A DNA probe, kit and method for distinguishing water hyacinth from water hyacinth

Abstract

The present invention relates to a DNA probe, a kit and a method for distinguishing between hyacinthus annuus and water hyacinth, wherein the DNA probe sequence is the nucleotide sequence shown in SEQ.ID.NO.1. According to the alignment results of the chloroplast genomes of hyacinthus annuus and water hyacinth, the present application found that there is a differential site in the 11 kb region. Through this site, we can distinguish between hyacinthus annuus and water hyacinth, which is an ideal site for molecular markers. Primers are designed based on this, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) can be used to detect leaf tissues of hyacinthus annuus and water hyacinth. Molecular identification can be achieved by the presence or absence of fluorescent signals, so that hyacinthus annuus and water hyacinth can be distinguished reliably and effectively.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a DNA probe, a kit and a method for distinguishing water hyacinth from water hyacinth. Background Art

[0002] The flowers and leaves of Echeveria are of great ornamental value, and it is a waterscape plant that is very worthy of development and utilization. Eichhornia crassipes, also known as water hyacinth, is a member of the Echeveriaceae family. It has a particularly strong reproductive capacity. Once it invades freshwater bodies such as lakes, rivers, waterways, and ponds, as long as the conditions are suitable, it will continue to reproduce and quickly cover the entire water surface, reducing the light transmittance in the water body and the concentration of dissolved oxygen in the water, causing other aquatic plants and even aquatic animals to die due to lack of oxygen and light. It is currently the most harmful aquatic floating plant in the world and is listed as one of the world's top ten harmful weeds. Echeveria crassipes and water hyacinth are both Echeveriaceae plants, and their appearance is very similar. They are both aquatic plants, and their flower colors are both blue-purple, so there are certain limitations in distinguishing their external morphology.

[0003] Molecular identification technology is a technology that identifies molecular-level information based on differences in biological genomes. Compared with the subjectivity and complexity of traditional morphological feature identification, molecular identification technology can visualize and simplify the differences between species in the form of sequence data, so as to obtain more reliable identification results more efficiently.

[0004] Chloroplast genome (cpDNA) molecular markers are of great significance in the field of plant science, especially in phylogeny, evolutionary biology, species identification, population genetics, ecology and conservation biology. The chloroplast genome is usually a single circular molecule with a size ranging from 120-160 kb, containing a series of genes encoding photosynthesis, electron transfer and other biosynthetic pathways, which has high genetic stability, low recombination rate and maternal inheritance. These characteristics make the chloroplast genome an efficient and reliable molecular marker that can provide high-resolution information, especially suitable for analyzing distantly related plants and evaluating population structure, gene flow and historical dynamics. By comparing the chloroplast genomes of different species or populations, researchers can gain a deeper understanding of how plants adapt to various ecological environments and the evolutionary mechanisms behind them, thereby providing a scientific basis for biodiversity conservation and sustainable use. Summary of the invention

[0005] In order to solve the problems existing in the above technology, the present invention provides a DNA probe for distinguishing between Euphorbia obesa and Eupatorium edulis, and the sequence of the DNA probe is the nucleotide sequence shown in SEQ.ID.NO.1.

[0006] Wherein, the DNA probe is marked with a tracer marker.

[0007] Wherein, the label is an isotope label or a non-isotope label.

[0008] Wherein, the isotope label is an enzyme or a colored group.

[0009] And, a method for distinguishing water hyacinth from water hyacinth, comprising the following steps:

[0010] S1 extracts chloroplast genomic DNA from the plant to be tested;

[0011] S2 uses the chloroplast genome of the plant as a template for PCR amplification and uses the aforementioned DNA probe to detect the presence of chloroplast-specific genes;

[0012] S3 If the chloroplast-specific gene exists, the plant is judged to be water hyacinth.

[0013] And, a kit for distinguishing between Euphorbia obesa and Eupatorium wilfordii, the kit comprising the aforementioned DNA probe.

[0014] The beneficial effects of the present invention are as follows: according to the alignment results of the chloroplast genomes of the hyacinth and the water hyacinth, we found that there is a differential site in the 11kb region. Through this site, we can distinguish the hyacinth and the water hyacinth, which is an ideal site for molecular markers. We intercepted the upstream and downstream 80 bp sequence of the differential site as a reference sequence to select homologous sequences to design primers. PCR amplification was performed using the DNA of the hyacinth and the water hyacinth as templates, and a single bright band consistent with the expected size could be amplified in both templates, proving that the differential site fragment obtained by analyzing the chloroplast genome sequence exists and can be amplified and subsequently identified.

[0015] The PCR amplification products were sequenced by Sanger sequencing and the sequencing results were compared. The comparison results showed that there was a 15 bp insertion site at this site in Water Hyacinth, which could distinguish Water Hyacinth from D. yulanense. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) can be used to detect leaf tissues of D. yulanense and Water Hyacinth. Molecular identification can be achieved by the presence or absence of fluorescent signals, so that Water Hyacinth and D. yulanense can be reliably and effectively distinguished. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0017] Figure 1It is the electrophoresis band of PCR amplification of molecular markers of Yujiuhua and Water Hyacinthus. The electrophoresis bands from the left are Marker, cpDNA_PK (Yujiuhua), cpDNA_PC (Water Hyacinthus), negative control, and the band size is about 180 bp;

[0018] Figure 2 This is the comparison of the sequencing results of the differential sites between Yujiuhua and Eupatorium cylindrica. Among them, cpDNA_PK is Yujiuhua, cpDNA_PC is Eupatorium cylindrica, and the differential site of the gene sequence between the two is the position marked by 11260 bp in the figure;

[0019] Figure 3 It is the test result of nucleic acid test strips on the DNA amplification products of water hyacinth and rain lily, among which, CK: sterile water; negative control: rice leaf DNA; rain lily: rain lily leaf DNA; water hyacinth: water hyacinth leaf DNA. DETAILED DESCRIPTION

[0020] The technical scheme in the embodiment of the present invention is described clearly and completely below in conjunction with the accompanying drawings in the embodiment of the present invention. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below.

[0021] 1. Experimental instruments

[0022] High-speed refrigerated centrifuge: ThermoFisher, Micro 21R;

[0023] Constant temperature water bath: Jinghong, DK-S24;

[0024] Ultra-micro-spectrophotometer: ThermoFisher, NanoDrop2000;

[0025] PCR instrument: ThermoFisher, Applied Biosystems VeritiPro;

[0026] Gel electrophoresis instrument: Liuyi, DYY-8C;

[0027] Gel imaging system: VILBER, FUSION FX7;

[0028] 2. Experimental Reagents

[0029] Plant genomic DNA extraction kit: Tiangen, DP305;

[0030] 2 × Phanta Max Master Mix (Dye Plus): Norvegicus, P525;

[0031] D2000 molecular weight standard: Tiangen, MD114;

[0032] 3. Experimental Methods

[0033] Sample grinding: Use liquid nitrogen to grind the sample tissue into a uniform powder.

[0034] DNA extraction: refer to the instruction manual to extract DNA from leaf tissues of water hyacinth and water hyacinth plants and detect the concentration.

[0035] Acquisition of chloroplast genome: The whole chloroplast genome of the sample is sequenced, and after removing low-quality data, the clean reads are assembled to obtain relatively complete chloroplast genome data.

[0036] Sequence alignment: MAFFT software was used to align the chloroplast genomes of P. lycopersicum and E. hyacinth.

[0037] PCR primer design: According to the alignment results of the chloroplast genomes of Yujiuhua and Water Hyacinthus, the differential sites that can be distinguished were selected, and the sequences of the differential sites and 80 bp upstream and downstream were extracted. Primers were designed using Primer-BLAST, and PCR primers 11k-F = SEQ.ID.NO.2 = GTTAAAATGATCAACCAACG and 11k-R = SEQ.ID.NO.3 = GATGGATATCTAAATTGATAATGC were screened and synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0038] PCR amplification verification: Configure the PCR reaction system according to Table 1, and set the PCR program according to Table 2 for PCR amplification.

[0039] Table 1 PCR system

[0040]

[0041] Table 2 PCR program

[0042]

[0043] Gel electrophoresis: Use 1.5% agarose gel electrophoresis to detect the band size of PCR products.

[0044] Sequencing: PCR products whose electrophoresis band size is consistent with the expected results are sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0045] Sequence alignment: DNAMAN was used to align the differential sites of the chloroplast genomes of D. yujiuhua and Eupatorium cyrtonema.

[0046] Probe design: Following the probe design principles, an oligonucleotide probe of 45-50 nt in length was designed at the specific site of the chloroplast gene of water hyacinth, labeled with a FAM fluorescent group at the 5' end, modified with C3-spacer at the 3' end, and a d-Spacer (THF tetrahydrofuran) was inserted in the middle of the probe at a distance of more than or equal to 35 nt from the 5' end.

[0047] Probe sequence=SEQ.ID.NO.1: 5'-CGATGCGGGTTCGATTCCCGCTACCCGCTCTTTATTCTATATTACTATATTCTATAT-3';

[0048] The probe sequence after insertion into tetrahydrofuran was: 5′-CGATGCGGGTTCGATTCCCGCTACCCGCTCTTTATTCTATATT(THF)CTATATTCTATAT-3′;

[0049] 4. Experimental Results

[0050] 4.1 Chloroplast genome sequencing results

[0051] The chloroplast genomes of P. yujiu and Eupatorium cylindricum were uploaded to Genbank, and the accession numbers were obtained as shown in Table 3.

[0052] Table 3 Genbank accession numbers of chloroplast genome sequences of research samples

[0053]

[0054] 4.2 Differential site selection and amplification verification

[0055] The fragments about 80 bp upstream and downstream of the differential sites were amplified and verified, and the results of agarose nucleic acid electrophoresis were consistent with expectations, such as Figure 1 As shown, the target fragments were amplified from both Eupatorium wilfordii and Eupatorium edulis.

[0056] 4.3 Differential site sequencing and comparison

[0057] After aligning and analyzing the upstream and downstream fragment sequences of the differential sites, the differential sites can be screened out such as Figure 2 shown.

[0058] 4.4 Molecular marker probes

[0059] Fluorescent molecular marker oligonucleotide probes were designed, and the results are shown in Table 4.

[0060] Table 4 Fluorescent probe sequences based on specific sites

[0061]

[0062] 4.5 Verification Site

[0063] DNA amplification: Use primers 11k-F / 11k-R, fluorescent probes and amplification kits to prepare the amplification system according to the system in Table 5, and use sterile water instead of DNA template as a negative control. After preparing the amplification system, add 2 μL of Starter and place it in a 40℃ water bath for reaction for 30 min before use.

[0064] Table 5. Sample DNA isothermal amplification system

[0065]

[0066] Nucleic acid test strip detection: Take 10 μl of the amplified product, dilute it 10 times with Diluent buffer, and then add it dropwise to the test strip. After the chromatography reaction for 5 minutes, check the test line (T) and quality control line (C).

[0067] 4.6 Test Results

[0068] like Figure 3 As shown, the nucleic acid test strip test results show that CK sterile water has no color reaction, and the negative control is rice leaf DNA, and the test strip quality control line is colored, proving that the test strip can be used for detection experiments. In this experiment, the oligonucleotide fluorescent probe successfully combined with the water hyacinth leaf DNA, causing the fluorescent modifier to color, while the rain long flower leaf DNA did not bind to the probe, and the result was that the test line did not color. According to the test results, the molecular marker probe can be used to distinguish between the rain long flower and the water hyacinth.

[0069] 5. Conclusion

[0070] Based on the alignment results of the chloroplast genomes of P. yujiu and E. hyacinthus, we found a differential site in the 11 kb region. Through this site, we can distinguish P. yujiu and E. hyacinthus, which is an ideal site for molecular markers. We intercepted the 80 bp upstream and downstream sequences of the differential site as reference sequences and selected homologous sequences to design primers. PCR amplification was performed using DNA from P. yujiu and E. hyacinthus as templates. A single bright band with the expected size was amplified in both templates, proving that the differential site fragment obtained by chloroplast genome sequence analysis exists and can be amplified and subsequently identified.

[0071] The PCR amplification products were sequenced by Sanger sequencing and the sequencing results were compared. The comparison results showed that there was a 15 bp insertion site at this site in Water Hyacinth, which could distinguish Water Hyacinth from D. yulanense. Based on this site, an oligonucleotide fluorescent probe was designed, and molecular biological methods such as RPA (Recombinase Polymerase Amplification) can be used to detect leaf tissues of D. yulanense and Water Hyacinth. Molecular identification can be achieved by the presence or absence of fluorescent signals, so that Water Hyacinth and D. yulanense can be reliably and effectively distinguished.

[0072] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

Claims

1. A primer and a probe for distinguishing between Euphorbia obesa and Eupatorium edulis, characterized in that: The sequence of the probe is: 5'-CGATGCGGGTTCGATTCCCGCTACCCGCTCTTTATTCTATATT(THF)CTATATTCTATAT-3'; The primers are 11k-F and 11k-R; The sequence of the primer 11k-F is the nucleotide sequence shown in SEQ ID NO.2; The sequence of the primer 11k-R is the nucleotide sequence shown in SEQ ID NO.

3.

2. A kit for distinguishing water hyacinth from water hyacinth, characterized in that: The kit comprises the primers and probes as claimed in claim 1.

Images