SNP molecular markers, amplification primers and their applications related to calcium content in cassava

Abstract

The present invention provides a SNP molecular marker related to the calcium content of cassava, which is a Chr1:29978285 SNP, a Chr1:29978475 SNP, a Chr1:29979909 SNP, a Chr1:29979932 SNP or a Chr1:29979963 SNP molecular marker. The present invention firstly identifies from the big data level that the SNPs located at the 102nd and 292nd positions of the nucleotide sequence of SEQ ID NO.1 and the 74th, 97th and 128th positions of the nucleotide sequence of SEQ ID NO.2 are closely related to the calcium content of cassava root tubers. The SNP molecular marker is not limited by the growth stage of cassava and can be selected in the seedling stage, which greatly reduces the workload of breeding, significantly shortens the cassava yield breeding selection cycle, improves the breeding efficiency, and can be used in practice for molecular marker-assisted breeding for cassava quality improvement.

Description

Technical Field

[0001] The present invention relates to a SNP marker and application thereof, and in particular to a SNP molecular marker related to the calcium content of cassava, an amplification primer and application thereof. Background Art

[0002] Cassava is one of the four major tuber crops in the world. It is widely planted in tropical and subtropical regions and is the sixth largest food crop in the world. It provides carbohydrates and energy for more than 2 billion people in more than 130 countries around the world. However, although cassava can provide sufficient calories, its calcium content is far below people's daily needs. This nutritional deficiency limits the nutritional value of cassava. Therefore, increasing the calcium content in cassava to meet people's nutritional needs has become an urgent challenge and a crucial link in the cassava variety breeding process. However, the molecular marker information for the calcium content of cassava tubers is still insufficient, which seriously limits the selection of high-calcium cassava varieties.

[0003] The present invention selects cassava materials with high calcium content by selecting favorable allele variations of SNP markers, which can significantly improve breeding efficiency, shorten the breeding cycle, and accelerate the breeding process. Summary of the invention

[0004] The present invention aims to overcome the deficiencies in the prior art and provide a SNP molecular marker related to the calcium content of cassava, an amplification primer and an application thereof, which can screen germplasm with high calcium content in tubers at an early stage and promote the breeding process of new varieties of high-calcium cassava materials.

[0005] The first aspect of the present invention is to provide a SNP molecular marker associated with the calcium content of cassava, wherein the SNP molecular marker is Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker or Chr1:29979963 SNP molecular marker.

[0006] The nucleotide sequence of the Chr1:29978285 SNP molecular marker is shown in SEQ ID No. 1, and the base at the 102 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is G or T.

[0007] The nucleotide sequence of the Chr1: 29978475 SNP molecular marker is shown in SEQ ID No. 1, and the base at the 292 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G.

[0008] The nucleotide sequence of the Chr1:29979909 SNP molecular marker is shown in SEQ ID No. 2, and the base at the 74 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or T.

[0009] The nucleotide sequence of the Chr1:29979932 SNP molecular marker is shown in SEQ ID No. 2, and the base at the 97 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is G or A.

[0010] The nucleotide sequence of the Chr1:29979963 SNP molecular marker is shown in SEQ ID No. 2, and the base at the 128 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or A.

[0011] When the Chr1:29978285 SNP molecular marker was TT genotype, the calcium content of the root tubers was significantly higher than that of the GG and GT genotypes; when the Chr1:29978475 SNP molecular marker was GG genotype, the calcium content of the root tubers was significantly higher than that of the AA and AG genotypes; when the Chr1:29979909 SNP molecular marker was TT genotype, the calcium content of the root tubers was significantly higher than that of the CC and CT genotypes; when the Chr1:29979932 SNP molecular marker was AA genotype, the calcium content of the root tubers was significantly higher than that of the GG and GA genotypes; when the Chr1:29979963 SNP molecular marker was AA genotype, the calcium content of the root tubers was significantly higher than that of the CC and CA genotypes.

[0012] Based on the SNP molecular marker, a genotype identification method for the calcium content of cassava root tubers can be developed. By analyzing the base sequence of the SNP site, when the Chr1:29978285 SNP molecular marker is TT genotype, it is identified as high-calcium cassava, or when the Chr1:29978475 SNP molecular marker is GG genotype, it is identified as high-calcium cassava, or when the Chr1:29979909 SNP molecular marker is TT genotype, it is identified as high-calcium cassava, or when the Chr1:29979932 SNP molecular marker is AA genotype, it is identified as high-calcium cassava, or when the Chr1:29979963 SNP molecular marker is AA genotype, it is identified as high-calcium cassava.

[0013] The second aspect of the present invention is to provide a SNP molecular marker combination related to the calcium content of cassava, wherein the SNP molecular marker combination includes Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker.

[0014] Compared with the GG-AA-CC-GG-CC genotype, the calcium content of cassava root tubers in the GT-AG-CT-GA-CA and TT-GG-TT-AA-AA genotypes was significantly increased; compared with the GT-AG-CT-GA-CA genotype, the calcium content of cassava root tubers in the TT-GG-TT-AA-AA genotype was significantly increased.

[0015] Among them, the GG-AA-CC-GG-CC genotype refers to the genotypes of Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker, which are GG, AA, CC, GG, CC respectively.

[0016] Among them, the GT-AG-CT-GA-CA genotype refers to the genotypes of Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker, which are GT, AG, CT, GA and CA respectively.

[0017] Among them, the TT-GG-TT-AA-AA genotype refers to the genotypes of Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker, which are TT, GG, TT, AA, and AA respectively.

[0018] Based on the SNP molecular marker combination, a genotype identification method for the calcium content of cassava root tubers can be developed. By analyzing the base sequences of each SNP site of the SNP molecular marker combination, when the genotypes of Chr1:29978285 SNP molecular marker, Chr1:29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, in sequence, especially TT, GG, TT, AA, AA, in sequence, the cassava is identified as high-calcium cassava.

[0019] In order to amplify or detect the SNP molecular marker, the third aspect of the present invention is to provide a primer pair for amplifying or detecting the SNP molecular marker described in the first aspect of the present invention or the SNP molecular marker combination described in the second aspect of the present invention, the primer pair for amplifying or detecting the Chr1:29978285 SNP molecular marker and the Chr1:29978475 SNP molecular marker is GT1; the primer pair for amplifying or detecting the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker is GT2.

[0020] Primer pair GT1 included GT1_F: 5'-CGTCTTTCTTTCCATGCAGATC-3' and primer GT1_R: 5'-CTCCTATCCTCCCAGAATCTCC-3'.

[0021] Primer pair GT2 includes GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and primer GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'.

[0022] The fourth aspect of the present invention is to provide a kit for detecting the SNP molecular marker described in the first aspect of the present invention or the SNP molecular marker combination described in the second aspect of the present invention, which comprises the primer pair described in the third aspect of the present invention.

[0023] The fifth aspect of the present invention is to provide the use of the SNP molecular marker described in the first aspect of the present invention, or the SNP molecular marker combination described in the second aspect of the present invention, or the primer pair described in the third aspect of the present invention, or the kit described in the fourth aspect of the present invention in the early screening of cassava germplasm with high root calcium content.

[0024] The sixth aspect of the present invention is to provide the use of the SNP molecular marker as described in the first aspect of the present invention, or the SNP molecular marker combination as described in the second aspect of the present invention, or the primer pair as described in the third aspect of the present invention, or the kit as described in the fourth aspect of the present invention in cassava breeding.

[0025] The seventh aspect of the present invention provides a method for detecting the calcium content trait of cassava root tubers: extracting genomic DNA of the cassava to be tested, using the genomic DNA of the cassava to be tested as a template, using the primer pair described in the third aspect of the present invention to perform PCR amplification, analyzing the sequence of the PCR amplification product, detecting the SNP molecular marker described in the first aspect of the present invention or the SNP molecular marker combination described in the second aspect of the present invention, determining the genotype of the cassava to be tested, and thus determining the calcium content trait of the root tubers of the cassava to be tested.

[0026] When the Chr1:29978285 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava roots was high.

[0027] When the Chr1: 29978475 SNP molecular marker was GG genotype, it was preliminarily identified that the calcium content in cassava roots was high.

[0028] When the Chr1:29979909 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava roots was high.

[0029] When the Chr1:29979932 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava roots was high.

[0030] When the Chr1:29979963 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava roots was high.

[0031] When the genotypes of Chr1:29978285 SNP molecular marker, Chr1:29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, especially TT, GG, TT, AA, AA, the cassava is identified as high-calcium cassava.

[0032] The eighth aspect of the present invention is to provide a cassava breeding method: extracting genomic DNA of the cassava to be tested, using the genomic DNA of the cassava to be tested as a template, using the primer pair described in the third aspect of the present invention to perform PCR amplification, analyzing the sequence of the PCR amplification product, detecting the SNP molecular marker described in the first aspect of the present invention or the SNP molecular marker combination described in the second aspect of the present invention, determining the genotype of the cassava to be tested, thereby determining the root calcium content trait of the cassava to be tested, and breeding the cassava.

[0033] The present invention identifies for the first time from a big data level that SNPs at positions 102 and 292 of the nucleotide sequence of SEQ ID NO.1, and SNPs at positions 74, 97 and 128 of the nucleotide sequence of SEQ ID NO.2 are closely associated with the calcium content of cassava root tubers; the SNP molecular markers are not restricted by the growth stage of cassava and can be selected in the seedling stage, which greatly reduces the workload of breeding, significantly shortens the cassava breeding selection cycle, improves breeding efficiency, and can be used in practice for molecular marker-assisted breeding for cassava quality improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Manhattan plot of SNP markers that are extremely significantly associated with calcium content in cassava roots.

[0035] Figure 2 (A) Manhattan plot and linkage disequilibrium haplotype block plot of the local interval of chromosome 1 where the SNP markers that are extremely significantly associated with the calcium content of cassava roots are located, where the darkened markers in the interval are the molecular markers screened by the present invention. (B) There are five SNP sites with non-synonymous mutations on the exon of the candidate gene Sc01g011610 associated with the calcium content of cassava.

[0036] Figure 3 Comparison of calcium content among different genotypes of 5 SNP markers that are extremely significantly correlated with calcium content in cassava roots. (A) When Chr1:29978285 SNP was TT genotype, the calcium content of root tubers was significantly higher than that of GG and GT genotypes; (B) When Chr1:29978475 SNP was GG genotype, the calcium content of root tubers was significantly higher than that of AA and AG genotypes; (C) When Chr1:29979909 SNP was TT genotype, the calcium content of root tubers was significantly higher than that of CC and CT genotypes; (D) When Chr1:29979932 SNP was AA genotype, the calcium content of root tubers was significantly higher than that of GG and GA genotypes; (E) When Chr1:29979963 SNP was AA genotype, the calcium content of root tubers was significantly higher than that of CC and CA genotypes; (F) TT-GG-TT-AA-AA genotype was extremely significantly correlated with high calcium content of root tubers; ** is P<0.01, *** is P<0.001.

[0037] Figure 4 The genotyping diagrams of the five SNP sites of the present invention are shown in FIG. 1 . (A) The genotyping diagram of the SNP obtained by PCR1. (B) The genotyping diagram of the SNP obtained by PCR2. DETAILED DESCRIPTION

[0038] The present invention will be further described below in conjunction with specific embodiments to provide a better understanding of the present invention.

[0039] Example 1: Mining SNP sites significantly associated with root calcium content based on genome-wide association analysis (GWAS)

[0040] 297 cassava samples from China, Brazil, Nigeria, Colombia and other countries were obtained from the National Cassava Germplasm Resource Garden (Danzhou) as research materials and sown in the Wenchang Base of the Chinese Academy of Tropical Agricultural Sciences to ensure consistent planting conditions such as soil fertility and temperature. Young leaf tissues were selected and cassava genomic DNA was extracted using the Polysaccharide and Polyphenol Plant Genomic DNA Extraction Kit (Tiangen). DNA samples with OD values ​​between 1.8 and 2.0 and a content of more than 1.5ug were used to construct libraries for sequencing. The raw sequencing data were filtered to obtain high-quality sequencing data (Q20 >= 90%, Q30 >= 85%) with a GC content between 37% and 39% for subsequent analysis. The high-quality sequencing data were aligned to the reference genome using BWA software (v0.7.17, parameters: mem-t 4-k 32-M), and the alignment results were sorted and deduplicated using SAMTOOLS (v1.9).

[0041] SNP (single nucleotide polymorphism) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level, including the conversion and transversion of a single base. We used software such as SAMTOOLS to detect population SNPs in samples. High-quality SNPs were obtained through the following filtering and screening: (1) Q20 quality control (filtering out SNPs with a quality value Q20, i.e., sequencing error rate greater than 1%); (2) the support number (coverage depth) of the variant site > 3; (3) the proportion of missing genotypes in the resequencing samples of the variant site <= 20%; (4) the minimum allele frequency (MAF) of the variant site > 0.05. Finally, ANNOVAR software was used to annotate population SNPs, obtain the relative position of the variant site and the gene, and detect whether the variant site on the gene is a non-synonymous mutation.

[0042] Inductively coupled plasma optical emission spectrometry (ICP-OES) was used to detect the calcium content of cassava root tubers: After the cassava root tubers were crushed and dried, the samples were digested by wet digestion. Take 10 mL of high-grade perchloric acid and slowly add it to 100 mL of high-grade nitric acid and mix well to prepare a nitric acid-perchloric acid (10+1) mixed solution for use. Accurately weigh 0.5 g of dried cassava root tubers in a glass digestion vessel, add 10 mL of nitric acid-perchloric acid (10+1) mixed solution, and digest on a hot plate until white smoke is emitted and the digestion solution is colorless and transparent or slightly yellow. After cooling, dilute to 50 mL with ddH2O and mix well for use; at the same time, a blank test was performed. The standard series working solutions were injected into an inductively coupled plasma optical emission spectrometer (PerkinElmer Optima 8300), and the intensity signal response value of the analysis line of the element to be measured was determined to draw a standard curve. The blank solution and the sample solution were respectively injected into the inductively coupled plasma emission spectrometer, the signal response value of the analysis line intensity of the element to be measured was measured, and the concentration of the element to be measured in the digestion solution was obtained according to the standard curve.

[0043] The mixed linear model (MLM) in GEMMA was used to conduct association analysis on the calcium content traits of the population, and the significance of the association was analyzed by ( P -value < 0.05) to screen potential candidate SNPs. The results showed that there was a GWAS signal significantly associated with calcium content at the 29.98Mb position of chromosome 1 of cassava (-log 10 ( P -value) =10.85), and detected a linkage disequilibrium region of 5 kb, and identified the candidate gene Sc01g011610 ( Figure 1 , Figure 2 Further analysis revealed that five non-synonymous mutation SNP sites were screened in the second exon of the Sc01g011610 gene, which were significantly associated with the calcium content of cassava roots: Chr1:29978285 (G / T), Chr1:29978475 (A / G), Chr1:29979909 (C / T), Chr1:29979932 (G / A), Chr1: 29979963 (C / A) ( Figure 2 B in the figure).

[0044] From Table 1 and Figure 3It can be seen that when SNP: 29978285 was TT genotype, the calcium content of the root tubers was significantly higher than that of GG and GT genotypes; when SNP: 29978475 was GG genotype, the calcium content of the root tubers was significantly higher than that of AA and AG genotypes; when SNP: 29979909 was TT genotype, the calcium content of the root tubers was significantly higher than that of CC and CT genotypes; when SNP: 29979932 was AA genotype, the calcium content of the root tubers was significantly higher than that of GG and GA genotypes; when SNP: 29979963 was AA genotype, the calcium content of the root tubers was significantly higher than that of CC and CA genotypes. Compared with the GG-AA-CC-GG-CC genotype (the genotypes of the above five non-synonymous mutation SNP sites Chr1: 29978285 (G / T), Chr1: 29978475 (A / G), Chr1: 29979909 (C / T), Chr1: 29979932 (G / A), Chr1: 29979963 (C / A) are GG, AA, CC, GG, CC respectively), the GT-AG-CT-GA-CA genotype (the above five non-synonymous mutation SNP sites Chr1: 29978285 (G / T), Chr1: 29978475 (A / G), Chr1: 29979909 (C / T), Chr1: 29979932 (G / A), Chr1: 29979963 (C / A) are GG, AA, CC, GG, CC respectively). The calcium content of cassava roots was significantly increased in the genotypes of Chr1: 29978285 (G / T), Chr1: 29978475 (A / G), Chr1: 29979909 (C / T), Chr1: 29979932 (G / A), and Chr1: 29979963 (C / A) (the genotypes are TT, GG, TT, AA, AA, respectively). Moreover, the calcium content of cassava roots containing the genotype TT-GG-TT-AA-AA was significantly increased compared with the genotype GT-AG-CT-GA-CA. By selecting these five SNP sites as the GT-AG-CT-GA-CA genotype or the TT-GG-TT-AA-AA genotype, especially the TT-GG-TT-AA-AA genotype, it is possible to quickly select or predict cassava materials with high calcium content, and then effectively select the calcium content of cassava tubers, thereby accelerating the molecular design breeding process of high-calcium cassava varieties.

[0045] Table 1 Statistics of different SNP genotypes and calcium content of cassava Sc01g011610 gene

[0046]

[0047] Note: Due to the filtering step, low-quality reads and sites with low coverage will be filtered out, so the total number of individuals at each site is ≤297.

[0048] The calcium content of the above cassava germplasms was investigated, and the genotypes of the target SNP sites were statistically analyzed for germplasms with particularly high calcium content (greater than or equal to 0.2%). The results showed that among the germplasms with calcium content greater than or equal to 0.2%, there were 5 germplasms with the genotype of GG-AA-CC-GG-CC, 33 germplasms with the genotype of GT-AG-CT-GA-CA, and 29 germplasms with the genotype of TT-GG-TT-AA-AA.

[0049] Example 2 SNP marker development

[0050] Based on the cassava SC205 reference genome, a total of 438 bp of upstream and downstream sequences of SNP sites (Chr1: 29978285 (G / T), Chr1: 29978475 (A / G)) significantly associated with the calcium content of cassava roots were extracted. Primer sequences were designed using Primer 5 software, and PCR amplification was performed using primers GT1_F: 5'-CGTCTTTCTTTCCATGCAGATC-3' and primer GT1_R: 5'-CTCCTATCCTCCCAGAATCTCC-3'. The PCR reaction system was: DNA template 1μl, PCR mix 12.5μl, forward primer 1μl, reverse primer 1μl, ddH2O 9.5μl, a total of 25μl. The PCR reaction program was: 98℃ pre-denaturation for 10min; 55℃ annealing for 15sec, 72℃ extension for 5sec, and 34 cycles.

[0051] The amplified product was recovered and sequenced to obtain a nucleotide sequence containing the above-mentioned SNP (Chr1: 29978285 (G / T), Chr1: 29978475 (A / G)) site, as shown in SEQ ID No. 1. The SNP site Chr1: 29978285 (G / T) (named as Chr1: 29978285 SNP) is located at the 102 bp site from the 5' end of the sequence shown in SEQ ID NO: 1. In the sequence of SEQ ID NO: 1, "g" is used to represent this site, and the base at this site is G or T. The SNP site Chr1: 29978475 (A / G) (named as Chr1: 29978475 SNP) is located at the 292 bp site from the 5' end of the sequence shown in SEQ ID NO: 1. In the sequence of SEQ ID NO: 1, "a" is used to represent this site, and the base at this site is A or G. It should be understood that in the sequence listing, the 102 bp position from the 5' end of SEQ ID No. 1 is represented by "g" and the 292 bp position is represented by "a" only for the purpose of normal submission of the nucleotide sequence listing and does not affect the relevant limitations of the claims and description of the present invention.

[0052] Based on the cassava SC205 reference genome, the upstream and downstream sequences of the SNP sites (Chr1:29979909(C / T), Chr1:29979932(G / A), Chr1:29979963(C / A)) significantly associated with the calcium content of cassava roots were extracted, and the primer sequences were designed using Primer 5 software. PCR amplification was performed using primers GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'. The PCR reaction system was: DNA template 1μl, PCRmix 12.5μl, forward primer 1μl, reverse primer 1μl, ddH2O 9.5μl, a total of 25μl. The PCR reaction program was as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 sec, annealing at 55°C for 5 sec, extension at 72°C for 5 sec, 30 cycles; and extension at 72°C for 7 min.

[0053] The nucleotide sequence containing the above SNP (Chr1:29979909(C / T), Chr1:29979932(G / A), Chr1:29979963(C / A)) sites was obtained by PCR amplification, as shown in SEQ ID No. 2. The SNP site Chr1:29979909(C / T) (named as Chr1:29979909 SNP) is located at the 74 bp site from the 5' end of the sequence shown in SEQ ID NO: 2. In the SEQ ID NO: 1 sequence, "c" is used to represent this site, and the base at this site is C or T. The SNP site Chr1:29979932 (G / A) (named as Chr1:29979932 SNP) is located at the 97 bp site from the 5' end of the sequence shown in SEQ ID NO:2, and the site is represented by "g" in the SEQ ID NO:1 sequence, and the base at this site is G or A. The SNP site Chr1:29979963 (C / A) (named as Chr1:29979963 SNP) is located at the 128 bp site from the 5' end of the sequence shown in SEQ ID NO:2, and the site is represented by "c" in the SEQ ID NO:1 sequence, and the base at this site is C or A. It should be understood that in the sequence listing, the 74 bp site from the 5' end of SEQ ID No.2 is represented by "c", the 97 bp site is represented by "g", and the 128 bp site is represented by "c", which is only for the normal submission of the nucleotide sequence listing and does not affect the relevant limitations of the claims and the specification of the present invention.

[0054] Example 3 Screening or Detection of High-Calcium Cassava Materials

[0055] 61 cassava plants were randomly selected from the cassava planting area of ​​the Wenchang Base of the Chinese Academy of Tropical Agricultural Sciences, and their genotyping and calcium content were investigated after sequencing. The specific operations are as follows:

[0056] 1) Extract DNA from the cassava sample to be tested;

[0057] 2) PCR amplification was performed with specific primer pair GT1 (primer GT1_F: 5' - CGTCTTTCTTTCCATGCAGATC - 3' and primer GT1_R: 5' - CTCCTATCCTCCCAGAATCTCC - 3') to obtain PCR1 product; wherein, the PCR1 reaction system was: DNA template 1μl, PCR mix 12.5μl, forward primer 1μl, reverse primer 1μl, ddH2O 9.5μl, a total of 25μl; PCR1 reaction program was: 98℃ pre-denaturation for 10min; 55℃ annealing for 15sec, 72℃ extension for 5sec, 34 cycles;

[0058] PCR amplification was performed with specific primer pair GT2 (primer GT2_F: 5' -CAGGAACCTGTAGAAGCTCGG- 3' and primer GT2_R: 5' -TGGCTATGCTTGGTTTTCAGG- 3') to obtain PCR2 product; wherein, the PCR2 reaction system was: DNA template 1μl, PCR mix 12.5μl, forward primer 1μl, reverse primer 1μl, ddH2O 9.5μl, a total of 25μl; PCR2 reaction program was: 98℃ pre-denaturation for 5min; 98℃ denaturation for 10sec, 55℃ annealing for 5sec, 72℃ extension for 5sec, 30 cycles; 72℃ extension for 7min;

[0059] 3) The PCR amplification products were detected by 1% agarose gel electrophoresis and then sequenced. Then, the sequencing peak graph was checked to analyze the genotype of the cassava sample to be tested. Among them, when the 102 bp position of the PCR1 product was a G single peak, the 292 bp position was an A single peak, and the 74 bp position of the PCR2 product was a C single peak, the 97 bp position was a G single peak, and the 128 bp position was a C single peak, the genotype was GG-AA-CC-GG-CC; when the 102 bp position of the PCR1 product was a GT double peak, the 292 bp position was an AG double peak, and the 74 bp position of the PCR2 product was a CT double peak, the 97 bp position was a GA double peak, and the 128 bp position was a CA double peak, the genotype was GT-AG-CT-GA-CA; when the 102 bp position of the PCR1 product was a T single peak, the 292 bp position was a G single peak, and the 74 bp position of the PCR2 product was a T single peak, the 97 bp position was an A single peak, and the 128 When the bp position is A single peak, it is TT-GG-TT-AA-AA genotype ( Figure 4 ); then the samples to be tested of GT-AG-CT-GA-CA genotype and TT-GG-TT-AA-AA genotype, especially TT-GG-TT-AA-AA genotype, are cassava materials with high calcium content.

[0060] The results are shown in Table 2 and Table 3, which show that the SNP molecular marker of the present invention has a high accuracy rate in identifying cassava with high calcium content, and the calcium content in the cassava root tubers of the TT-GG-TT-AA-AA genotype is substantially higher than that of the cassava with the GG-AA-CC-GG-CC genotype and the GT-AG-CT-GA-CA genotype, and the calcium content in the cassava root tubers of the GT-AG-CT-GA-CA genotype is substantially higher than that of the cassava with the GG-AA-CC-GG-CC genotype. By selecting the GT-AG-CT-GA-CA genotype and the TT-GG-TT-AA-AA genotype, especially the TT-GG-TT-AA-AA genotype, the cassava material with high calcium content can be quickly selected or predicted, and then the calcium content of the cassava root tubers can be effectively selected, accelerating the molecular design breeding process of high calcium cassava varieties.

[0061] Table 2 Different genotypes and calcium content (%) of 61 cassava strains

[0062]

[0063] Table 3 Statistics of different genotypes and calcium content of 61 cassava strains in Sc01g011640:372

[0064] genotype Number of individuals Average calcium content (%) GG-AA-CC-GG-CC 25 0.123 GT-AG-CT-GA-CA 23 0.199 TT-GG-TT-AA-AA 13 0.248

[0065] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Use of a primer pair comprising a SNP molecular marker or a combination thereof for detecting calcium content in cassava root tubers or a kit comprising the primer pair in early screening of cassava germplasm with high calcium content in the root tubers, characterized in that: The SNP molecular marker is Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker or Chr1:29979963 SNP molecular marker; the SNP molecular marker combination consists of Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker; wherein the nucleotide sequence of the Chr1:29978285 SNP molecular marker is as shown in SEQ ID No.1, and the base at the 102 bp position from the 5' end of the sequence shown in SEQ ID NO:1 is G or T; The nucleotide sequence of the Chr1: 29978475 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 292 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G; The nucleotide sequence of the Chr1:29979909 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 74 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or T; The nucleotide sequence of the Chr1:29979932 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 97 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is G or A; The nucleotide sequence of the Chr1:29979963 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 128 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or A; When the Chr1:29978285 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; Chr1: 29978475 SNP molecular marker was preliminarily identified as GG genotype, which showed that the calcium content in cassava root tubers was high; When the Chr1:29979909 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979932 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979963 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the genotypes of the Chr1:29978285 SNP molecular marker, the Chr1:29978475 SNP molecular marker, the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, respectively, the cassava is identified as high-calcium cassava; The primer pair for amplifying or detecting the Chr1:29978285 SNP molecular marker and the Chr1:29978475 SNP molecular marker is GT1; the primer pair for amplifying or detecting the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker is GT2; Primer pair GT1 included GT1_F: 5′ - CGTCTTTCTTTCCATGCAGATC - 3′ and GT1_R: 5′ -CTCCTATCCTCCCAGAATCTCC - 3′; Primer pair GT2 includes GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'.

2. Use of a primer pair of SNP molecular markers or a combination thereof for detecting calcium content in cassava tubers or a kit containing the primer pair in the selection of calcium content in cassava tubers, characterized in that: The SNP molecular marker is Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker or Chr1:29979963 SNP molecular marker; the SNP molecular marker combination consists of Chr1:29978285 SNP molecular marker, Chr1: 29978475 SNP molecular marker, Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker; wherein, The nucleotide sequence of the Chr1:29978285 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 102 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is G or T; The nucleotide sequence of the Chr1: 29978475 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 292 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G; The nucleotide sequence of the Chr1:29979909 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 74 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or T; The nucleotide sequence of the Chr1:29979932 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 97 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is G or A; The nucleotide sequence of the Chr1:29979963 SNP molecular marker is shown in SEQ ID No.2, and the base at the 128 bp position from the 5' end of the sequence shown in SEQ ID NO:2 is C or A; when the Chr1:29978285 SNP molecular marker is TT genotype, it is preliminarily identified that the calcium content in the cassava root tuber is high; Chr1: 29978475 SNP molecular marker was preliminarily identified as GG genotype, which showed that the calcium content in cassava root tubers was high; When the Chr1:29979909 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979932 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979963 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the genotypes of the Chr1:29978285 SNP molecular marker, the Chr1:29978475 SNP molecular marker, the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, respectively, the cassava is identified as high-calcium cassava; The primer pair for amplifying or detecting the Chr1:29978285 SNP molecular marker and the Chr1:29978475 SNP molecular marker is GT1; the primer pair for amplifying or detecting the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker is GT2; Primer pair GT1 included GT1_F: 5′ - CGTCTTTCTTTCCATGCAGATC - 3′ and GT1_R: 5′ -CTCCTATCCTCCCAGAATCTCC - 3′; Primer pair GT2 includes GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'.

3. A method for detecting calcium content of cassava root tubers, characterized in that: The genomic DNA of the cassava to be tested is extracted, the genomic DNA of the cassava to be tested is used as a template, a primer pair is used for PCR amplification, the sequence of the PCR amplification product is analyzed, and a SNP molecular marker or a molecular marker combination related to the calcium content of the cassava root tubers is detected to determine the genotype of the cassava to be tested, thereby determining the calcium content trait of the cassava root tubers to be tested, wherein the SNP molecular marker is a Chr1:29978285 SNP molecular marker, a Chr1:29978475 SNP molecular marker, a Chr1:29979909 SNP molecular marker, a Chr1:29979932 SNP molecular marker or a Chr1:29979963 SNP molecular marker; the SNP molecular marker combination is a Chr1:29978285 SNP molecular marker, a Chr1:29978475 SNP molecular marker, a Chr1:29979909 SNP molecular marker, a Chr1:29979932 SNP molecular markers and Chr1:29979963 SNP molecular markers; among them, The nucleotide sequence of the Chr1:29978285 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 102 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is G or T; The nucleotide sequence of the Chr1: 29978475 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 292 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G; The nucleotide sequence of the Chr1:29979909 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 74 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or T; The nucleotide sequence of the Chr1:29979932 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 97 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is G or A; The nucleotide sequence of the Chr1:29979963 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 128 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or A; Chr1: 29978475 SNP molecular marker was preliminarily identified as GG genotype, which showed that the calcium content in cassava root tubers was high; When the Chr1:29979909 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979932 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979963 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the genotypes of the Chr1:29978285 SNP molecular marker, the Chr1:29978475 SNP molecular marker, the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, respectively, the cassava is identified as high-calcium cassava; The primer pair for amplifying or detecting the Chr1:29978285 SNP molecular marker and the Chr1:29978475 SNP molecular marker is GT1; the primer pair for amplifying or detecting the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker is GT2; Primer pair GT1 included GT1_F: 5′ - CGTCTTTCTTTCCATGCAGATC - 3′ and GT1_R: 5′ -CTCCTATCCTCCCAGAATCTCC - 3′; Primer pair GT2 includes GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'.

4. A method for breeding cassava root tubers for calcium content, characterized in that: The genomic DNA of the cassava to be tested is extracted, the genomic DNA of the cassava to be tested is used as a template, a primer pair is used for PCR amplification, the sequence of the PCR amplification product is analyzed, and a SNP molecular marker or a combination of molecular markers related to the calcium content of the cassava root tubers is detected to determine the genotype of the cassava to be tested, thereby determining the calcium content trait of the cassava root tubers to be tested, and breeding the cassava, wherein the SNP molecular marker is a Chr1:29978285 SNP molecular marker, a Chr1: 29978475 SNP molecular marker, a Chr1:29979909 SNP molecular marker, a Chr1:29979932 SNP molecular marker or a Chr1:29979963 SNP molecular marker; the SNP molecular marker combination is a Chr1:29978285 SNP molecular marker, a Chr1: 29978475 SNP molecular marker, a Chr1:29979909 SNP molecular marker, Chr1:29979932 SNP molecular marker and Chr1:29979963 SNP molecular marker; among them, The nucleotide sequence of the Chr1:29978285 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 102 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is G or T; The nucleotide sequence of the Chr1: 29978475 SNP molecular marker is shown in SEQ ID No. 1, wherein the base at the 292 bp position from the 5' end of the sequence shown in SEQ ID NO: 1 is A or G; The nucleotide sequence of the Chr1:29979909 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 74 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or T; The nucleotide sequence of the Chr1:29979932 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 97 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is G or A; The nucleotide sequence of the Chr1:29979963 SNP molecular marker is shown in SEQ ID No. 2, wherein the base at the 128 bp position from the 5' end of the sequence shown in SEQ ID NO: 2 is C or A; Chr1: 29978475 SNP molecular marker was preliminarily identified as GG genotype, which showed that the calcium content in cassava root tubers was high; When the Chr1:29979909 SNP molecular marker was TT genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979932 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the Chr1:29979963 SNP molecular marker was AA genotype, it was preliminarily identified that the calcium content in cassava root tubers was high; When the genotypes of the Chr1:29978285 SNP molecular marker, the Chr1:29978475 SNP molecular marker, the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker are GT, AG, CT, GA, CA or TT, GG, TT, AA, AA, respectively, the cassava is identified as high-calcium cassava; The primer pair for amplifying or detecting the Chr1:29978285 SNP molecular marker and the Chr1:29978475 SNP molecular marker is GT1; the primer pair for amplifying or detecting the Chr1:29979909 SNP molecular marker, the Chr1:29979932 SNP molecular marker and the Chr1:29979963 SNP molecular marker is GT2; Primer pair GT1 included GT1_F: 5′ - CGTCTTTCTTTCCATGCAGATC - 3′ and GT1_R: 5′ -CTCCTATCCTCCCAGAATCTCC - 3′; Primer pair GT2 includes GT2_F: 5'-CAGGAACCTGTAGAAGCTCGG-3' and GT2_R: 5'-TGGCTATGCTTGGTTTTCAGG-3'.

Images