A SNP molecular marker related to high temperature resistance of cotton anthers and its application

Abstract

The present invention provides a SNP molecular marker related to high temperature resistance of cotton anthers and its application, belonging to the technical field of cotton breeding. The present invention provides a SNP molecular marker related to high temperature resistance of cotton anthers, the physical position of the SNP molecular marker is the 55462867th base of chromosome D01 of the upland cotton genome, wherein the polymorphism of the deoxynucleotide of the 55462867th base of chromosome D01 of the upland cotton genome is G or A. The SNP molecular marker of the present invention is located in the downstream regulatory region of the GhMucin17-like locus and is closely linked to the high temperature resistance phenotype. The SNP molecular marker can be used to realize the rapid identification of high temperature resistance of cotton germplasm, accurately judge whether the cotton germplasm to be tested has high temperature resistance, convenient and efficient, and provide a technical basis and support for cotton breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of cotton breeding, and particularly relates to a SNP molecular marker related to high temperature resistance of cotton anthers and an application thereof. Background Art

[0002] Tetraploid upland cotton (Gossypium hirsutum) has high yield and is currently the most widely cultivated fiber crop in the world. It is an important part of the world economy and has important strategic significance. In recent years, global temperatures have continued to rise. Under extreme high temperature weather, cotton has shown male sterility phenotypes such as pollen inactivation and anther non-dehiscence, resulting in a significant drop in yield, which seriously affects the national economy. Therefore, it is urgent to cultivate high temperature resistant cotton germplasm and promote the stable development of the cotton industry.

[0003] Anther dehiscence is an important phenotype of cotton's male reproductive organs, and it is extremely susceptible to high temperatures. Whether the anther can dehiscence normally is closely related to cotton pollination, fertilization, and the final fiber yield. The traditional phenotypic investigation method usually involves field planting and collecting field data to investigate anther traits. Due to the special anther structure of cotton, the number of anthers is large and they grow in clusters. This type of investigation method has the disadvantages of large workload, high cost, long cycle, and is affected by human errors and the environment. The development of molecular biology technology has enabled germplasm resources and variety identification to enter the molecular level. Molecular markers based on DNA polymorphism have become a powerful tool for analyzing biological genetic diversity, which can quickly assist breeding, reduce cost input, and shorten the breeding period.

[0004] With the development of whole genome sequencing and resequencing technology, the development and utilization of SNP sites have been successfully applied in soybeans, rice, and potatoes. However, the genetic resources of cultivated varieties of upland cotton are narrow, and the innovation of germplasm resources and the breeding of new varieties are developing slowly. At the same time, due to the complexity of cotton's high temperature resistance phenotype and the many influencing factors, the molecular markers currently used to evaluate and detect cotton anther high temperature resistance are limited. Summary of the invention

[0005] In view of the defects in the prior art, the object of the present invention is to provide a SNP molecular marker related to high temperature resistance of cotton anthers, which can be used to efficiently distinguish between high temperature resistant cotton germplasm and high temperature sensitive cotton germplasm.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] The invention provides a SNP molecular marker related to high temperature resistance of cotton anthers. The physical position of the SNP molecular marker is the 55462867th base of chromosome D01 of the upland cotton (Gossypium hirsutum) genome, wherein the polymorphism of the deoxynucleotide of the 55462867th base of chromosome D01 of the upland cotton genome is G or A.

[0008] Preferably, the nucleotide sequence comprising the SNP molecular marker is as shown in SEQ ID NO.1.

[0009] Preferably, the cotton comprises upland cotton.

[0010] The present invention provides a KASP-marked primer based on the SNP molecular marker described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the KASP-marked primer are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

[0011] The present invention provides a kit for detecting high temperature resistance of cotton, characterized in that the kit comprises the KASP-labeled primers and PCR amplification reagents described in the above technical solution.

[0012] Preferably, the PCR amplification reagent comprises Taq DNA polymerase, dNTPs and a buffer reagent.

[0013] The present invention provides the use of the SNP molecular marker described in the above technical solution, the primer of the KASP marker described in the above technical solution or the kit described in the above technical solution in the detection of high temperature resistance of cotton.

[0014] The present invention provides a method for detecting high temperature resistance of cotton, comprising the following steps:

[0015] Using the KASP-labeled primers described in the above technical solution to perform PCR amplification on the genomic DNA of the cotton germplasm to be tested to obtain a PCR amplification product;

[0016] The PCR amplification product is subjected to electrophoresis detection. When the PCR amplification product can specifically amplify a band and contains a 546 bp band pattern, the cotton germplasm to be tested is a high temperature resistant cotton germplasm;

[0017] When the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 546 bp band pattern, the cotton germplasm to be tested is a high temperature sensitive cotton germplasm.

[0018] Preferably, the annealing temperature during the PCR amplification is 66-68°C.

[0019] The present invention provides the use of the SNP molecular markers described in the above technical solution, the primers of the KASP markers described in the above technical solution, the kit described in the above technical solution or the method described in the above technical solution in cotton breeding and / or assisted breeding.

[0020] Beneficial effects of the present invention:

[0021] The present invention provides a SNP molecular marker related to high temperature resistance of cotton anthers, wherein the physical position of the SNP molecular marker is the base 55462867 of chromosome D01 of the upland cotton (Gossypium hirsutum) genome, wherein the polymorphism of the deoxynucleotide of the base 55462867 of chromosome D01 of the upland cotton genome is G or A. The inventors previously used 510 resequenced natural populations of upland cotton germplasms, collected anther images under normal and high temperature conditions at multiple points over many years, evaluated the heat resistance index of anther cracking, identified the main effect QTLs affecting cotton anther cracking under high temperature, and cloned one of the genes GhMucin17-like regulating high temperature resistance in sensitive high temperature varieties. By analyzing the individual sequences of GhMucin17-like in the natural population, natural variations linked to the high temperature resistance phenotype were found in its downstream regulatory sequences, and markers were developed accordingly. The physical location of the SNP molecular marker of the present invention is the 55462867th base of chromosome D01 of the upland cotton genome, which is located in the downstream regulatory region of the Ghir_D01G018440 (GhMucin17-like) locus, and is closely linked to the high temperature resistance phenotype. The SNP molecular marker can be used to quickly identify the high temperature resistance of cotton germplasm, that is, only the genomic DNA of the cotton germplasm to be tested needs to be used as a template for PCR amplification, and the molecular marker banding can be used to accurately determine whether the cotton germplasm to be tested has high temperature resistance, which is convenient and efficient, and provides a technical basis and support for cotton breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0023] Figure 1 It is the location map of SNP distribution in the gene GhMucin17-like;

[0024] Figure 2 This is a SNP variation validation diagram based on Jimian 12 and Liaomian 6 varieties;

[0025] Figure 3 To develop a map for annealing-sensitive KASP markers targeting the SNP variation (A->G) at the physical position of 55462867 bp in the downstream regulatory region;

[0026] Figure 4 This is a diagram showing the validation results of GhMucin17-like KASP markers in natural populations of high temperature resistant / sensitive materials. DETAILED DESCRIPTION

[0027] The invention provides a SNP molecular marker related to high temperature resistance of cotton anthers, wherein the physical position of the SNP molecular marker is the 55462867th base of chromosome D01 of the upland cotton genome, wherein the polymorphism of the deoxynucleotide of the 55462867th base of chromosome D01 of the upland cotton genome is G or A.

[0028] The inventors previously used a natural population of 510 resequenced upland cotton germplasms to collect anther images under normal and high temperature conditions for many years, evaluate the heat resistance index of anther cracking, identify the main QTLs that affect cotton anther cracking under high temperature, and clone one of the genes regulating high temperature resistance, GhMucin17-like, in sensitive and high temperature varieties. By analyzing the individual sequences of GhMucin17-like in natural populations, natural variations linked to the high temperature resistance phenotype were found in its downstream regulatory sequences, and markers were developed accordingly.

[0029] In the present invention, the cotton preferably includes upland cotton. In the present invention, the SNP molecular marker is a SNP variation located in the downstream regulatory region of the upland cotton GhMucin17-like gene, and the physical position of the SNP variation is the 55462867th base of chromosome D01 of the upland cotton genome, and there is an allele variation of A->G compared with the reference genome. In the present invention, the SNP molecular marker is tightly linked to the high temperature resistance phenotype. In the present invention, when the SNP molecular marker is G, the cotton germplasm to be tested is a high temperature resistant cotton germplasm; when the SNP molecular marker is A, the cotton germplasm to be tested is a high temperature sensitive cotton germplasm. The SNP molecular marker described in the present invention can directly detect the genotype of the site, and then determine whether the cotton germplasm is a high temperature resistant germplasm or a high temperature sensitive germplasm.

[0030] In the present invention, the nucleotide sequence of the SNP molecular marker described in the above technical solution is shown as SEQ ID NO.1.

[0031] The present invention provides a KASP-marked primer based on the SNP molecular marker described in the above technical solution, and the nucleotide sequences of the upstream primer and the downstream primer of the KASP-marked primer are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively.

[0032] In the present invention, the primers of the KASP marker are designed based on the SNP molecular marker, and the upstream primers are set from the physical position of the SNP molecular marker forward, so that the 3' end of the upstream primer is the G base in the SNP molecular marker. In the present invention, the annealing temperatures of the upstream primer and the downstream primer of the KASP marker are designed to be around 57°C. By setting a suitable annealing temperature, the primers of the KASP marker can specifically amplify the fragments with the SNP molecular marker G, but cannot amplify the fragments with the SNP molecular marker A, so as to realize the identification of high temperature resistance of cotton germplasm and efficiently distinguish high temperature resistant cotton germplasm from high temperature sensitive cotton germplasm.

[0033] The present invention provides a kit for detecting high temperature resistance of cotton, the kit comprising the KASP-labeled primers and PCR amplification reagents described in the above technical solution. In the present invention, the PCR amplification reagent preferably comprises Taq DNA polymerase, dNTPs and a buffer reagent. In the present invention, the buffer reagent preferably comprises 10×Buffer. The present invention has no special limitation on the source of the PCR amplification reagent, and conventional commercial products in the art can be used. The PCR amplification reagent of the present invention preferably also comprises ddH2O. The present invention has no special limitation on the total amount of the PCR amplification reagent and the total amount of the primers in the kit, as well as the concentration of the primers, and they can be set according to the conventional requirements of the kit.

[0034] The present invention provides the use of the SNP molecular markers described in the above technical solution, the primers of the KASP markers described in the above technical solution, or the kit described in the above technical solution in the detection of high temperature resistance of cotton. The present invention uses the SNP molecular markers, the primers of the KASP markers, or the kit to identify the high temperature resistance of cotton germplasm, efficiently distinguish high temperature resistant cotton germplasm from high temperature sensitive cotton germplasm, and has high accuracy.

[0035] The present invention provides a method for detecting high temperature resistance of cotton, comprising the following steps:

[0036] Using the KASP-labeled primers described in the above technical solution to perform PCR amplification on the genomic DNA of the cotton germplasm to be tested to obtain a PCR amplification product;

[0037] The PCR amplification product is subjected to electrophoresis detection. When the PCR amplification product can specifically amplify a band and contains a 546 bp band pattern, the cotton germplasm to be tested is a high temperature resistant cotton germplasm;

[0038] When the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 546 bp band pattern, the cotton germplasm to be tested is a high temperature sensitive cotton germplasm.

[0039] The present invention utilizes the KASP-labeled primers described in the above technical solution to perform PCR amplification on the genomic DNA of the cotton germplasm to be tested to obtain a PCR amplification product.

[0040] The present invention preferably extracts the genomic DNA of the cotton germplasm to be tested first. The present invention does not specifically limit the method for extracting the genomic DNA, and the commonly used genomic DNA extraction method or genomic DNA extraction kit in the art can be used, such as the CTAB extraction method used in the embodiment of the present invention. After obtaining the genomic DNA of the cotton planted to be tested, the present invention uses the KASP-labeled primers to perform PCR amplification on the genomic DNA of the cotton germplasm to be tested. In the present invention, the PCR amplification system is 20 μL, preferably including the following components: 10×buffer 2.0 μL, dNTP mix 0.3 μL, Taq DNA polymerase 0.2 μL, genomic DNA 1 μL (75-100 ng), upstream primer 0.5 μL, downstream primer 0.5 μL and ddH2O 15.5 μL. The annealing temperature during the PCR amplification of the present invention is preferably 66-68°C, more preferably 66-67°C, and more preferably 66°C. The PCR amplification program of the present invention is preferably pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 66-68°C for 30 s, extension at 70-72°C for 30 s, and cycled 35 times; and final extension at 72°C for 30 s.

[0041] After obtaining the PCR amplification product, the PCR amplification product is subjected to electrophoresis detection. When the PCR amplification product can specifically amplify a band and contains a 546bp band pattern, the cotton germplasm to be tested is a high temperature resistant cotton germplasm; when the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 546bp band pattern, the cotton germplasm to be tested is a high temperature sensitive cotton germplasm. In the present invention, the sequence corresponding to the 546bp band pattern is preferably as shown in SEQ ID NO.6.

[0042] The present invention also provides the use of the SNP molecular markers described in the above technical solution, the primers of the KASP markers described in the above technical solution, the kits described in the above technical solution or the methods described in the above technical solution in cotton breeding and / or assisted breeding. The present invention uses the SNP molecular markers, the primers of the KASP markers, the kits or the methods to screen high temperature resistant cotton germplasm, which can be applied to cotton breeding and / or assisted cotton breeding.

[0043] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0044] Example 1

[0045] Analysis of natural variation of GhMucin17-like gene

[0046] First, we used the publicly published resequencing data of 376 upland cotton samples to construct a natural variation map of upland cotton (DOI: 10.1038 / s41588-021-00844-9); combined with the laboratory's multi-point collection of anther dehiscence phenotypes under normal and high temperature conditions for many years, we retrieved the variation information on the Ghir_D01G018440 (GhMucin17-like) locus (including 1500bp before the start codon and 1500bp after the stop codon). We found that there were 4 SNP variations in the GhMucin17-like locus, one in the 5'-UTR, one in the fourth exon, one in the 3'-UTR, and one in the downstream regulatory region, see for details. Figure 1 and Table 1.

[0047] Figure 1 The four SNPs in Table 1 are highly linked in natural populations. In this example, marker development was performed for the SNP in the regulatory region (at the physical position of 55462867 bp).

[0048] Table 1 Summary of natural population variation information

[0049]

[0050] Note: The categories in the table header represent Type: variant type; Pos: physical position in the genome; Ref: reference genotype; Alt: variant genotype; Dist to ATG: physical distance from the start codon; Dehiscence_ref_mean: average anther dehiscence heat resistance index of reference genotype cotton materials; Dehiscence_alt_mean: average anther dehiscence heat resistance index of variant genotype cotton materials; T.test_p: T-test p value of the relative heat resistance index of anther dehiscence of two genotypes.

[0051] Example 2

[0052] Molecular marker development

[0053] 1. Verification of molecular marker authenticity (taking 55462867bp physical position A->G as an example)

[0054] According to the material information and the corresponding genotype information in the variation map of Example 1, one material each with the genotype of 55462867bp position being A and one material each being G were selected. In this example, two materials, Jimian 12 (A) and Liaomian 6 (G), were used for molecular marker amplification, and the main steps were as follows:

[0055] (1) Design PCR primers based on the GhMucin17-like regulatory sequence and marker position in SEQ ID NO.1.

[0056] The nucleotide sequence of SEQ ID NO.1 is as follows:

[0057] CCAACATCCAAAATAACTCAAAAGATCTACCAAAACAAGATATGGATAGTGTGTATGCTCTGACTTGAATGGTTTAATCATTTCAGTGATTGGTTTACAGCAGATTGA GTCTTAGCTTGACTGGCATGA GCATTGTTGTCAATGCAGGAGGATGTGGGTTCGAATGC A TTAAAGTGTATTACTCTCCTATT TATGGGTTGGGAGGGGCTAT GAGTAGTTCTAAGTATTGTGTCGAAGAGAGCAAATATGATCAAAACCTAAAATGAGATTATTAAAAAGAGAGAGAGAGATTGGTTTACATGTTAAAATTTAAAGAAAATTGGAAGATCTGTAAATAAAGAAAATTGGAAGATCTTAAAGTTGTGAATTATAGCTATGATTTTCTTGTTCTTTTTAAATG.

[0058] The bold and underlined position is the position of the SNP variation, which undergoes an A->G mutation compared to the reference genome and is located at 55462867bp on chromosome D01 of the upland cotton genome. The version of the cotton genome is 'TM-1_HAU-AD1_v1.1' and can be openly obtained from the CottonGen database at https: / / www.cottongen.org / data / download / genome_tetraploid / AD1.

[0059] The upstream primer in the PCR primers is shown in SEQ ID NO.2, specifically: 5'-GTCTTAGCTTGACTGGCATGA-3'; the downstream primer is shown in SEQ ID NO.3, specifically: 5'-ATAGCCCCTCCCAACCCATA-3'.

[0060] (2) The CTAB method was used to extract the genomic DNA of Jimian 12 (A) and Liaomian 6 (G) materials. Fresh leaves were placed in a 2 mL centrifuge tube, clean steel beads and 200 μL extraction buffer (0.35 M glucose, 0.1 M Tris-HCl, 0.005 M Na2EDTA, 2% PVP K-30 and 0.1% DIECA, PH = 7.5) were added, and the leaves were placed in a grinder (Shanghai Jingxin # Tissuelyser-192) for 60 s at a frequency of 60 Hz; after grinding, 800 μL lysis buffer (0.1 M Tris-HCl, 1.4 M NaCl, 0.02 M Na2EDTA, 2% CTAB, 2% PVP K-30 and 0.1% DIECA, PH = 7.5) was added. 8.0); After 30 minutes in a 65℃ water bath, add 800μL chloroform (chloroform: isoamyl alcohol volume ratio is 24:1), gently invert, and extract for 20 minutes; after centrifugation at 12000rpm for 8-10 minutes, transfer the supernatant and mix it with an equal volume of -20℃ pre-cooled isopropanol. After mixing, flocculent DNA precipitates will appear; use 75% volume ethanol to wash the DNA twice, blow dry in a clean bench, and use ddH2O to dissolve the DNA. Use the PCR primers designed in the above step (1), configure the PCR system according to the formula in Table 2, and perform PCR amplification according to the program in Table 3.

[0061] Table 2 PCR system

[0062] Components volume Genomic DNA 1μL (75~100ng loading volume) 10xBuffer 2μL Upstream Primer-F 0.5μL Upstream Primer-R 0.5μL dNTPmix 0.3μL Taq enzyme 0.2μL ddH2O 15.5μL Total volume 20μL

[0063] Table 3 PCR program

[0064]

[0065]

[0066] (3) After PCR, the product was cloned into the entry vector pTOPO-T (Aidlab #CV2101), heat-shocked to the competent E. coli DH5α, and 4 to 5 single clones were selected for product sequencing using the M13F universal primer to confirm the authenticity of the marker SNP in the sequence. Figure 2 shown.

[0067] Depend on Figure 2It can be concluded that the genotype of Jimian 12 at the physical position of 55462867bp is A and the genotype of Liaomian 6 at the physical position of 55462867bp is G; thus confirming the presence of marker SNP variation. The genotype of Jimian 12 at the physical position of 55462867bp is A, which is a high temperature sensitive genotype; the genotype of Liaomian 6 at the physical position of 55462867bp is G, which is a high temperature resistant genotype.

[0068] 2. Design of optimal primer sequence and annealing temperature

[0069] After confirming the authenticity of the marker, the number of materials was increased to explore the optimal primer sequence and annealing temperature. In this embodiment, according to the annealing sensitivity KASP marker design principle, Figure 3 For primer design and marker development, the steps are as follows:

[0070] (1) On the sequence of the sequencing result, keep the reverse primer unchanged, start from the physical position of 55462867bp, design the forward primer, make the 3' end of the forward primer a G base, and set the reverse primer at the same time. The annealing temperature of the forward primer and the reverse primer are designed to be around 57°C. The nucleotide sequence of the upstream primer (i.e., the forward primer) of the KASP marker primer is shown in SEQ ID NO.4, specifically: 5'-AGGATGTGGGTTCGAATGCG-3'; the nucleotide sequence of the downstream primer (i.e., the reverse primer) is shown in SEQ ID NO.5, specifically: 5'-CGGCAAAGAGGTCTCAAAGT-3'. The nucleotide sequence of the fragment amplified by the upstream and downstream primers is shown in SEQ ID NO.6, specifically: 5'-AGGATGTGGGTTCGAATGCATTAAAGTGTATTACTCTCCTATTTATGGGTTG GGAGGGGCTATGAGTAGTTCTAAGTATTGTGTCGAAGAGAGCAAATATGATCAAAACCTAAAATGAGATTATTAAAAAGAGAGAGAGATTGGTTTACATGTTAAAATTTAAAGAAAATTGGAAGATCTGTAAATAAAGAAAATTGGAAGATCTTAAAGTTGTGAATTATAGCTATGATTTTCTTGTTCTTTTTAAATGTCAAATGCATTTGATCACGCAAACACGATTTCCCACATGCTATTTGTGT AGATTCAAAAAGATGGATCATTTCATGGACAAACCTAATAGTAATTGTTCCCCTCCTTTTCACTTTTTTCATCTTTGAAAAACCCAAATGCAAACAAAAACTTTAAAACTATTCATCTAAACCTTAGGTTTAAATCACAATGTCAGCATCGTTAGGTGTGAGGATCAATTCTAGAACATTCAACTAAGATAACACTAATTATAATTAATGAGGATTTAAATCCTAACTTTGAGACCTCTTTGCCG-3'. Note: The target sequence amplified when the bold A in SEQ ID NO.6 is replaced by base C is SEQ ID NO.4 and SEQ ID NO.5 as primers.

[0071] (2) Expand the range of materials. According to the genetic variation map in Example 1, six materials with genotype G, namely Yumian 1, Xiangmian 13, Junmian 1, Xinluzao 32, NC20B and Jiangsumian 1, and six materials with genotype A, namely Liaomian 10, Liaomian 11, Liaomian 12, Jinmian 12, Jinmian 13 and Jinmian 18, were selected (Table 4).

[0072] Table 4 Upland cotton material information 1

[0073] Material Name Chinese name source Yumian1 Yumian No.1 my country's independent breeding Xiangmian13 Hunan Cotton No. 13 my country's independent breeding Junmian1 Military Cotton No. 1 my country's independent breeding Xinluzao32 Xinlu Zao No. 32 my country's independent breeding NC20B NC20B Introduction of American Cotton Jiangsumian1 Jiangsu Cotton No. 1 my country's independent breeding Liaomian10 Liaomian No. 10 my country's independent breeding Liaomian11 Liaomian No.11 my country's independent breeding Liaomian12 Liaomian No. 12 my country's independent breeding Jinmian12 Jinmian No. 12 my country's independent breeding Jinmian13 Jinmian No. 13 my country's independent breeding Jinmian18 Jinmian No. 18 my country's independent breeding

[0074] The genomic DNA of the 12 cotton materials was extracted using the CTAB method, using the same method as above.

[0075] After obtaining the genomic DNA of the above 12 cotton materials, the KASP labeled primers designed in step (1) were used to perform PCR on the genomic DNA of the above 12 materials according to the PCR system in Table 2 and the PCR program in Table 3 in Example 2, and the annealing temperature in Table 3 was modified to perform a gradient annealing experiment from 62°C to 68°C with an interval of 1°C. That is, the annealing temperatures were set to 62°C, 63°C, 64°C, 65°C, 66°C, 67°C and 68°C, respectively. After the PCR reaction was completed, the PCR product was obtained, and the PCR product was subjected to electrophoresis detection. The detection results are as follows: Figure 3 As shown in b.

[0076] Depend on Figure 3 From the analysis of b, it can be seen that 12 materials with different genotypes were amplified by molecular markers, among which Yumian 1, Xiangmian 13, Junmian 1, Xinluzao 32, NC20B and Jiangsumian 1 were genotype G, and Liaomian 10, Liaomian 11, Liaomian 12, Jinmian 12, Jinmian 13 and Jinmian 18 were genotype A. At the annealing temperature of 66-68°C, the primer with a G base at the 3' end could not anneal with the sequence of genotype A. According to the PCR amplification results, at the annealing temperature of 66-68°C, the material with genotype G could amplify the band normally, and the material with genotype A basically had no PCR product. In order to ensure the authenticity of the amplification results, 66°C was finally selected as the optimal annealing temperature.

[0077] Example 3

[0078] Validation of molecular markers at the natural population level

[0079] Example 2 confirmed the authenticity of the marker and explored the optimal annealing temperature and KASP marker primer sequence. In this example, the annealing temperature and KASP marker primer sequence confirmed in Example 2 were used, and according to the average anther dehiscence heat resistance index vitality phenotype data of the natural population, 24 high temperature resistant materials and 24 high temperature sensitive materials were randomly selected (Table 5) to extract DNA.

[0080] Table 5 Upland cotton material information

[0081]

[0082]

[0083]

[0084] Using KASP labeled primers according to the PCR system in Table 2 and the PCR program in Table 3, at an annealing temperature of 66°C, the 55462867bp physical position of the above 48 varieties of materials was labeled and amplified. After the PCR reaction was completed, the PCR product was obtained and the PCR product was detected by electrophoresis. The detection results are as follows: Figure 4 shown. Figure 4 a in the figure is the amplification result of 24 high temperature resistant materials, and the asterisk indicates the material with unclear or non-specific amplification; Figure 4 The b in the figure shows the amplification results of 24 high temperature sensitive materials, and the asterisk indicates the material with obvious or specific amplification.

[0085] Depend on Figure 4 It can be analyzed that the PCR results show that 23 materials can amplify specific bands in the high temperature resistant materials, and 1 material has a shallow band amplification or non-specific amplification (such as Figure 4 a); 4 samples of the high temperature sensitive materials could amplify specific bands, and 20 samples of the materials had shallow bands or non-specific amplification ( Figure 4 b). According to the chi-square test, the amplification efficiency between the high temperature resistant material and the high temperature sensitive material was significantly different, with a p value of 3.242e-08.

[0086] It can be concluded from the results of the above examples that the SNP molecular markers provided by the present invention and the primers developed based on the SNP molecular markers can detect high temperature resistance of upland cotton and effectively distinguish between high temperature resistant cotton germplasm and high temperature sensitive cotton germplasm.

[0087] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker related to high temperature resistance of cotton anthers, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the SNP is located at the 168 bp base of SEQ ID NO.1; and the polymorphism of the SNP is G or A.

2. A primer based on the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequences of the upstream primer and the downstream primer of the primer are shown as SEQ ID NO.4 and SEQ ID NO.5 respectively.

3. A kit for detecting high temperature resistance of cotton, characterized in that: The kit comprises the primers according to claim 2 and a PCR amplification reagent.

4. The kit according to claim 3, characterized in that The PCR amplification reagents include Taq DNA polymerase, dNTPs and a buffer reagent.

5. Use of the SNP molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 3 or 4 in the detection of the drug-cracking and heat-resistant phenotype of upland cotton.

6. A method for detecting the heat-resistant phenotype of drug cracking in upland cotton, characterized in that: The following steps are involved: Using the primers described in claim 2 to perform PCR amplification on the genomic DNA of the cotton germplasm to be tested to obtain a PCR amplification product; The PCR amplification product is subjected to electrophoresis detection. When the PCR amplification product can specifically amplify a band and contains a 546 bp band pattern, the cotton germplasm to be tested is a high temperature resistant cotton germplasm; When the PCR amplification product cannot specifically amplify a band or the amplified band pattern does not contain a 546 bp band pattern, the cotton germplasm to be tested is a high temperature sensitive cotton germplasm; The annealing temperature during the PCR amplification is 66-68°C.

7. Application of the SNP molecular marker according to claim 1, the primer according to claim 2, the kit according to claim 3 or 4, or the method according to claim 6 in breeding and / or assisted breeding of upland cotton based on the anther dehiscence heat-resistant phenotype.

Images