A tobacco leaf development regulatory gene Ntfb1 and its application

Abstract

The present invention discloses a tobacco leaf development regulatory gene Ntfb1 and its application, belonging to the technical field of plant genetic engineering, wherein the genome sequence of the Ntfb1 gene is shown in SEQ ID NO.1, the CDS sequence is shown in SEQ ID NO.3, and the amino acid sequence of its expressed protein is shown in SEQ ID NO.2. The present invention finds that tobacco plants overexpressing the Ntfb1 gene grow slowly, have abnormal leaf development, and are shorter in height, while tobacco leaves significantly increase in size and the number of tobacco leaves increases after gene editing, indicating that the Ntfb1 gene participates in leaf growth and development as a negative regulatory factor.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering and molecular biology, and in particular to a tobacco leaf development regulating gene Ntfb1 and an application thereof. Background Art

[0002] Leaves are the most important part of the aboveground part of plants and the main place for plants to carry out life activities such as photosynthesis, respiration and transpiration. The morphology and development of leaves are closely related to the growth potential, nutrient supply, and response to adverse stress of plants. For agricultural production, cultivating specific leaf shapes, attachment angles and other forms through breeding, cultivation, chemical regulation and other means can improve the utilization rate of crop light energy and achieve high yields. Studies have also found that leaf shape can affect fruit quality. For example, the fruits of the round-leaf tomato varieties 'Stupice' and 'Glacier' have higher soluble solids content and yield than the fruits of other pinnate-leaf varieties of tomatoes (Rowland et al., 2020). For some crops that harvest leaves (such as sericulture, leaf vegetables, tobacco, etc.), the size and quality of leaves are directly related to economic benefits. Therefore, studying the regulatory mechanism of leaf growth and development is of great significance to improving crop quality, increasing yield and economic benefits.

[0003] F-box proteins play an important role in the plant hormone signaling pathway. There are many members in the family, and their biological functions are extremely diverse. They play a key role in regulating plant life processes, including many aspects of plant growth and development and plant physiology (Coates et al., 2006; Yin et al., 2020). The KISS ME DEADLY 1-3 (KMDs) family is one of the most intensively studied F-box protein families. It can directly target B-type response regulators (Evyatar et al., 2021) and regulate the transcriptional output of the cytokinin signaling pathway by targeting B-type response regulators (Kim et al., 2013). The rice F-box protein gene KISS ME DEADLY is involved in the cytokinin signal transduction process as a negative regulator (Kim et al., 2013). The Arabidopsis F-box protein gene FBX92 is an inhibitor of Arabidopsis leaf growth. Overexpressing plants have smaller leaves than wild-type plants (Joke et al., 2017). Arabidopsis plants with reduced AtFBX92 expression levels have accelerated cell division, resulting in an increase in cell number and thus larger leaves. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a tobacco leaf development regulatory gene Ntfb1 and an application thereof.

[0005] The present invention is achieved by adopting the following technical solutions:

[0006] The first object of the present invention is to provide a tobacco leaf development regulatory gene Ntfb1, the nucleotide sequence of the gene Ntfb1 is shown as SEQ ID NO.1, and the CDs sequence thereof is shown as SEQ ID NO.3.

[0007] As a further improvement of the present invention, the protein encoded by the gene Ntfb1 has an amino acid sequence as shown in SEQ ID NO.2.

[0008] The second objective of the present invention is to provide an application of the above-mentioned Ntfb1 gene in regulating tobacco leaf development.

[0009] As a further improvement of the present invention, the Ntfb1 gene negatively regulates leaf growth and development.

[0010] The third object of the present invention is to provide a gene editing vector, which is a CRISPR gene editing vector comprising an sgRNA target site sequence for knocking out the above-mentioned Ntfb1 gene.

[0011] As a further improvement of the present invention, the sgRNA target site sequence includes the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5:

[0012] SEQ ID NO.4: sgRNA1:AGGCTCGACGGTCGTTCCTTAGG;

[0013] SEQ ID NO.5: sgRNA2:AATGGAGTCAGCTTCTGATTCGG.

[0014] The fourth object of the present invention is to provide a genetically engineered bacterium, wherein the host cell is Agrobacterium containing the above-mentioned gene editing vector.

[0015] The fifth object of the present invention is to provide a method for cultivating large-leaf tobacco, wherein the tobacco Ntfb1 gene is knocked out and mutated to obtain large-leaf tobacco plants.

[0016] As a further improvement to the present invention, the following steps are included:

[0017] (1) Construct a recombinant gene CRISPR / Cas9 gene editing vector containing the tobacco Ntfb1 gene sgRNA target site sequence.

[0018] (2) The CRISPR / Cas9 gene editing vector was transferred into Agrobacterium competent cells, and the tobacco callus was infected by Agrobacterium-mediated infection to obtain tobacco seedlings. After the sequencing was correct, the seeds were cultured and propagated to obtain large-leaf tobacco.

[0019] The present invention knocks out the Ntfb1 gene in Yunyan 87 through CRISPR / Cas9 gene knockout technology, obtains a mutant with Ntfb1 function loss, and detects four mutation types through sequencing analysis. The first mutation type lacks 3 bases, the second mutation type has 1 more base, the third mutation type lacks 7 bases at the target site sgRNA1 and 1 base at the target site sgRNA2, and the fourth mutation type lacks 8 bases at the target site sgRNA1 and 1 base at the target site sgRNA2, resulting in the inability to normally express the protein encoded by Ntfb1. The four mutation types all cause the tobacco leaves to become wider and longer.

[0020] The beneficial effects of the present invention are: the Ntfb1 gene belongs to the F-box protein gene family member and has similar functions to the AtFBX92 gene. The present invention found that tobacco plants overexpressing the Ntfb1 gene grew slowly, had abnormal leaf development, and had shorter plant heights, while after gene editing, tobacco leaves significantly increased in size and the number of tobacco plant leaves increased, indicating that the Ntfb1 gene participates in leaf growth and development as a negative regulatory factor. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the overexpression vector construction map;

[0022] Figure 2 It is a map of gene editing vector construction;

[0023] Figure 3 is the Ntfb1 gene structure and editing target sequence location;

[0024] Figure 4 Four editing forms of NtFB1 protein; FB, Ntfb1 gene protein; crf1-4, four gene editing forms; blue box is F-box domain, red font is the differential protein sequence after editing;

[0025] Figure 5 This is a comparison of the leaf sizes of the wild type and four gene-edited tobacco plants (the 4th leaf from the bottom); WT, wild type; 1, crf-1; 2, crf-2; 3, crf-3; 4, crf-4;

[0026] Figure 6 This is a picture of leaves of overexpression and gene-edited tobacco plants. DETAILED DESCRIPTION

[0027] In order to make the technical means, creative features, objectives and effects of the present invention easier to understand, the present invention is further described below with reference to specific diagrams.

[0028] 1. Materials

[0029] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified. The primers used are indicated when they first appear, and the same primers used thereafter are the same as those indicated for the first time.

[0030] 2. Methods

[0031] The tobacco variety used in this experiment is Yunyan 87.

[0032] 2.1 Obtaining Ntfb1 gene overexpression strains

[0033] Primers were designed based on the tobacco Ntfb1 gene CDs sequence (shown in SEQ ID NO.3):

[0034] Primer(+):AACACGGGGGACTTTGCAACATGGGAAGCAAGTTTTTTATCAATGATAATCAAGATTTGCT;

[0035] Primer(-):CCGTCGTGGTCTTTGTAATCAACATTGACGGCGTTGCAAAGGAACATAAG;

[0036] Perform PCR amplification to obtain PCR amplification products, and recover the Ntfb1 gene by gel recovery; transfer the Ntfb1 gene into the pBWA(V)HS plasmid, as shown in Figure 1 As shown, the pBWA(V)HS-fb overexpression vector-3xflag-2 vector was constructed. After sequencing verification, Agrobacterium (GV3101) was transformed, and tobacco (Yunyan 87) was transformed using the Agrobacterium-mediated tobacco callus transformation method. After co-cultivation, screening, and differentiation and rooting, overexpression plants ox1 and ox2 were obtained.

[0037] 2.2 Obtaining Ntfb1 gene-edited strains and identifying their phenotypes

[0038] The present invention uses CRISPR / Cas9 technology to design and construct a gene editing vector for Ntfb1. The constructed gene editing vector map is as follows: Figure 2As shown. The design principles of sgRNA target site sequences are as follows: 1) The knockout site is in the coding (CDS) region and is as close to the front end of the protein or the important functional domain as possible; 2) Try to cover a higher proportion of transcripts; 3) There is no off-target or the off-target is located in the intergenic region; 4) Targets with higher editing efficiency are preferred; 5) The sequence has a relatively balanced GC content and is not easy to form secondary structures. The present invention uses the Huazhong Agricultural University CRISPR-P website for design (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and selects targets with high target scores, low off-target rates, and suitable locations as sgRNA target site sequences. The following sequence is the target used when constructing a gene editing vector for the Ntfb1 gene:

[0039] SEQ ID NO.4: sgRNA1:AGGCTCGACGGTCGTTCCTTAGG;

[0040] SEQ ID NO.5: sgRNA2:AATGGAGTCAGCTTCTGATTCGG;

[0041] The above two target sequences were constructed on the CRISPR gene editing vector to obtain the Ntfb1 gene editing vector, and the constructed gene editing vector was transferred into Agrobacterium. The target gene was transferred into the mature callus of Yunyan 87 by using the Agrobacterium infection tobacco transgenic technology. After co-cultivation, screening and differentiation and rooting process, transgenic T0 generation tobacco seedlings were obtained. Primers were designed, PCR amplified, and sent to a sequencing company for sequencing. The sequencing primer sequence is:

[0042] SEQ ID NO.6: crfb-F:ATGGGAAGCAAGTTTTTTATCAATG;

[0043] SEQ ID NO.7: crfb-R:TCAAACATTGACGGCGTTGCAAAGG;

[0044] The sequencing results were compared with the Ntfb1 genome sequence (DNA sequence as shown in SEQ ID NO.1, CDs sequence as shown in SEQ ID NO.3). Figure 3 As shown, it was found that the first mutation type lacked 3 bases, the second mutation type had 1 more base, the third mutation type lacked 7 bases at the target site sgRNA1 and 1 base at the target site sgRNA2, and the fourth mutation type lacked 8 bases at the target site sgRNA1 and 1 base at the target site sgRNA2, named crf-1, crf-2, crf-3, and crf-4. The above four mutation types all caused the protein NtFB1 (SEQ ID NO.2) encoded by Ntfb1 to be unable to be expressed normally, as shown in Figure 4shown.

[0045] After normal culture and growth, it was found that compared with the wild type Yunyan 87, the leaf length and width of crf-1, crf-2, crf-3 and crf-4 were longer and wider to varying degrees. Figure 5 shown.

[0046] like Figure 6 The figures shown are leaf phenotypes of wild-type, overexpression and gene-edited tobacco plants, respectively. Through phenotype investigation, it was found that the overexpression tobacco plants grew slowly, the leaves developed abnormally, and the plant height became shorter. However, after gene editing, the tobacco leaves increased significantly and the number of leaves in the tobacco plants increased, indicating that the Ntfb1 gene participates in leaf growth and development as a negative regulatory factor.

[0047] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A tobacco leaf development regulatory gene Ntfb1 The application in regulating tobacco leaf development is characterized in that: The gene Ntfb1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. Ntfb1 Negatively regulates tobacco leaf growth and development.

2. A method for cultivating large-leaf tobacco, characterized in that: Tobacco Ntfb1 Gene knockout mutation to obtain large leaves Ntfb1 Gene mutant tobacco plant, the tobacco Ntfb1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The method for growing large-leaf tobacco according to claim 2, characterized in that: The following steps are involved: (1) Constructing tobacco Ntfb1 A recombinant gene CRISPR / Cas9 gene editing vector containing a gene sgRNA target site sequence; wherein the sgRNA target site sequence includes the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO.5: SEQ ID NO.4: sgRNA1: AGGCTCGACGGTCGTTCCTTAGG; SEQ ID NO.5: sgRNA2: AATGGAGTCAGCTTCTGATTCGG; (2) The CRISPR / Cas9 gene editing vector was transferred into Agrobacterium competent cells, and the tobacco callus tissue was infected by Agrobacterium-mediated infection to obtain tobacco seedlings. After the sequencing was correct, the seeds were cultured and propagated to obtain large-leaf tobacco plants.

Images