figure 4 Fig. 8 is a Calcein cell viability staining detection result of cell viability of Vero-E6 infected by Faecalibacterium prausnitzii DSM 17677 and viruses co-incubated;
[0022] Figure 5 Fig. 9 is a virus particle content detection result in supernatant of culture solution of Vero-E6 infected by Faecalibacterium prausnitzii DSM 17677 and PEDV viruses co-incubated, wherein the virus copy number of supernatant of cells of the Mock group is 0, and thus is not shown in the figure;
[0023] Figure 6 Fig. 10 is a virus particle content detection result in cells of Vero-E6 infected by Faecalibacterium prausnitzii DSM 17677 and PEDV viruses co-incubated, wherein the virus copy number of cells of the Mock group is 0, and thus is not shown in the figure, and the virus copy number of cells of the PEDV+B group at 36h and 48h is close to 0, and thus is not shown in the figure;
[0024] Figure 7 Fig. 11 is a PEDV-S1 protein expression result in cells of Vero-E6 infected by Faecalibacterium prausnitzii DSM 17677 and PEDV viruses co-incubated;
[0025] Figure 8 Fig. 12 is a cell indirect immunofluorescence assay result of intracellular virus titer;
[0026] Figure 9 Fig. 13 is a Reed-Muench determination result of intracellular virus titer;
[0027] Figure 10 Fig. 14 is a plaque assay detection result of live virus particles. DETAILED DESCRIPTION
[0028] The present application provides an application of Faecalibacterium prausnitzii DSM 17677 in preparation of a product for preventing and treating porcine epidemic diarrhea virus infection.
[0029] In the present application, the type of the product preferably includes a drug, the drug preferably includes a pharmaceutical adjuvant, and the pharmaceutical adjuvant preferably includes at least one of an isotonic agent, a buffer, a flavoring agent, an excipient, a filler, a binder, a disintegrant, and a lubricant. The present application is not particularly limited to the specific source of Faecalibacterium prausnitzii DSM 17677. In the present application, the Faecalibacterium prausnitzii DSM 17677 is also known as Faecalibacterium duncaniae A2-165 DSM 17677, and the strain type is Faecalibacterium prausnitzii, Prasunitzii, Faecalibacterium prausnitzii, Odorfaecium, other preservation numbers are ATCC 27768, BCRC81047, NCIMB 13872, CCUG 50206, CIP 107879, JCM 31915. In the present application, the prevention means prevention or treatment.
[0030] The present application also provides the use of Faecalibacterium prausnitzii DSM 17677 in the preparation of a product for inhibiting the replication of porcine epidemic diarrhea virus or for reducing the titer of porcine epidemic diarrhea virus. In the present application, the type of the product and the specific content of the drug are the same as above, and will not be repeated here.
[0031] The present application also provides a drug for preventing and treating porcine epidemic diarrhea virus infection, and the active ingredient of the drug includes Faecalibacterium prausnitzii DSM 17677.
[0032] In the drug of the present application, Faecalibacterium prausnitzii DSM 17677 is preferably the only active ingredient. The mass percentage of Faecalibacterium prausnitzii DSM 17677 in the drug is preferably 0.01% to 100%, and more preferably 10% to 99%. In the present application, the drug preferably includes a pharmaceutical adjuvant. The pharmaceutical adjuvant preferably includes at least one of an isotonic agent, a buffer, a flavoring agent, an excipient, a filler, a binder, a disintegrant, and a lubricant. In the present application, the dosage form of the drug preferably includes a powder, a tablet, a granule, a capsule, a solution, an emulsion, or a suspension. The present application is not particularly limited to the specific preparation method of the drug.
[0033] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.
[0034] In the following examples, if not otherwise specified, all are conventional methods.
[0035] In the following examples, the materials and reagents used, if not otherwise specified, can be obtained from commercial channels.
[0036] Example 1
[0037] Fresh modified Clostridium liquid culture medium (purchased from Shandong Top Bioengineering Co., Ltd.) was inoculated with Faecalibacterium prausnitzii DSM 17677 (purchased from the German Microorganism and Cell Culture Collection (DSMZ), Ningbo Mingzhou Biotechnology Co., Ltd.) at an inoculation amount of 5%, and placed in an anaerobic workstation at 37°C and a humidity of 65% for static culture. When the OD value was 0.5, Faecalibacterium prausnitzii DSM 17677 was collected by centrifugation at 6000 rpm for 8 min, and the collected Faecalibacterium prausnitzii DSM 17677 was washed twice with PBS at 10 times the volume of the bacterial amount to remove the Clostridium culture medium, the bacterial mass was weighed on an electronic balance, and the bacterial mass was diluted with PBS to 50 mg / ml, and stored at 4°C for standby use. 600
[0038] Observation of the morphology of Faecalibacterium prausnitzii DSM 17677 and Gram staining:
[0039] (1) Observation of the morphology of Faecalibacterium prausnitzii DSM 17677:
[0040] a) Smear: Take a clean glass slide, and drop 1 drop of normal saline in the center of the glass slide. After sterilizing the inoculation loop in the flame, pick up a small amount of Faecalibacterium prausnitzii DSM 17677 in the normal saline in the center of the glass slide, and spread it into a uniform film about 1 cm x 1 cm in size. After sterilizing the inoculation loop, put it back on the test tube rack;
[0041] b) Drying: Dry the smear at room temperature naturally;
[0042] c) Fixing: After the smear is dried, pass the back of the glass slide back and forth through the flame of an alcohol lamp for about 2-3 seconds, and then place the cover glass over the bacterial film to fix it;
[0043] d) Observation: Electron microscopy was used to observe the morphology of Faecalibacterium prausnitzii DSM 17677. The results are shown in the left image in FIG. 1, and the bacterial body of Faecalibacterium prausnitzii DSM 17677 is rod-shaped under a high-power lens. Figure 1
[0044] (2) Gram staining:
[0045] a) Primary staining: Place the fixed Faecalibacterium prausnitzii DSM 17677 smear on a staining rack, and add 2-3 drops of crystal violet dye to completely cover the smear. After 1 min of staining, gently rinse with a fine stream of water;
[0046] b) Mordanting: Add 2-3 drops of Lugol's iodine solution, and after 1 min of staining, gently rinse with a fine stream of water;
[0047] c) Decolorization: Add 3-5 drops of 95% ethanol until the flowing ethanol is colorless or light purple, and gently rinse with a fine stream of water;
[0048] d) Restaining: Add 1 drop of safranin stain solution, restain for 1 minute, rinse gently with running water, wait for the smear to dry naturally, add 1 drop of cedar oil to the bacterial film, and then observe with an oil microscope. The results are as follows: Figure 1 As shown in the right figure, Faecalibacterium prausnitzii DSM17677 is a Gram-positive bacterium.
[0049] Example 2
[0050] Recovery and culture of Vero-E6 cell line:
[0051] The frozen cells were quickly thawed in a 37°C water bath, and complete culture medium (DMEM medium supplemented with 10% FBS and 1% penicillin-streptomycin double antibody solution) was added. The cells were gently shaken to evenly distribute the cells, and the cells were placed in a 37°C, 5% CO2 incubator for static culture until the cells were fully confluent as a monolayer and then passaged.
[0052] Cultivation and propagation of PEDV virus:
[0053] PEDV virus was inoculated into a confluent monolayer of Vero-E6 cells at a 2% inoculation rate, and 10 μg / ml trypsin (without EDTA) was added. The cells were placed in a 37°C incubator for adhesion for 2 h, after which the virus solution was discarded. The cells were washed twice with PBS, and cell basal maintenance medium (1×DMEM+1% penicillin and streptomycin, without FBS) was added. The cells were cultured for 4 days. After most cells showed obvious cytopathic effect (CPE), the cells were repeatedly frozen and thawed, the virus solution was collected, the supernatant was centrifuged, and the cells were stored in aliquots at -80°C for later use.
[0054] Vero-E6 cell viability was detected by CCK-8 assay:
[0055] The CCK-8 method was used to detect the effect of the bacteria obtained in Example 1 and PEDV co-incubated on the viability of Vero-E6 cells. 5 The cells were inoculated at a density of 100 μL / well in a 96-well plate. When the cells were about 80% confluent, the cell culture medium was discarded and the cells were washed twice with PBS. For the experimental group (PEDV+B), 50 μL of the diluted bacterial cells obtained in Example 1 and the PEDV virus incubation solution (diluted with basal culture medium (1×DMEM+1% penicillin and streptomycin) was added to each well to obtain a bacterial cell concentration of 25 mg / mL and a virus titer of 10 TCID 50 , and subsequent experiments were also carried out using this bacterial concentration and virus titer. Negative control group (Mock): 50 μL of basal culture medium was added to each well of cells. Positive control group (PEDV): 50 μL of virus dilution (virus titer of 10 TCID) was added to each well of cells. 50Immediately place the cells in a 37°C incubator and infect for 2 hours. Add 10 μg / mL of trypsin (EDTA-free). After infection, discard the viral solution, wash twice with PBS, and add 100 μL of basal medium to each well for continued incubation (this time is marked as viral infection hour 0). Add CCK-8 reagent (10 μL / well) at 24, 36, 48, and 60 hours, incubate at 37°C in the dark for 1.5 hours, and read the absorbance at 450 nm on a microplate reader. Perform eight parallel experiments for each group.
[0056] The results are as follows Figure 2 As shown, Faecalibacterium prausnitzii DSM 17677 and PEDV were co-incubated to infect Vero-E6 cells, which significantly increased cell viability and protected the cells from viral damage after 36 hours.
[0057] Example 3
[0058] Detection of cytotoxicity of Faecalibacterium prausnitzii DSM 17677 by CCK-8 assay
[0059] The Faecalibacterium prausnitzii DSM 17677 obtained in Example 1 was formulated into 0.1 mg / mL, 0.2 mg / mL, 1 mg / mL, 5 mg / mL, and 25 mg / mL, respectively, and incubated with Vero-E6 cells at 37°C in a 5% CO2 incubator. Experimental group (0.1, 0.2, 1, 5, 25): 50 μL of different concentrations of Faecalibacterium prausnitzii DSM 17677 and 50 μL of basal culture medium were added to each well. Negative control group (Mock): 100 μL of basal culture medium was added to each well. CCK-8 reagent was added at 12h, 24h, and 48h, 10 μL / well, incubated at 37°C in the dark for 1.5h, and the absorbance value was read at 450nm on a microplate reader. Eight parallel experiments were performed for each group.
[0060] The results are as follows Figure 3 As shown, within 24 hours, different concentrations of Faecalibacterium prausnitzii DSM 17677 had no toxicity to the cells, but after 48 hours, 5 mg / mL and 50 mg / mL of Faecalibacterium prausnitzii DSM 17677 showed cytotoxicity.
[0061] Example 4
[0062] Calcein cell viability staining
[0063] Vero-E6 cells were cultured at 1×10 5Vero-E6 cells were seeded in 96-well plates at a density of 1 x 104 / mL, 100 μL / well, and allowed to adhere and reach about 80% confluence. The cell culture medium was discarded, and the cells were washed twice with PBS. For the experimental group (PEDV+B), 50 μL of the diluted bacteria and PEDV virus incubation solution (diluted with the base medium (1 x DMEM + 1% penicillin and streptomycin), with a bacterial concentration of 25 mg / mL and a virus titer of 10 TCID 50 , which was also used in subsequent experiments), for the negative control group (Mock), 50 μL of the base medium was added to each well, and for the positive control group (PEDV), 50 μL of the virus dilution solution (with a virus titer of 10 TCID 50 ) was added to each well. The cells were immediately placed in a 37°C incubator for 2 h, and 10 μg / mL trypsin was added. After the infection was completed, the virus solution was discarded, and the cells were washed twice with PBS. Then, 100 μL of the base medium was added to each well for further culture (at this time, it was recorded as 0 h of virus infection). Cell activity was detected at 24 h, 36 h, 48 h, and 60 h, respectively, with the following specific steps:
[0064] a) Washing: The cell culture medium was removed, and the cells were washed twice with PBS to completely remove the culture medium containing phenol red;
[0065] b) Staining: 100 μL / well of Calcein AM detection solution was added, and the cells were incubated at 37°C in the dark for 45 min;
[0066] c) Observation: The staining results were observed under an inverted fluorescence microscope, and Calcein was green fluorescent.
[0067] The results are shown in Figure 4 . After the co-incubation of Faecalibacterium prausnitzii DSM 17677 and PEDV to infect Vero-E6 cells, the green fluorescent activity of the Faecalibacterium prausnitzii DSM 17677 group (experimental group) was significantly higher than that of the PEDV infection group (positive control group).
[0068] Example 5
[0069] qPCR detection of virus content in cell supernatant and intracellular
[0070] The effect of co-incubation of Faecalibacterium prausnitzii DSM 17677 and PEDV to infect Vero-E6 on the expression of PEDV-M gene in cells was detected by qPCR. The specific method of co-incubation of Faecalibacterium prausnitzii DSM 17677 and PEDV to infect Vero-E6 and the group design were the same as in Example 4. The total RNA in the cell supernatant and intracellular was extracted, and the reverse transcription and PCR amplification of the related genes were performed, in which the extraction of total RNA in the supernatant and the reverse transcription and PCR amplification were the same as the extraction of total RNA in the cells.
[0071] a) Extraction of total cellular RNA: After PEDV infection of Vero-E6, the cells were washed twice with PBS, and 500 μL of Trizol solution was added to each well. The cells were allowed to stand at room temperature for 5 min to fully lyse the cells. 100 μL of chloroform was added, the cells were thoroughly mixed by inversion, and then centrifuged at 4°C, 12,000 rpm for 15 min. The upper colorless aqueous phase was removed and placed in a new centrifuge tube. An equal volume of isopropanol was added, the cells were mixed by inversion, and the tubes were allowed to stand at room temperature for 10 min. The tubes were centrifuged at 4°C, 12,000 rpm for 10 min. min, discard the supernatant, and invert to remove residual isopropanol; add 1 mL of 75% alcohol solution pre-cooled at 4°C for precipitation, centrifuge at 4°C and 12000 rpm for 5 min, discard the supernatant, invert to remove residual ethanol, open the lid and dry at room temperature for 5 min; add 20 μL of DEPC water (preheated at 55°C) to each tube for dissolution, and determine the RNA concentration and purity (A260 / A280 ratio) using NanoDrop2000 nucleic acid quantitative analyzer. After aliquoting, store at -80°C.
[0072] b) Reverse transcription using Vazyme Total RNA from the sample was extracted using the IIQ RT SuperMix for qPCR (+gDNA wiper) kit and reverse transcribed. The specific procedure was as follows: Reverse transcription system (20 μL / sample): first, 4× gDNA wiper mix (4 μL) and mRNA (1 μg) were mixed, and RNase-free ddH2O was added to adjust the total volume to 16 μL. The reaction was carried out in a PCR instrument at 42°C for 2 minutes. Then, 4 II qRT SuperMixII was added to the first step reaction solution and placed in a PCR instrument for reverse transcription. The reaction conditions were 37°C for 15 min and 85°C for 5 sec. After the reaction was completed, the cDNA product was taken out and stored in aliquots.
[0073] c) Real-time fluorescence quantitative PCR using Vazyme ChamQTM qPCR reaction was performed using the qPCR MasterMix kit. The reverse transcription product was diluted 3-fold with ddH2O. The reaction system was 10 μL: 5 μL of 2× Taq Plus Master Mix, 0.25 μL of each upstream and downstream primers (10 μM), 1 μL of cDNA template, and 3.5 μL of ddH2O. The reaction conditions were: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 5 seconds, 60°C annealing for 60 seconds, and 75°C extension for 30 seconds for 40 cycles; and a final extension at 75°C for 10 minutes. The Ct value was used as the 2 -△△CTThe relative quantification of the target gene was calculated by taking GAPDH as the internal reference. The primers used in PCR were designed according to the relevant coding region sequences published in GenBank by Primer Premier 5.0 and synthesized by Shengong Biotechnology Co., Ltd. The primer sequences are shown in Table 1. Each group was tested in triplicate.
[0074] Table 1 Real-time fluorescent quantitative PCR primer sequences
[0075] Primer name Sequence (5'-3') GAPDH-F TGACAACAGCCTCAAGATCG (SEQ ID NO. 1) GAPDH-R GTCTTCTGGGTGGCAGTGA (SEQ ID NO. 2) PEDV-M-F TATGGTGTCAAGATGGCTATTCTATGG (SEQ ID NO. 3) PEDV-M-R AAAGACCACCAAGAATGTGTCCT (SEQ ID NO. 4)
[0076] The results of the detection of the virus copy number in the supernatant of the cells infected with PEDV virus after the interaction of Faecalibacterium prausnitzii DSM 17677 and PEDV virus are shown in Table 4. Figure 5 At 36h, the virus copy number in the supernatant of the cells in the experimental group (Faecalibacterium prausnitzii DSM 17677 group, PEDV+B) was significantly lower than that in the positive control group (virus infection group, PEDV). However, there was no significant difference at 24h.
[0077] The results of the detection of the virus copy number in the cells infected with PEDV virus after the interaction of Faecalibacterium prausnitzii DSM 17677 and PEDV virus are shown in Table 4. Figure 6 At 24-48h, the expression level of PEDV-M in the cells in the experimental group (Faecalibacterium prausnitzii DSM 17677 group, PEDV+B) was significantly lower than that in the positive control group (virus infection group, PEDV).
[0078] Example 6
[0079] The content of PEDV-S1 protein in the cells after the co-incubation of Faecalibacterium prausnitzii DSM 17677 (F. prausnitzii) and PEDV to infect Vero-E6 was detected by WB, wherein the specific method of co-incubating Faecalibacterium prausnitzii DSM 17677 and PEDV to infect Vero-E6 and the group design are the same as those in Example 4.
[0080] a) Extraction of total protein: after the interaction of Faecalibacterium prausnitzii DSM 17677 and PEDV to infect Vero-E6 cells, the cells were washed twice with PBS, 200μL RIPA cell lysis buffer (containing 0.1% aprotinin and 1% PMSF) was added to each well, and the cells were uniformly lysed by blowing for 1 min. The protein-containing cell lysate was collected in a centrifuge tube, centrifuged at 12000 rpm at 4°C for 20 min, and the supernatant was collected.
[0081] b) Protein quantification and denaturation: a small amount was taken for protein quantification, and the operation was performed according to the instructions of the Biyun Tian BCA protein quantification standard product. The total protein concentration in each sample was calculated by preparing a standard curve, and the protein concentration in each group of samples was made consistent by using cell lysis buffer.
[0082] c) Protein denaturation: mix 5x Protein Loading Buffer with sample at a volume ratio of 5:1, after mixing, denature the protein by boiling in water at 100℃ for 10 min;
[0083] d) SDS-PAGE electrophoresis: prepare concentrated gel and separation gel (12% separation gel according to the molecular size of the target protein) respectively, add electrophoresis buffer to the electrophoresis tank, set 60V constant voltage electrophoresis for 40 min after loading, then adjust the voltage to 120V and continue electrophoresis until the bromophenol blue reaches the bottom of the separation gel, remove the concentrated gel;
[0084] e) Western blot transfer: activate the PVDF membrane with 100% methanol for 1 min in advance, then transfer it to the transfer solution and balance for 5 min, assemble a "sandwich layer" in the order of black plate-sponge-filter paper-separation gel-PVDF membrane-filter paper-sponge-white plate, and try to remove air bubbles with a glass rod; transfer at a constant current of 260mA with ice water bath for 45 min;
[0085] f) Antigen blocking: after the transfer is completed, place the PVDF membrane in 5% skimmed milk powder blocking solution, close at room temperature for 1 h, and mix well on a shaker at low speed;
[0086] g) Antibody incubation: dilute the antibody with blocking solution, transfer the PVDF membrane to the primary antibody incubation solution, incubate at 4℃ overnight, and wash with TBST buffer on a shaker for 3 times, 8 min each time; then incubate the PVDF membrane with the secondary antibody at room temperature for 1 h, and wash with TBST buffer on a shaker for 3 times, 8 min each time. The dilution ratio of the antibody: dilute with the blocking solution according to the recommended dilution ratio, dilute the GAPDH antibody at a ratio of 1:5000, and dilute the PEDV-S1 antibody at a ratio of 1:1000; dilute the HRP-labeled goat anti-rabbit (goat anti-mouse) at a ratio of 1:5000;
[0087] h) Mix equal volumes of A and B in the ECL chemiluminescence kit, incubate the PVDF membrane at room temperature for 30 sec, and then image on the ChemiDocTM XRS+ system;
[0088] i) Quantification of target protein: quantify the protein bands by ImageJ, and calculate the relative expression of the target protein by dividing the value of the target protein by the value of the corresponding internal standard.
[0089] The results are shown in Figure 7 The expression level of PEDV-S1 in the experimental group (Faecalibacterium prausnitzii DSM 17677 group, PEDV + F. prausnitzii) was significantly lower than that in the virus infection group (PEDV) at 24-60 h.
[0090] Example 7
[0091] Cellular indirect immunofluorescence assay for virus titration
[0092] The virus titration was determined by cellular indirect immunofluorescence staining (IFA), which was performed as follows:
[0093] a) The 96-well Vero-E6 cell plate treated with Faecalibacterium prausnitzii DSM 17677 and PEDV virus (as a control, without Faecalibacterium prausnitzii DSM 17677, only with PEDV virus) was discarded the culture medium and washed twice with PBS (the operation was as gentle as possible to prevent the cells from falling off);
[0094] b) Fixation: the cells were fixed in 4% paraformaldehyde at room temperature for 20 min, and then washed with PBST for 3 times, 3 min each time;
[0095] c) Cell membrane perforation: the cells were incubated in 0.1% Triton-100 (prepared in PBS) solution at 37°C for 10 min, and then washed with PBS for 3 times, 3 min each time;
[0096] d) Blocking: the cells were blocked with 3% BSA blocking solution at room temperature for 1 h;
[0097] e) Primary antibody incubation: the antibody (diluted with 1% BSA, 1:500) was added, and the cells were incubated at 4°C overnight. After the incubation, the cells were washed with PBS for 3 times, 3 min each time;
[0098] f) Secondary antibody incubation: the FITC-labeled fluorescent secondary antibody (diluted with 1% BSA, 1:500) was added, and the cells were incubated at room temperature for 1 h in the dark. After the incubation, the cells were washed with PBST for 3 times, 3 min each time in the dark;
[0099] g) Nucleus staining: the cells were stained with DAPI and incubated in the dark for 5 min. The cells were rinsed with PBST for 3 times, 5 min each time;
[0100] h) High-content fluorescence imaging: the whole plate was scanned and observed under a high-content microscope.
[0101] The results are shown in Figure 8 Table 1, and Faecalibacterium prausnitzii DSM 17677 can significantly reduce the virus titer.
[0102] Example 8
[0103] Reed-Muench assay for virus titration
[0104] Determination of virus titer: Reed-Muench method was used to determine the virus titer of different experimental groups (group design is the same as Example 7): Vero-E6 cells were inoculated into 96-well cell culture plates, and when a monolayer was formed, 10-fold gradient dilution of virus liquid of different treatment groups was inoculated, adsorbed in a cell incubator for 2 h, 10 μg / mL of trypsin (without EDTA) was added, the virus suspension was discarded, and the basic cell maintenance solution (without FBS) was added for culture, the cytopathic effect (CPE) caused by the virus was observed every 24 h, and the observation was stopped when there was no new CPE in the cell culture hole. According to the number of cell holes with CPE, the Reed-Muench method was used to calculate the TCID50 of the virus 50 .
[0105] The results are shown in Figure 9 Fig. 6, and Faecalibacterium prausnitzii DSM 17677 can significantly reduce the virus titer.
[0106] Example 9
[0107] Plaque assay for detecting live virus particles
[0108] a) Cell culture: Vero-E6 cells were inoculated into 12-well plates and grown to 90% for standby;
[0109] b) Virus dilution: 24 h after the interaction of Faecalibacterium prausnitzii DSM 17677 and PEDV virus, the cell and supernatant suspension (using no Faecalibacterium prausnitzii DSM 17677 and only adding PEDV virus as a control) was collected, frozen and thawed twice, centrifuged at 1000 rpm for 5 min, and the supernatant was taken as the virus liquid. Then 1.5 mL sterile centrifuge tubes were taken, 0.9 mL of maintenance solution was added to each tube. 0.1 mL of virus liquid was added to the first centrifuge tube and mixed. 0.2 mL of the mixed liquid was taken from the first centrifuge tube and added to the second tube and mixed. Sequential dilution was performed until the last tube;
[0110] c) Virus adsorption: the complete culture medium was aspirated, and PBS was washed twice. 500 μL of virus liquid was added, and 10 μg / mL of trypsin (without EDTA) was added. Adsorption was performed in a 37°C, 5% CO2 incubator for 2 h, and shaking was performed every 20 min. The virus liquid was aspirated, and PBS was washed twice;
[0111] d) Methyl cellulose overlay: 500 μL of 1% methyl cellulose was added to each well, and culture was performed in a 37°C, 5% CO2 incubator;
[0112] Result observation: after 3 days of infection, plaques could be observed under a microscope, and staining observation was performed when the plaques no longer obviously increased. Crystal violet solution was added to each well to cover the cell surface, and it was static for 30 min. Tap water was used for washing, and the results were observed after drying.
[0113] The results are shown inFigure 10 As shown, the number of virus plaques in the experimental group (Faecalibacterium prausnitzii DSM 17677 group, PEDV+B) was significantly less than in the virus infection group (PEDV).
[0114] The above merely describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
Claims
1. Application of Faecalibacterium prausnitzii DSM 17677 in the preparation of products for preventing and treating porcine epidemic diarrhea virus infection.
2. Application of Faecalibacterium prausnitzii DSM 17677 in the preparation of products for inhibiting the replication of porcine epidemic diarrhea virus.
3. Application of Faecalibacterium prausnitzii DSM 17677 in the preparation of products for reducing the titer of porcine epidemic diarrhea virus.
4. The use according to any one of claims 1 to 3, characterized in that The types of products include pharmaceuticals.
5. The use according to claim 4, characterized in that The drug includes pharmaceutical excipients, which include at least one of an isotonic agent, a buffer, a flavoring agent, an excipient, a filler, a binder, a disintegrant, and a lubricant.
Citation Information
Patent Citations
Faecalibacterium prausnitzii strain CNCM 1-4573 for the treatment and prevention of gastrointestinal inflammation
CN109310714A