Application of ALDH9A1 as a marker and / or therapeutic target for invasion and metastasis of liver cancer

By detecting and regulating the expression of ALDH9A1 gene and protein, qPCR and antibodies are used to diagnose liver cancer metastasis, and inhibit ALDH9A1 using interfering RNA and viral vectors, the identification and treatment of liver cancer invasion and metastasis are solved, and effective diagnosis and treatment of liver cancer metastasis is achieved.

CN118853882BActive Publication Date: 2025-07-08INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410866627.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-28
Publication Date
2025-07-08
Estimated Expiration
2044-06-28

Smart Images

  • Figure CN118853882B_ABST
    Figure CN118853882B_ABST
Patent Text Reader

Abstract

The present invention provides the use of ALDH9A1 as a marker and / or therapeutic target for the invasion and metastasis of liver cancer, belonging to the technical field of biomedicine. The present invention provides the use of the ALDH9A1 gene or ALDH9A1 protein as a marker or therapeutic target for the invasion and metastasis of liver cancer. By knocking down the expression level of the ALDH9A1 gene, the metastatic and invasive abilities of primary liver cancer cell lines (HCC) can be effectively inhibited, and by promoting the expression of the ALDH9A1 gene or ALDH9A1 protein, the metastasis and invasion of HCC cell lines can be promoted. It can be seen that the ALDH9A1 gene or ALDH9A1 protein is a key target for regulating the invasion and metastasis properties of liver cancer, and the development of liver cancer metastasis diagnostic reagents or therapeutic drugs can be achieved by acting on the ALDH9A1 gene or ALDH9A1 protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to the application of ALDH9A1 as a marker and / or therapeutic target for liver cancer invasion and metastasis. Background Art

[0002] Liver cancer is the fourth leading cause of cancer-related mortality globally, and hepatocellular carcinoma (HCC) accounts for the majority of primary liver cancers. Metastasis is the main cause of death in most cancer patients. Metastasis is the process by which primary cancer cells spread to secondary sites. More and more studies have found that metastatic cancer cells selectively and dynamically adjust their metabolism in each successive multi-step involved in the metastatic process. In addition, the metabolic characteristics of many metastases are different from those of the primary tumor, enabling them to survive and grow in the new environment. Metabolic restrictions are now considered potential barriers to cancer cell metastasis. Many studies have shown that metabolites and ROS support the transformation of the cell state into a metastatic phenotype with invasive and migratory properties. In addition to ROS, some metabolites have been found to act as signaling molecules to promote epithelial-mesenchymal transition (EMT), which is related to the metastatic phenotype. For example, fumarate is an epigenetic modifier that can cause EMT transformation. In addition, some studies have provided evidence that lactate and pyruvate can promote tumor cell migration and invasion by inducing various signaling pathways. Therefore, discovering the metabolic characteristics of metastatic tumors and identifying potential metabolites that can induce EMT and promote metastasis may provide a therapeutic window for preventing or reducing metastasis.

[0003] γ-Aminobutyric acid (GABA) is a non-protein amino acid that is widely distributed in microorganisms, plants, and animals. GABA is the main inhibitory neurotransmitter in the mammalian central nervous system (CNS), but it is also present in a wide range of non-neural tissues, including the peripheral nerves and endocrine system. GABA binds to its specific transmembrane receptor and acts as an inhibitory neurotransmitter in the brain. Interestingly, in several solid tumors such as breast cancer, colon cancer, pancreatic cancer, and gastric cancer, GABA and GABA receptors have been found to be related to tumor progression. Previous studies have focused on GABA receptors, which can activate downstream signaling pathways such as the ERK, EGFR, or Wnt pathways to promote cancer cell growth. For example, GAD1-mediated GABA promotes tumor cell proliferation by activating its receptor and inhibits T cell infiltration. However, GABA has also been shown to retain the androgen receptor (AR) in the nucleus. Therefore, GABA may regulate cancer progression in a manner independent of its receptor.

[0004] The traditional GABA synthesis pathway is the GABA shuttle, in which GABA is produced from glutamate by glutamate decarboxylase (GAD1 and GAD2). Alternatively, GABA can be synthesized from putrescine by diamine oxidase (DAO) and aldehyde dehydrogenase (ALDHs), and aldehyde dehydrogenase family 9 member A1 (ALDH9A1) is the main subtype of ALDHs. It has high oxidative activity towards γ-aminobutyraldehyde, and this enzyme catalyzes the dehydrogenation of γ-aminobutyraldehyde to γ-aminobutyric acid (GABA). However, there have been no reports on the relationship between the enzymes related to the GABA synthesis pathway and liver cancer metastasis. SUMMARY OF THE INVENTION

[0005] In view of this, the object of the present invention is to provide an application of ALDH9A1 as a marker or therapeutic target for liver cancer invasion and metastasis. Since overexpression of ALDH9A1 can promote liver cancer invasion and metastasis, and knockout of ALDH9A1 can reduce the invasion and metastasis of liver cancer cells, therefore, ALDH9A1 is used as a marker or therapeutic target for liver cancer invasion and metastasis to prepare related diagnostic reagents or drugs.

[0006] The present invention provides an application of the ALDH9A1 gene or ALDH9A1 protein as a marker or therapeutic target for liver cancer invasion and metastasis.

[0007] The present invention provides an application of a reagent for detecting the expression level of the ALDH9A1 gene and / or the ALDH9A1 protein in the preparation of a diagnostic reagent or diagnostic kit for liver cancer invasion and metastasis.

[0008] Preferably, the reagent for detecting the expression level of the ALDH9A1 gene includes qPCR primers;

[0009] The qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2.

[0010] Preferably, the reagent for detecting the expression level of the ALDH9A1 protein includes an antibody against ALDH9A1.

[0011] The present invention provides an application of a reagent for knocking out or inhibiting the expression level of the ALDH9A1 gene or the ALDH9A1 protein, inhibiting the biological function of the ALDH9A1 protein and / or reducing the content of the metabolite of the ALDH9A1 protein in the preparation of a drug for preventing and / or treating liver cancer invasion and metastasis.

[0012] Preferably, the reagent for knocking out or inhibiting the expression level of the ALDH9A1 gene includes at least one of the following: small interfering RNA, sgRNA, shRNA, and a recombinant lentiviral vector or recombinant lentivirus containing the shRNA.

[0013] Preferably, the small interfering RNA includes siRNA having a nucleotide sequence as shown in SEQ ID NO:3 and / or SEQ ID NO:4;

[0014] The nucleotide sequence of the shRNA is as shown in SEQ ID NO:5.

[0015] Preferably, the reagent for inhibiting the biological function of the ALDH9A1 protein includes an inhibitor or antagonist of the ALDH9A1 protein.

[0016] Preferably, the metabolite of the ALDH9A1 protein includes gamma-aminobutyric acid.

[0017] The present invention provides an application of a reagent for promoting the expression level of the ALDH9A1 gene or the ALDH9A1 protein or a metabolite of the ALDH9A1 protein in constructing an animal model of liver cancer invasion and metastasis.

[0018] The present invention provides an application of the ALDH9A1 gene or the ALDH9A1 protein as a biomarker or therapeutic target for liver cancer invasion and metastasis. Through the analysis of the gene expression level of hepatocellular carcinoma (HCC) in situ tumors and metastatic tumors of hepatocellular carcinoma, it is obtained that compared with HCC in situ tumors, the expression levels of the ALDH9A1 gene and its encoded protein are significantly increased in metastatic tumors of HCC patients and metastatic models of mouse liver cancer. By knocking down the expression level of the ALDH9A1 gene, the results show that the metastatic and invasive abilities of the HCC cell line are inhibited, and after supplementing the ALDH9A1 metabolite GABA, the effect of the decrease in the expression level of the ALDH9A1 gene on metastasis and invasion is restored. In addition, taking the mouse model of HCC in situ tumors as an object, by knocking down the expression level of the ALDH9A1 gene in mice, the metastasis of HCC cells is inhibited, and at the same time, supplementing the ALDH9A1 metabolite GABA after knocking down ALDH9A1 can restore the effect of the decrease in ALDH9A1 on metastasis and invasion. It can be seen that the ALDH9A1 gene or the ALDH9A1 protein is a key target for regulating the invasive and metastatic properties of liver cancer, and the development of diagnostic reagents or therapeutic drugs for liver cancer metastasis can be achieved by acting on the ALDH9A1 gene or the ALDH9A1 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Expression results of ALDH9A1 in in situ (P) and metastatic sites (M) of liver cancer patients, where A. Result diagram of Real-time qPCR detection; B. Representative image of immunohistochemistry of ALDH9A1 in tissue sections; C. Result diagram of Western Blot detection; n = 10, scale bar = 50 μm;

[0020] Figure 2Representative immunohistochemical images and quantitative statistical results of ALDH9A1, divided into three cohorts of high, medium or low according to tissue scores, including 27 pairs (A, B) and 17 pairs (C, D) of primary HCC tumors (P) and metastatic tumors (M) from patients; SI: stage I, SII: stage II; SIII: stage III; scale bar = 50 μm;

[0021] Figure 3 Expression of ALDH9A1 in the primary and metastatic sites of a spontaneous metastasis mouse model of in situ liver cancer, where A. Result graph of Real-time qPCR detection; B. Result graph of Western Blot detection; C. Representative immunohistochemical image of ALDH9A1 in tissue sections; n = 3, scale bar = 50 μm;

[0022] Figure 4 Results of the effect of knocking down ALDH9A1 on the metastasis and invasion of HCC cell lines, where A and B. Effects of supplementing control and the ALDH9A1 metabolite GABA on the metastasis (A) and invasion (B) of HCC cell line Huh7 after knocking down ALDH9A1; C. Schematic diagram of Western Blot detection showing the knockdown efficiency of ALDH9A1 in Huh7; D and E. Effects of supplementing control and the ALDH9A1 metabolite GABA on the metastasis (D) and invasion (E) of HCC cell line MHCC97H after knocking down ALDH9A1; F. Result of Western Blot detection showing the knockdown efficiency of ALDH9A1 in MHCC97H;

[0023] Figure 5 Results of the effect of overexpressing ALDH9A1 on the metastasis and invasion of HCC cell lines, where A and B. Effects of supplementing control and the ALDH9A1 metabolite GABA on the metastasis (A) and invasion (B) of HCC cell line Huh7 after overexpressing ALDH9A1. C. Schematic diagram of Western Blot detection showing the overexpression efficiency of ALDH9A1 in Huh7; D and E. Effects of supplementing control and the ALDH9A1 metabolite GABA on the metastasis (D) and invasion (E) of HCC cell line MHCC97H after overexpressing ALDH9A1; F. Result of Western Blot detection showing the overexpression efficiency of ALDH9A1 in MHCC97H;

[0024] Figure 6Results of the effect of knocking down ALDH9A1 on a spontaneous metastasis mouse model of primary liver cancer. A. Whole-animal tumor results monitored by bioluminescence imaging; B. Representative bright-field images (left) and quantification (right) of HCC lung metastases, where the red arrows indicate pulmonary metastatic tumors; C. H&E (upper), Ki67 (middle), and GABA (lower) staining of lung metastatic tumor tissue sections; n = 3. Detailed implementation

[0025] The present invention provides the application of the ALDH9A1 gene or the ALDH9A1 protein as a marker or therapeutic target for the invasion and metastasis of liver cancer.

[0026]

[0027] In the present invention, the liver cancer preferably refers to hepatocellular carcinoma. The cell types of the hepatocellular carcinoma preferably include Huh7 and / or MHCC97H. The invasion and metastasis of liver cancer refer to the process in which primary cancer cells invade blood vessels, lymphatic vessels or body cavities, and are carried by the blood flow or lymph flow to another part or organ to proliferate and grow, forming a tumor of the same type as the primary tumor. In the embodiments of the present invention, two types of hepatocellular carcinoma cells, Huh7 and MHCC97H, are respectively used as objects to verify the effect of knocking out the ALDH9A1 gene or ALDH9A1 protein on inhibiting the metastasis and invasion of hepatocellular carcinoma. The ALDH9A1 gene or ALDH9A1 protein in the in-situ liver cancer cells is knocked out. The results show that knocking out the ALDH9A1 gene or protein significantly reduces the invasion and metastasis of the primary liver cancer mouse model, while simultaneously supplementing the metabolites of the ALDH9A1 protein can effectively restore the effect of the reduced ALDH9A1 expression level on liver cancer metastasis. Simultaneously overexpressing the ALDH9A1 gene or protein significantly promotes the invasion and metastasis of liver cancer. Therefore, the application of the ALDH9A1 gene or its protein as a marker and therapeutic target in the invasion and metastasis of liver cancer and other cancer types.

[0028] The present invention provides the application of a reagent for detecting the expression level of the ALDH9A1 gene and / or ALDH9A1 protein in the preparation of a diagnostic reagent or diagnostic kit for liver cancer invasion and metastasis.

[0029] In the present invention, the reagent for detecting the expression level of the ALDH9A1 gene preferably includes qPCR primers. The qPCR primers preferably include a forward primer with a nucleotide sequence shown in SEQ ID NO:1 (5'-GTCGCAGCCGCTCAATTAC-3') and a reverse primer with a nucleotide sequence shown in SEQ ID NO:2 (5'-CCTTTGCATTTTGAACAGCCAA-3'). When preparing a qPCR diagnostic kit, it preferably further includes internal reference gene primers and a qPCR detection buffer. The present invention does not impose special restrictions on the types of the internal reference genes, and the well-known types of internal reference genes in the art can be used, such as β-actin. The internal reference gene β-actin primers preferably include a forward primer with a nucleotide sequence shown in SEQ ID NO:8 (5'-CATGTACGTTGCTATCCAGGC-3') and a reverse primer with a nucleotide sequence shown in SEQ ID NO:9 (5'-CTCCTTAATGTCACGCACGAT-3').

[0030] The present invention does not impose special restrictions on the types of qPCR detection buffers, and qPCR detection buffers well-known in the art can be used, such as 2×SYBR Green Mix. The method of using the diagnostic reagent or diagnostic kit preferably includes the following steps: detecting the relative expression level of the ALDH9A1 gene in a test sample using qPCR primers, and judging the diagnostic result of the test sample based on the obtained relative expression level of the ALDH9A1 gene: when the relative expression level of the ALDH9A1 gene or its protein is significantly increased relative to the control, it indicates that liver cancer metastasis has occurred in the test sample, and re-detection is performed in combination with other medical detection means; when the relative expression level of the ALDH9A1 gene or its protein has not changed significantly relative to the control, it indicates that liver cancer cell metastasis has not occurred in the test sample.

[0031] In the present invention, the reagent for detecting the expression level of the ALDH9A1 protein preferably includes an antibody against ALDH9A1. The technique for detecting the expression level of the ALDH9A1 protein preferably includes Western Blot detection. The present invention does not impose special restrictions on the method of the Western Blot detection, and a Western Blot detection protocol well-known in the art can be used. When preparing a diagnostic kit, other reagents involved in Western Blot detection are preferably further included, such as PVDF membrane, TBST, BeyoECL Plus chromogenic solution, 5% BSA, secondary antibody and other reagents. The method for diagnosing liver cancer invasion and metastasis of the kit is the same as that of the qPCR diagnostic kit, and will not be elaborated here.

[0032] The present invention provides the use of a reagent for knocking out or inhibiting the expression level of the ALDH9A1 gene or ALDH9A1 protein, inhibiting the biological function of the ALDH9A1 protein and / or reducing the content of the metabolite of the ALDH9A1 protein in the preparation of a drug for preventing and / or treating liver cancer invasion and metastasis.

[0033] In the present invention, the reagent for knocking out or inhibiting the expression level of the ALDH9A1 gene preferably comprises at least one of the following: small interfering RNA, sgRNA, shRNA, and a recombinant lentiviral vector or recombinant lentivirus containing the shRNA. The present invention does not impose any special restrictions on the design methods of small interfering RNA, sgRNA, and shRNA, and the well-known design principles of interfering RNA in the art can be adopted. In the embodiments of the present invention, a verification experiment on the effect of knocking out the expression of the ALDH9A1 gene on liver cancer metastasis was carried out using mice as the subject. Among them, the small interfering RNA preferably comprises siRNA with a nucleotide sequence as shown in SEQ ID NO:3 and / or SEQ ID NO:4. The nucleotide sequence of the shRNA is as shown in SEQ ID NO:5. The present invention does not impose any special restrictions on the construction methods of the recombinant lentiviral vector or recombinant lentivirus containing the shRNA, and the well-known construction methods of recombinant lentiviral vectors or recombinant lentiviruses in the art can be adopted. The drug is preferably a gene drug. The present invention does not impose any special restrictions on the preparation method of the gene drug, and the well-known preparation methods of gene drugs in the art can be adopted.

[0034] In the present invention, the reagent for inhibiting the biological function of the ALDH9A1 protein preferably comprises an inhibitor of the ALDH9A1 protein. The inhibitor of the ALDH9A1 protein refers to a substance that can affect the protease activity of ALDH9A1, such as a compound that binds to the active center of the ALDH9A1 protease. The present invention does not impose any special restrictions on the types of inhibitors of the ALDH9A1 protein, and the well-known inhibitors of the ALDH9A1 protein in the art can be adopted. The dosage form of the drug is preferably an injection, powder, or dispersant. The present invention does not impose any special restrictions on the preparation method of the drug, and the well-known preparation methods of drug dosage forms in the art can be adopted.

[0035] In the present invention, the metabolite of the ALDH9A1 protein preferably comprises γ-aminobutyric acid. The present invention does not impose any special restrictions on the types of reagents for reducing the content of γ-aminobutyric acid, and the well-known reagents for reducing the content of γ-aminobutyric acid in the body in the art can be adopted.

[0036] In view of the positive correlation between the expression level of the ALDH9A1 gene or ALDH9A1 protein and liver cancer invasion and metastasis, and the fact that the metastasis of liver cancer can be promoted by replenishing the metabolite of the ALDH9A1 protein to the liver cancer cells with the ALDH9A1 gene knocked out, the present invention provides an application of a reagent for promoting the expression level of the ALDH9A1 gene or ALDH9A1 protein or the metabolite of the ALDH9A1 protein in constructing an animal model of liver cancer invasion and metastasis.

[0037] In the present invention, the reagent for promoting the expression level of the ALDH9A1 gene or the ALDH9A1 protein preferably includes an overexpression vector containing the ALDH9A1 gene or a recombinant lentivirus. The present invention has no special limitation on the construction method of the recombinant lentiviral vector or the recombinant lentivirus containing the ALDH9A1 gene, and the well-known construction methods of recombinant lentiviral vectors or recombinant lentiviruses in the art can be used.

[0038] In the present invention, the metabolite of the ALDH9A1 protein preferably includes γ-aminobutyric acid. The γ-aminobutyric acid is preferably injected into the animal body. The working concentration of the γ-aminobutyric acid is preferably 100-200 mM. The present invention has no special limitation on the animal species of the animal model, and the animal species of the well-known animal model in the art can be used, such as rats or mice.

[0039] The following combines examples to detail the application of ALDH9A1 provided by the present invention as a marker and / or therapeutic target for liver cancer invasion and metastasis, but they cannot be construed as limiting the protection scope of the present invention.

[0040] Example 1

[0041] Clinical patient detection

[0042] Using the tumor tissues of the primary tumors and metastatic tumors of 10 pairs of liver cancer patients collected, after extracting RNA and protein, the expression levels of the ALDH9A1 gene or protein were detected by qPCR and Western Blot, and at the same time, tissue sections were prepared for immunohistochemical staining of the ALDH9A1 protein. The specific steps are as follows:

[0043] 1. Total RNA extraction and real-time PCR reaction

[0044] 1.1. Total RNA extraction of tissues. Extract the total RNA of the tumor tissues according to the instructions of the Beijing Tiangen Total RNA Extraction Kit (centrifugal column type). Grind the tissues in liquid nitrogen. Add 1 ml of lysis buffer RZ to every 100 mg of tissues, homogenize with a homogenizer, and lyse the cells for 5 min. Add 200 μl of chloroform, shake vigorously for 15 s and then let stand for 3 min, and centrifuge at 12000 g for 10 min. Aspirate the upper aqueous phase, add 0.5 times the volume of absolute ethanol, mix well and add it to the CR3 centrifugal column, centrifuge at 4 °C and 12000 g for 1 min. Add 500 μl of RD Buffer deproteinizing solution, centrifuge at 4 °C and 12000 g for 1 min. Add Washbuffer and centrifuge at 4 °C and 12000 g for 1 min, wash twice. After empty centrifugation again, add 30 μL of DEPC water to dissolve, centrifuge at 4 °C and 12000 g for 2 min for elution. Measure the RNA concentration with Nanodrop and record A 260nm / A280nm Values were used to calculate the volume required for cDNA synthesis. After synthesizing cDNA using a cDNA synthesis kit, it was amplified with a fluorescence quantitative PCR kit to detect the mRNA expression level. The reverse transcription system was as follows: 1 μg of total RNA, 2 μl of 5× gDNA buffer, made up to 10 μl with DEPC water, incubated at 42 °C for 3 min, and then brought to room temperature. The above reaction system was mixed with 2 μl of 10× KingRT buffer, 1 μl of FastKing RT Enzyme Mix, 2 μl of FQ-RT Primer Mix, and 5 μl of RNase-Free ddH2O. The reaction system was incubated at 42 °C for 15 min and then at 95 °C for 3 min to obtain cDNA. Using the obtained cDNA as a template, a quantitative PCR reaction system was prepared: 10 μl of 2× SYBR Green Mix, 1 μl of cDNA template, 2 μl of primer (5 μM), and 7 μl of RNase-Free ddH2O. The Realtime-PCR primers were as follows:

[0045] hALDH9A1-F: 5’-GTCGCAGCCGCTCAATTAC-3’ (SEQ ID NO:1);

[0046] hALDH9A1-R: 5’-CCTTTGCATTTTGAACAGCCAA-3’ (SEQ ID NO:2).

[0047] Internal reference primers:

[0048] h-β-actin-F: 5'-CATGTACGTTGCTATCCAGGC-3' (SEQ ID NO:8);

[0049] h-β-actin-R: 5'-CTCCTTAATGTCACGCACGAT-3' (SEQ ID NO:9).

[0050] qPCR amplification conditions: pre-denaturation at 95 °C for 10 min, denaturation at 95 °C for 15 s, annealing / extension at 60 °C for 1 min, for 35 cycles.

[0051] 2. Protein extraction, content determination, and Western Blot analysis

[0052] Western Blot is a method that separates proteins with different molecular weights on a gel by electrophoresis and then transfers them to a PVDF (Polyvinylidene fluoride) membrane. The expression of the target protein is obtained through the specific antibody-antigen binding. The specific experimental steps are as follows:

[0053] Weigh the tissue, add 200 μl of RIPA lysis buffer (with protease inhibitor added) for every 20 mg of tissue to extract total protein. Homogenize the tissue using a homogenizer, and after lysing on ice for 30 min, centrifuge at 12,000 rpm for 10 min at 4°C to obtain the total protein of the cells.

[0054] Use a commercial BCA kit to measure the concentration of total protein in the cells. Prepare the BCA working solution by mixing A and B in a volume ratio of 50:1, incubate at 37°C for 30 min, measure the absorbance at 562 nm, and calculate the protein concentration. Mix the sample with 5× protein loading buffer in a volume ratio of 4:1, and use a metal bath for 10 min to denature the protein.

[0055] Western Blot experiment: In the experiment, use a 10% separating gel and a 5% stacking gel. After the gel solidifies, load the samples and perform electrophoresis. Electrophorese at 80 V for 30 min, then switch to 120 V and run until the electrophoresis is completed. After electrophoresis, transfer the membrane. Soak the PVDF membrane in methanol for 2 min. After assembling the transfer membrane device, add pre-cooled transfer buffer at 4°C and transfer the membrane at 350 mA for 120 min. After the transfer is completed, block with 5% BSA for 1 h and then incubate with the primary antibody. Dilute the antibody with TBST in a volume ratio of 1:1000 and incubate overnight at 4°C in the refrigerator. After the incubation with the primary antibody, wash the PVDF membrane with 1×TBST buffer solution, and incubate with the secondary antibody (diluted 1:2000) for 1 h. Take out the PVDF membrane, wash it 3 times with 1×TBST solution and then develop the color. Use an Image Quant LAS 4000 ECL gel imager to develop the color. Mix the BeyoECLPlus developing solution and the mixture of A and B (1:1, volume ratio) and add it to the surface of the PVDF membrane, set the instrument parameters for exposure to develop the color.

[0056] 3. Immunohistochemical detection

[0057] 3.1 Embed the tissue and section: Place the tissue to be embedded in paraffin, arrange it neatly, and freeze it to make the paraffin solidify. Remove the embedded tissue from the mold and place it on a paraffin microtome for sectioning.

[0058] 3.2 Bake the paraffin sections in an incubator at 60°C for 120 minutes;

[0059] Deparaffinization and hydration: Xylene (10 min) → Xylene (10 min) → Absolute ethanol (5 min × 2 times) → 95% ethanol (5 min × 2) → 90% ethanol (5 min) → 85% ethanol (5 min) → 80% ethanol (5 min) → 75% ethanol (5 min);

[0060] 3.3 Antigen retrieval: After dewaxing, rinse twice in distilled water for 5 minutes each time. Add 3% H2O2 and soak for 10 minutes to remove endogenous catalase. Then pour out the H2O2, wash twice with distilled water, add citrate buffer, and place in a microwave oven to cook for 5 minutes (medium heat), usually until just boiling. Cool to room temperature, then cook again and cool to room temperature. The purpose of cooking is to expose the antigen sites.

[0061] 3.4 Serum blocking: After cooling to room temperature, pour out the citrate buffer, wash twice with water, place the slides in PBS for 5 minutes, wash twice, dry the PBS solution around the tissue, immediately add serum to block some non-specific sites, and then place in an incubator at 37°C for half an hour. Dilute the serum 10 times (900 μl PBS: 100 μl serum blocking solution).

[0062] 3.5 Adding primary antibody: Take out the slides from the incubator, dry the serum on the front and back of the slides and around the tissue with absorbent paper, add the primary antibody. If a control experiment is done, add PBS to the control tissue. After adding the primary antibody, store overnight in a 4°C refrigerator.

[0063] 3.6 Adding secondary antibody: Take out the slides from the refrigerator, wash 3 times in PBS for 5 minutes each time, dry the PBS around the tissue and then add the secondary antibody, and then place in an incubator at 37°C for half an hour.

[0064] 3.7 Adding chromogenic agent: Take out the slides from the incubator, wash 3 times in PBS for 5 minutes each time, dry the PBS around the tissue and then add DAB chromogenic agent.

[0065] 3.8 Hematoxylin counterstaining: After rinsing the stained slides with water for a period of time, soak in hematoxylin for staining, usually for half a minute for animal tissues.

[0066] 3.9 Dehydration: After rinsing the counterstained slides in water, place the slides successively in 70% alcohol - 80% alcohol - 90% alcohol - 95% alcohol - 100% alcohol - 100% alcohol - xylene - xylene. Place in each reagent for 2 minutes, and finally soak in xylene, then move to the fume hood.

[0067] 3.10 Sealing the slides: Drop neutral balsam next to the tissue, then cover with a coverslip. First place one side flat, then gently lower the other side to avoid generating bubbles. After sealing the slides, place them in the fume hood to dry.

[0068] It was found that, compared with the in-situ tumors, the mRNA and protein levels of ALDH9A1 were significantly increased in the metastatic tumors ( Figure 1 ).

[0069] Example 2

[0070] The commercially available clinical in-situ liver cancer and metastatic liver cancer tissue microarrays were detected using immunohistochemical detection technology, and the tissue staining was scored.

[0071] The steps of immunohistochemical detection are as follows:

[0072] 1 Antigen retrieval: After dewaxing, rinse twice in distilled water for 5 minutes each time. Add 3% H2O2 and soak for 10 minutes to remove endogenous catalase. Then pour out the H2O2, wash twice with distilled water, add citrate buffer, and place in a microwave oven to steam for 5 minutes (medium heat), usually just until boiling. Cool to room temperature, then steam again and cool to room temperature. The purpose of steaming is to expose the antigen sites.

[0073] 2 Serum blocking: After cooling to room temperature, pour out the citrate buffer, wash twice with water, place the slide in PBS for 5 minutes, wash twice, dry the PBS solution around the tissue, immediately add serum to block some non-specific sites, and then place in an incubator at 37°C for half an hour. Dilute the serum 10 times (900 μl PBS and 100 μl serum blocking solution).

[0074] 3 Add primary antibody: Take out the slide from the incubator, dry the serum on the front and back of the slide around the tissue with absorbent paper, add the primary antibody. If a control experiment is done, add PBS to the control tissue. After adding the primary antibody, store it in a 4°C refrigerator overnight.

[0075] 4 Add secondary antibody: Take out the slide from the refrigerator, wash it 3 times in PBS for 5 minutes each time, dry the PBS around the tissue, and then add the secondary antibody, and then place it in an incubator at 37°C for half an hour.

[0076] 5 Add chromogenic agent: Take out the slide from the incubator, wash it 3 times in PBS for 5 minutes each time, dry the PBS around the tissue, and then add DAB chromogenic agent.

[0077] 6 Counterstain with hematoxylin: After rinsing the developed slide with water for a period of time, immerse it in hematoxylin for staining, usually for half a minute for animal tissues.

[0078] 7 Dehydration: After rinsing the counterstained slide in water, sequentially place the slide in 70% alcohol - 80% alcohol - 90% alcohol - 95% alcohol - 100% alcohol - 100% alcohol - xylene - xylene. Place it in each reagent for 2 minutes, and finally immerse it in xylene and move it to a fume hood.

[0079] 8 Coverslipping: Drop neutral balsam next to the tissue, and then cover it with a coverslip. First, lay one side flat, and then gently lower the other side to avoid generating bubbles. After covering the slide, place it in a fume hood to dry.

[0080] The results are shown in Figure 2 . According to the immunohistochemical staining of ALDH9A1, the samples were scored and divided into three groups with high, medium or low expression. It was found that compared with primary HCC tumors (P), the proportion of high expression of ALDH9A1 in metastatic tumors (M) was higher. At the same time, for liver cancer samples with higher clinical stages, the proportion of high expression of ALDH9A1 was also higher.

[0081] Example 3

[0082] Verification of the relationship between ALDH9A1 expression level and the metastasis of liver cancer cells at the animal level

[0083] 5×10 6 Huh7 cells (all expressing luciferase) were injected into the livers of mice to generate orthotopic tumors. The mice were intraperitoneally injected with the ALDH9A1 metabolite GABA (experimental group) or solvent (control group) every other day for 12 weeks. The orthotopic tumors metastasized to the lungs or intraperitoneum. After extracting RNA and proteins, qPCR and Western Blot were performed to detect the expression level of ALDH9A1 according to the method described in Example 1. At the same time, tissue sections were prepared according to the method described in Example 1 for immunohistochemical staining of ALDH9A1 protein.

[0084] The results showed that compared with orthotopic tumors, the mRNA and protein levels of ALDH9A1 in metastatic tumors were significantly increased ( Figure 3 ).

[0085] Example 4

[0086] Knockdown of ALDH9A1 inhibits the metastasis and invasion of HCC cell lines

[0087] Establishment of transient knockdown cell lines

[0088] Huh7 and MHCC97H cells in good growth state were seeded in 6-well plates. After 24 h, the cell confluence reached 70% - 80%. siRNA and RNAiMAX were added to 0.2 ml of Opti-MEM medium at a volume ratio of 1:1.5 and allowed to stand at room temperature for 5 min. Then the two were mixed separately. After 15 min, 400 μl of the mixed solution was added dropwise to the corresponding wells of the 6-well plates and shaken evenly. After incubation in the incubator for 48 h, the proteins were collected for Western Blot detection.

[0089] siRNA sequences

[0090] hALDH9A1#1-siRNA: GCAAAUCUCCACUCAUCAUTT (SEQ ID NO:3);

[0091] hALDH9A1#2 - siRNA: CCGUGUGACAAUCGAAUAUTT (SEQ ID NO:4).

[0092] Transfect siRNAs that interfere with the expression of the ALDH9A1 gene into two HCC cell lines, Huh7 and MHCC97H, and supplement GABA 24 h after transfection. Dissolve GABA powder in water to prepare a 4 M stock solution, filter and sterilize it, and add it to the cell culture medium at a final concentration of 100 mM for cell migration and invasion assays.

[0093] The results showed that knocking down the expression level of the ALDH9A1 gene could inhibit the metastasis and invasion of HCC cell lines. Meanwhile, supplementing the ALDH9A1 metabolite GABA after knocking down ALDH9A1 could restore the effect of the decrease in ALDH9A1 on metastasis and invasion ( Figure 4 ).

[0094] Example 5

[0095] Overexpression of the ALDH9A1 gene or protein promotes the metastasis of liver cancer cells

[0096] 1. Construction method of recombinant vector

[0097] Experimental steps of cDNA plasmid

[0098] Design primer fragments according to the target gene, and add restriction enzyme sites and protection bases at both ends. Using cDNA as a template, PCR amplify and synthesize the target gene fragment. The 20 μl reaction system is shown in Table 1:

[0099] Table 1 PCR amplification reaction system

[0100]

[0101] Among them, the upstream primer: GGAATTCGAATGTTTCTCCGAGCAGGCC (SEQ ID NO:10);

[0102] The downstream primer: CGGGATCCTCAAAAAGCAGATTCCACAT (SEQ ID NO:11).

[0103] After mixing the reaction system, put it into a PCR instrument, set appropriate annealing temperature and cycle number for amplification of the target fragment.

[0104] 2) Gel recovery of the target fragment. Perform DNA agarose gel electrophoresis on the target fragment, cut off the target fragment under ultraviolet light, and recover and purify it according to the instructions of the agarose gel electrophoresis recovery kit (Tiangen).

[0105] 3) Restriction digestion. The recovered target product and 0.5 μg of empty plasmid were subjected to restriction digestion using restriction endonucleases from NEB. The digestion conditions were 37 °C for 4 h. The 20 μl restriction digestion system is shown in Table 2:

[0106] Table 2 Restriction digestion system

[0107]

[0108] After the restriction digestion was completed, the digested target fragment was recovered by DNA gel extraction and then ligated.

[0109] 4) Ligation. The digested target gene fragment was ligated to the empty vector using T4 ligase. Ligation was carried out overnight at 16 °C. The 10 μl ligation system is shown in Table 3:

[0110] Table 3 Ligation system

[0111]

[0112] 5) Transformation. The competent Trans5α cells were mixed with the ligation product, incubated on ice for 30 min, heat shocked at 42 °C for 50 s, and then incubated on ice for another 2 min. After that, 500 μl of LB medium was added. The mixture was placed on a shaker at 37 °C for 1 h, and then 200 μl was taken and spread on an LB plate containing ampicillin. The plate was incubated at 37 °C for 16 h.

[0113] 6) Pick monoclonal colonies and place them in liquid LB medium containing ampicillin. Incubate with shaking at 37 °C for 16 h.

[0114] 7) Mini-prep of plasmid. The bacterial culture was collected by centrifugation, and the plasmid was extracted using a rapid mini-prep kit from Tiangen Biotech. After concentration detection and restriction digestion identification, the plasmid samples were sent to the company for sequencing. The plasmid samples that were completely matched with the target gene were used for subsequent experiments.

[0115] 2. Lentivirus packaging: Seed 293T cells in a 10 cm culture dish at an inoculation density of 80 - 90%. After the cells adhered, transfection was carried out. Mix 4 μg of cDNA plasmid, 3 μg of helper plasmid VSVG, and 2 μg of psPAX2 with 200 μl of Opti-MEM. At the same time, mix 3000 with 200 μl of Opti-MEM. After standing for 15 min, mix the two, stand for another 15 min, then add the mixture dropwise to the cell culture dish, and then add 2 ml of Opti-MEM. After 6 h, add complete medium and culture in an incubator. After 72 h, collect the culture supernatant, filter it through a 0.45 μm filter membrane, and use it for cell infection.

[0116] 3. Cell infection and establishment of stable cell lines: Add 1 ml of the collected virus and 1 ml of medium to the cells to be infected, and simultaneously add 2 μl of 4 μg / ml polybrene to enhance the infection efficiency. After 24 h, replace with fresh medium, and simultaneously add puromycin (2 mg / ml) for screening, and supplement GABA. The GABA supplementation dose is a final concentration of 100 mM. After 7 days, detect the infection efficiency by western blot.

[0117] The results showed that overexpression of ALDH9A1 promoted the metastasis and invasion of HCC cell lines in two HCC cell lines, Huh7 and MHCC97H. Meanwhile, supplementation with the ALDH9A1 metabolite GABA after overexpression of ALDH9A1 could further promote cell metastasis and invasion ( Figure 5 ).

[0118] Example 6

[0119] Knockdown of ALDH9A1 inhibits spontaneous metastasis in a mouse model of orthotopic liver cancer

[0120] 1. Construction method of shRNA plasmid

[0121] 1) The DNA sequence corresponding to the shRNA for knocking down ALDH9A1 is as follows:

[0122] shALDH9A1: 5'-CCCAAATTAAAGGATGGATAT-3' (SEQ ID NO:5).

[0123] Synthesize the upstream fragment and downstream fragment according to the DNA sequence of the shRNA of ALDH9A1, and dissolve the upstream and downstream fragments of the shRNA in water to 10 μM. Mix the upstream and downstream primers, and the reaction system (50 μl) is shown in Table 4:

[0124] Table 4 shRNA fragment hybridization system

[0125]

[0126] The annealing reaction conditions are shown in Table 5.

[0127] Table 5 Annealing reaction conditions

[0128]

[0129] 2) Enzyme digestion. Digest the mixed product after PCR annealing and the plko.1 empty vector with restriction endonucleases AgeI and EcoRI for 4 h.

[0130] 3) Ligation. Carry out a ligation reaction on the digested PCR mixed product and the plko.1 empty vector. Ligate overnight at 16°C.

[0131] The system (15 μl) is shown in Table 6 as follows:

[0132] Table 6 Ligation system

[0133]

[0134] 4) Transformation. Mix the competent Trans5α with the ligation product, incubate on ice for 30 min, heat shock at 42 °C for 50 s, then incubate on ice for another 2 min. After that, add 500 μl of LB medium. After placing it on a shaker at 37 °C for 1 h, take 200 μl and spread it on an LB plate containing ampicillin, and place it at 37 °C for 16 h.

[0135] 5) Pick monoclonal colonies and put them into liquid LB medium containing ampicillin, and shake at 37 °C for 16 h.

[0136] 6) Mini-prep of plasmid. Centrifuge to collect the bacterial liquid, and extract the plasmid using the Tiangen Biotech rapid mini-prep kit. After concentration detection and enzymatic digestion identification, send it to the company for sequencing. The plasmid samples that are completely matched with the target gene are used for subsequent experiments.

[0137] 2. Lentivirus packaging: Seed 293T cells in a 10-cm culture dish with an inoculation density of 80 - 90%. After the cells adhere, perform transfection. Mix the shRNA plasmid (4 μg), the helper plasmid VSVG (3 μg), and psPAX2 (2 μg) with Opti-MEM (200 μl). At the same time, mix 3000 with 200 μl of Opti-MEM, let it stand for 15 min, then mix the two, let it stand for 15 min and then add it dropwise to the cell culture dish. Then add 2 ml of Opti-MEM. After 6 h, add the complete medium and culture in an incubator. After 72 h, collect the culture supernatant, filter it through a 0.45-μm filter membrane and use it for cell infection.

[0138] 3. Cell infection and establishment of stable transfected cell line: Add 1 ml of the collected virus and 1 ml of medium to the cells to be infected, and at the same time add 2 μl of 4 μg / ml polybrene to enhance the infection efficiency. After 24 h, change to fresh medium and add puromycin (2 mg / ml) for screening. After 7 days, detect the infection efficiency by western blot. Expand the culture.

[0139] 4. Construction of orthotopic tumor animal model

[0140] Add 5×10 6Huh7 cells (both expressing luciferase) stably expressing control shRNA or ALDH9A1 shRNA were injected into the livers of mice to generate orthotopic tumors. The mice were intraperitoneally injected with the ALDH9A1 metabolite GABA (injection dose: 50 mg / kg) or solvent every other day for 12 weeks. The orthotopic tumors metastasized to the lungs or intraperitoneum. Whole-animal tumors were monitored by bioluminescence imaging, and the number of metastatic tumors was counted. At the same time, immunohistochemical staining was performed on tissue sections of lung metastatic tumors.

[0141] The results showed that knocking down the expression level of ALDH9A1 protein could effectively inhibit the metastasis of the orthotopic hepatocellular carcinoma cell line (HCC). At the same time, supplementing the ALDH9A1 metabolite GABA after knocking down ALDH9A1 could restore the effect of the decrease in ALDH9A1 on metastasis and invasion ( Figure 6 ).

[0142] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the expression level of ALDH9A1 gene and / or ALDH9A1 protein in the preparation of a diagnostic reagent or diagnostic kit for liver cancer invasion and metastasis.

2. The application according to claim 1, characterized in that, The reagent for detecting the expression level of ALDH9A1 gene includes qPCR primers; The qPCR primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

2.

3. The application according to claim 1, wherein The reagent for detecting the expression level of ALDH9A1 protein includes an antibody against ALDH9A1.

4. Use of a reagent for knocking out or inhibiting ALDH9A1 gene in the preparation of a drug for preventing and / or treating liver cancer invasion and metastasis, wherein the reagent is small interfering RNA and / or shRNA; the small interfering RNA includes siRNA with a nucleotide sequence as shown in SEQ ID NO:3 and / or SEQ ID NO:4; the nucleotide sequence of the shRNA is as shown in SEQ ID NO:

5.

5. Use of a metabolite of ALDH9A1 protein in the construction of an animal model for liver cancer invasion and metastasis, wherein the metabolite of ALDH9A1 protein is γ-aminobutyric acid; The cell type of the liver cancer is Huh7.