Indel molecular markers associated with direct cold resistance of potato and their application

Abstract

The application provides a potato direct cold resistance related Indel molecular marker and application. The potato direct cold resistance related Indel molecular marker, which is named Indel0516 in full name, comprises an upstream primer sequence Indel0516-F: TTAGCAATGGAACGAGTTCA and a downstream primer sequence Indel0516-R: ACGTGCATTAGGAGTCATTT. The application crosses two strains CND50-2 (PI 473493) and CND48-2 (PI 473345) of a potato diploid wild species S. candolleanum, constructs a direct cold resistance segregation population, and obtains an Indel molecular marker significantly associated with the direct cold resistance of the potato wild species S. candolleanum by using QTL-seq and combining molecular marker development. CND50-2 is a cold resistance strain of S. candolleanum, and CND48-2 is a low-temperature sensitive strain of S. candolleanum. The Indel molecular marker significantly associated with the direct cold resistance is used to detect germplasm resources with S. candolleanum cold resistance strain blood relationship, and it is found that the detection of the direct cold resistance of the offspring is more accurate, which indicates that the molecular marker can be applied to the assisted selection of the direct cold resistance of S. candolleanum.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to an Indel molecular marker related to direct cold resistance in potatoes and its application. This Indel marker for direct cold resistance in potatoes is located on potato chromosome 5 and is designated as Indel0516. Technical Background

[0002] The potato (Solanum tuberosum L.) is an important food crop in the world.

[0003] Cultivated potatoes are cool-season crops, and frost damage during their growth can significantly impact yield and quality, sometimes even leading to total crop failure (Chinnusamy et al 2007). Frost damage severely affects potato production and hinders the healthy development of the potato industry. However, 70% of wild potato species in nature are diploid, possessing abundant germplasm resources for stress resistance, including cold resistance. Current genetic mapping studies on potato cold resistance primarily focus on another diploid wild species, *S. commersonii*. In this wild species, SNPs associated with direct cold resistance are mainly distributed on chromosomes 2, 6, 10, and 11 (Vega et al 2003; Pan Fei 2016; Shu Qiqiong 2021; Dong 2023). However, existing research indicates that direct cold resistance in *S. commersonii* is recessive, and no widely applicable molecular markers have been identified. S. candolleanum is another diploid wild species with strong direct cold resistance and no domestication ability. The genome of this wild species has also been sequenced and assembled (Tang et al 2022).

[0004] Existing technical problems: Currently, no dominant or predominantly dominant cold resistance genes or loci have been reported in other wild potato species; no ideal markers suitable for marker-assisted selection have been developed that may be linked to dominant or predominantly dominant cold resistance genes or loci. Summary of the Invention

[0005] The key technical problem this invention aims to solve is to provide an Indel molecular marker related to the direct cold resistance of potatoes and its application. To solve the above technical problem, this invention adopts the following technical solution:

[0006] 1. Primers for the Indel molecular marker Indel0516, which is directly linked to cold resistance in wild potato species S. candolleanum. The molecular marker was identified using the following primer sequences: upstream primer sequence Indel0516-F: TTAGCAATGGAACGAGTTCA and downstream primer sequence Indel0516-R: ACGTGCATTAGGAGTCATTT.

[0007] 2. The Indel molecular marker Indel0516, which is directly linked to the cold resistance of wild potato species S. candolleanum, is shown in the sequence listings SEQ No.1 and SEQ No.2. The cold-resistant potato material, as shown in SEQ No.1, has an insertion of a 13bp base sequence, while the low-temperature sensitive material, as shown in SEQ No.2, has a deletion of the 13bp sequence.

[0008] 3. Screening method for Indel molecular markers linked to direct cold resistance in wild potato species S. candolleanum, including the following steps: (1) Construction of genetic population. A direct cold-resistant segregating population was constructed by crossing the cold-resistant strain CND50-2 and the low-temperature sensitive strain CND48-2 from S. candolleanum; (2) Electrolyte permeability of individual F1 plants was measured at -3℃. Those with an electrolyte permeability of less than 40% were considered cold-resistant strains, and those with an electrolyte permeability of more than 80% were considered low-temperature sensitive strains. Based on the final results, select extremely cold-resistant single plants and extremely low-temperature sensitive single plants to construct resistant-Pool and sensitive-Pool pools; (3) send the pools for sequencing, perform BSA analysis based on the sequencing data, and obtain the differential sites between resistant-Pool and sensitive-Pool; (4) QTL-seq detection; (5) screen polymorphic sites based on pool sequencing, and select sites with deletions or substitutions greater than 15bp between resistant-sensitive pools; (6) use the polymorphic primers obtained in the above steps to perform PCR amplification on all single plants in the F1 population; (7) read and encode the banding, and use relevant software to construct the genetic map and QTL localization based on the results; (8) obtain the primer sequence of the Indel marker Indel0516.

[0009] 4. Application of Indel molecular marker linked to direct cold resistance of wild potato species S. candolleanum. The application is to identify whether the hybrid offspring of S. candolleanum have direct cold resistance. The specific steps are as follows: (1) Electrolyte permeability of potato germplasm resources containing S. candolleanum lineage to be identified is measured at -3℃; (2) Whole genome DNA of the corresponding materials is extracted by CTAB method; (3) Potato materials are detected by marker Indel0516. The specific steps include: ① 1 μL of 50 ng / μL DNA template, 0.5 μL each of 10 μM upstream and downstream primers, 5 μL of 2×Utaq PCRMix, and 3 μL of ddH2O; ② The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min and 30 s, and finally 72℃ extension for 5 min; store at 4℃ and take out; ③ Add 5 μL of PCR product to 10×LoadingBuffer, polypropylene gel electrophoresis, development and observation results. (4) Result judgment: When the amplified product has no target band in electrophoresis, it is a cold-resistant potato material; when it has a target band, it is a low-temperature sensitive material.

[0010] Beneficial effects: (1) This invention uses two diploid wild S. candolleanum strains as parents to construct a diploid F1 population through hybridization, and this population exhibits resistance to low temperature segregation. Using BSA analysis and QTL-seq analysis techniques, based on the phenotypic data of electrolyte permeability at -3℃, combined with the screening of polymorphic sites and the development of molecular markers, a locus related to direct cold resistance was identified in chromosome 5 from 23Mb to 26Mb, and it may exhibit dominant inheritance. By combining the traditional QTL mapping method, molecular markers were densified in the candidate interval, and the molecular marker Indel0516, which is closely linked to direct cold resistance, was obtained. This lays an important foundation for realizing molecular-assisted breeding and genetic improvement of multi-gene controlled traits. (2) Based on the developed Indel marker primers, this invention detected the F1 population (denoted as CR population) of a cross between the cold-resistant strain CND50-2 of wild potato species S. candolleanum and another diploid cultivated species RH (which does not have cold resistance). It was found that there was obvious segregation in the offspring of the PCR amplification products, which indicates that the cold resistance gene of CND50-2 can be successfully inherited by the offspring. Moreover, the marker can detect the cold resistance gene of CND50-2 and can be applied to auxiliary selection in potato cold resistance breeding. Attached Figure Description

[0011] Figure 1 These are the results of direct cold resistance (LT50) tests on 11 materials of wild potato species S. canolleanum.

[0012] Figure 2 This is the field frost phenotype of wild potato species *S. canolleanum* at -3°C. CMM5 is the cold-resistant control, and AC142 is the sensitive control.

[0013] Figure 3 This is a genetic mapping study of the cold resistance distribution of individual plants in the CC population after three phenotypic tests (electrolyte leakage rate at -3℃).

[0014] Figure 4 These are the results of QTL-Seq analysis.

[0015] Figure 5 These are the results of QTL detection for direct cold resistance in the CC population. The numbers to the left of the linkage group represent the genetic distance between markers, in cM. The solid rectangles to the right of the linkage group indicate the QTL mapping intervals.

[0016] Figure 6 This is a distribution map of the direct cold resistance (electrolyte leakage rate at -3℃) of 20 potato germplasm resources.

[0017] Figure 7 This is a graph showing the results of cold resistance testing on 20 interspecific hybrid potato materials with S. canolleanum lineage using the marker Indel0516. Figure 7 A represents the difference in electrolyte leakage rate between 20 potato samples with and without the Indel label. 0 indicates no Indel label (Indel0516); 1 indicates the presence of the Indel label (Indel0516). Figure 7 B represents the band pattern after Indel-labeled Indel0516 polyacrylamide gel electrophoresis, and the arrow indicates the target band pattern.

[0018] Figure 8 This is a comparison diagram of the target sequence of the primer labeled Indel0516. The mutation sites are highlighted. Specific implementation methods

[0019] Unless otherwise specified, the methods and apparatus used in the following embodiments of this invention are conventional methods and apparatus; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies. To make the objectives, technical solutions, and advantages of this invention clearer, the specific implementation methods of this invention are described in detail below with reference to specific embodiments. Examples of these preferred embodiments are illustrated in the specific embodiments. It should also be noted that, in order to avoid obscuring the technical solution of this invention due to unnecessary details, only technical solutions and / or processing steps closely related to the solution according to this invention are shown in the embodiments, while other details that are not closely related are omitted.

[0020] Example 1

[0021] This implementation case provides the full-length sequence of the Indel molecular marker linked to the direct cold resistance of the wild potato species S. candolleanum, as follows:

[0022] (1) Primer sequence of Indel molecular marker Indel0516:

[0023] Upstream primer sequence Indel0516-F: TTAGCAATGGAACGAGTTCA

[0024] Downstream primer sequence Indel0516-R: ACGTGCATTAGGAGTCATTT

[0025] (2) The full-length primer sequences for potato cold-resistant and low-temperature sensitive materials are shown in SEQ No. 1 and SEQ No. 2; or as shown in Figure 8 As shown, the highlighted area indicates the location where the mutation occurred.

[0026] Example 2

[0027] This embodiment provides a method for screening Indel molecular markers linked to the direct cold resistance of the wild potato species S. candolleanum, as follows:

[0028] (1) Genetic population construction: S. candolleanum is a material preserved in our laboratory resource bank. It exhibits clear phenotypic segregation and has multiple PIs. For example... Figure 1 and Figure 2 As shown, previous studies using various cold resistance testing methods revealed variations in the direct cold resistance of different strains of *S. candolleanum* with different parent lines (PIs). Interspecific hybridization was performed between the cold-resistant strain CND50-2 and the low-temperature-sensitive strain CND48-2 to obtain an F1 population (named the CC population), containing 234 progeny individuals. Electrolyte permeability measurements of this F1 population at -3℃ revealed segregation in its direct cold resistance. Multiple electrolyte permeability measurements at -3℃ were performed on all individuals in the CC population. The results showed that the electrolyte leakage rate distribution was consistent across all individuals in the three replicates; except for the extreme strains, the electrolyte leakage rate of most individuals remained between 40% and 80%. Figure 3 ).

[0029] (2) DNA was extracted from all individual plants in the CC population using the CTAB method.

[0030] (3) Electrolyte permeability was measured at -3℃ for all offspring of the CC population. Extremely cold-resistant and sensitive single plants were selected to construct extreme cold-resistant pools (Resistant-Pool) and extreme cold-sensitive pools (Sensitive-Pool). Each pool contained 22 single plants. DNA from these 44 single plants was collected, mixed in equal weight, and sent to Wuhan Fraser Gene Technology Co., Ltd. for whole-genome sequencing using an Illumina sequencer. The sequencing depth of each pool was 20×, yielding a total of 40G of data.

[0031] (4) Analyze the sequencing data to obtain the differences in polymorphic sites between the R-pool and S-pool. The specific analysis steps are as follows: 1) Use the MEM algorithm of BWA software (version 0.7015-r1140) to align the sequencing data of the resistant-pool with the reference genome to obtain the alignment results in SAM format; 2) Use samtools software (version 1.3.1) to convert the SAM format file to BAM format; 3) Use SortSam in Picard tool (version 1.91) to sort the reads in the BAM file. The obtained BAM file can be used to count the differential SNPs between the resistant-pool and the sensitive-pool; 4) Use GATK software (version 4.0) to complete the SNP and Indel detection.

[0032] (5) QTL-seq analysis: Based on the R package provided by Mansfeld and Grumet (2018), the SNP-index values ​​of the Resistant-Pool and Sensitive-Pool obtained in (4) were calculated, and the distribution map of the SNP-index on the genome was plotted using the sliding window method (with a unit window of 2Mb and a step size of 10kb). Then, the Δ(SNP-index) value was calculated based on the SNP-index value of the extreme pool, and the distribution map of Δ(SNP-index) on the genome was plotted using the sliding window method (with a unit window of 2Mb and a step size of 10kb). Finally, the threshold of Δ(SNP-index) at the 95% level was calculated to determine the candidate regions related to direct cold resistance. Figure 4 ).

[0033] (6) Polymorphic site screening and linkage Indel molecular marker design: Based on the analysis results of GATK software, primers were designed for SNP and Indel sites within the candidate intervals, and PCR amplification was performed. Polymorphic screening was conducted between the parents and the mixed pool. The PCR reaction system was 20 μl, specifically as follows: DNA template (50 ng / μl) 1 μl, forward and reverse primers (10 μM) 0.5 μl each, Utaq PCRMix (2×) 10 μl, ddH2O 8 μl. The reaction program was as follows: 95℃ pre-denaturation for 3 min, then 35 cycles of 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min 30 s, and finally 72℃ extension for 5 min; stored at 4℃. The amplified products were subjected to polyacrylamide gel electrophoresis, and the bands were read after electrophoresis. Genotyping of the next generation materials was performed. The results were recorded as follows: two bands at the target product position were recorded as "1", and one band was recorded as "0".

[0034] (7) Using the polymorphic primers obtained in (6), PCR amplification was performed on all single plants in the CC population (CND50-2╳CND48-2). The PCR reaction system and reading method were the same as in the previous step.

[0035] (8) Genetic map construction and QTL mapping: Using the genetic map construction software JoinMap and the marker results statistically analyzed in (7), a genetic map of candidate segments of chromosome 5 was constructed; based on the statistical analysis of the CC population phenotype in (1), the diploid mapping software MapQTL was used to locate the QTLs directly related to cold resistance in S. candolleanum, such as Figure 5 As shown. This QTL is named Chr5LT. 50 The Indel at the peak is marked as Indel0516.

[0036] Example 3

[0037] This implementation example provides the application of Indel molecular markers for cold resistance in potatoes, specifically the application of Indel molecular marker primers that distinguish between cold-tolerant and cold-sensitive types of potatoes. This is achieved through the following steps:

[0038] (1) Cold resistance was tested on 20 individual plants from another CR population (CND50-2╳RH) containing S. candolleanum lineage constructed in the laboratory. Figure 6 As shown.

[0039] (2) DNA was extracted from 20 samples using the CTAB method.

[0040] (3) Twenty potato materials were tested using the Indel0516 marker. The specific steps included: the PCR amplification reaction system consisted of 1 μl of DNA template (50 ng / μl), 0.5 μl each of upstream and downstream primers (10 μM), 10 μl of Utaq PCR Mix (2×), and 8 μl of ddH2O; the PCR reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min 30 s, and a final 72℃ extension for 5 min; the samples were stored at 4℃ and then removed; the amplified products were subjected to polyacrylamide gel electrophoresis, and the bands were read after electrophoresis and genotyping of the next generation materials was performed. The results were recorded as follows: two bands at the target product position were recorded as "1", and one band was recorded as "0".

[0041] (4) Result determination method: The phenotypic identification results and labeling detection results of 20 potato materials were correlated. The correlation coefficient was 0.59**. The electrolyte leakage rate at -3℃ was significantly correlated with the labeling results at the 0.01 level. Figure 7 ).

[0042] The above description is only a specific embodiment of this application. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of this application, and these improvements and modifications should also be considered within the scope of protection of this application.

[0043] References and cited experimental methods:

[0044] [1]. Shu Qiqiong. Genome-wide association analysis and molecular marker development of cold resistance traits in potato. [Master's Thesis]. Guiyang: Guizhou Normal University, 2021.

[0045] [2]. Pan Fei. Study on SNP molecular markers related to cold resistance traits in potatoes. [Master's Thesis]. Changsha: Hunan Agricultural University, 2017.

[0046] [3].Chinnusamy V, Zhu J, Zhu JK. Cold stress regulation of gene expression in plants. Trends Plant Sci, 2007, 12: 444-451

[0047] [4].Dong J,Li J,Deng G,Chen C,Jing S,Song B,Cai X.QTL analysis forlow temperature tolerance of wild potato species Solanum commersoniiinnatural field trials.Scientia Horticulturae,2023,310:111689

[0048] [5].Tang D,Jia Y,Zhang J,Li H,Cheng L,Wang P,Bao Z,Liu Z,Feng S,ZhuX,Li D,Zhu G,Wang H,Zhou Y,Zhou Y,Bryan GJ,Buell CR,Zhang C,Huang S.Genomeevolution and diversity of wild and cultivated potatoes.Nature,2022,606:535-541

[0049] [6].Vega S,Rio Ad,Jung G,Bamberg J,Palta J.Marker-assisted geneticanalysis of non-acclimated freezing tolerance and cold acclimation capacityin a backcross Solanum population.Am J Potato Res,2003,80:359-369

Claims

1. Wild potato species S. candolleanum Indel molecular markers linked to direct cold resistance, characterized by The sequences of the Indel molecular markers are those shown in SEQ ID No. 1 and SEQ ID No. 2.

Images