Mutant sequences of the rice OsABCF3 gene and their methods and applications in regulating cadmium accumulation in rice.

By editing the OsABCF3 gene in rice and mutating its nucleotide sequence, the problem of excessive cadmium in rice was solved, and rice varieties with reduced cadmium absorption were cultivated, resulting in a significant reduction in cadmium content in rice and ensuring food security and human health.

CN118879728BActive Publication Date: 2026-06-30INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF SUBTROPICAL AGRICULTURE CHINESE ACADEMY OF SCIENCES
Filing Date
2024-08-02
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Excessive cadmium content in rice poses a threat to food security and human health, and current technologies lack effective genetic breeding methods to reduce cadmium accumulation.

Method used

By editing the rice OsABCF3 gene, a CRISPR/Cas9 editing vector was designed to mutate the nucleotide sequence of the OsABCF3 gene, resulting in loss or alteration of protein function and reduced cadmium absorption and accumulation.

Benefits of technology

Significantly reduce the cadmium content in rice, cultivate rice varieties with reduced cadmium absorption, and safeguard food security and human health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879728B_ABST
    Figure CN118879728B_ABST
Patent Text Reader

Abstract

This disclosure relates to a mutant sequence of the rice OsABCF3 gene and its methods and applications in regulating cadmium accumulation in rice. Specifically, it relates to a mutant sequence of the rice OsABCF3 gene, the protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its applications. This disclosure reduces cadmium accumulation in rice by mutating the nucleotide sequence of the rice OsABCF3 gene to eliminate its function. It provides genetic resources and technical support for breeding rice varieties with reduced cadmium absorption, and offers new methods and ideas for breeding low-cadmium varieties and producing safe food. This disclosure can effectively improve the problem of excessive cadmium content in rice, which is of great significance for solving food security issues. It also provides technical support for further in-depth research on the molecular mechanisms of cadmium absorption, translocation, and accumulation in rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure relates to the field of rice genetic engineering technology, specifically to a mutant sequence of the rice OsABCF3 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants, and its application. Background Technology

[0002] Cadmium (Cd) is a highly toxic heavy metal that poses a serious threat to the global soil environment, with cadmium pollution in my country's agricultural soils being particularly severe. In cadmium-contaminated soils, plant growth is significantly inhibited, often manifesting as stunted growth, chlorosis of leaves, and browning of root tips. Because cadmium is easily absorbed by plants and accumulates in edible parts, it can easily enter the human body through the food chain, causing serious damage to organs such as the kidneys and bones. To prevent further contamination of the food chain by cadmium, we must adopt effective countermeasures. One feasible strategy is to utilize genetic breeding technology to actively seek and cultivate new crop varieties with low cadmium accumulation. Simultaneously, we can also consider using certain plants with high accumulation capacity for bioremediation to reduce cadmium levels in the soil. However, to achieve these goals, we must first gain a deeper understanding of the mechanisms by which plants absorb, translocate, and accumulate cadmium.

[0003] Cadmium is not an essential element for plant growth; its absorption and transport primarily rely on other transport proteins and ion channels. Among these, ABC transporters are a class of widely distributed and functionally diverse proteins found in various organelles, including the plasma membrane, vacuolar membrane, and chloroplasts. They can transport a variety of substrates, such as hormones, metal ions, and metabolites. By regulating the transport and balance of these substrates, ABC transporters exert a profound influence on physiological processes such as hormone transport, toxin isolation, and secondary metabolite secretion in plants. Therefore, studying the functions of ABC proteins related to cadmium transport is crucial for improving crops to reduce cadmium accumulation. For example, in Arabidopsis thaliana, transporters such as AtABCC1, AtABCC2, and AtABCC3 can isolate the PC-Cd complex into vacuoles, thereby reducing cadmium concentration in root cells and decreasing cadmium transport to plant branches. Furthermore, under cadmium stress, the expression level of AtABCC6 is significantly upregulated, which may be a natural response of plants to cadmium stress. Meanwhile, overexpression of AtPDR8 and AtATM3 was also shown to reduce cadmium accumulation in plants and enhance their resistance to cadmium. These findings clearly demonstrate that ABC transporters play a crucial role in Arabidopsis thaliana's response to cadmium stress.

[0004] Rice is one of the main sources of cadmium ingestion for humans, and the problem of excessive cadmium levels in rice has attracted widespread attention. Although the rice genome contains as many as 128 ABC transporters, research on their specific functions is still relatively limited. Therefore, we need to further explore these molecular mechanisms and strive to discover the rice ABC transporter family genes associated with cadmium transport. This will help us to more comprehensively understand the plant response mechanisms to cadmium and provide important scientific evidence for developing low-cadmium rice varieties and formulating phytoremediation strategies for cadmium-contaminated soils. Summary of the Invention

[0005] In order to address the problem of excessive cadmium in rice in existing technologies, the purpose of this disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption.

[0006] To achieve the above objectives, the first aspect of this disclosure is a mutant sequence of the rice OsABCF3 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCF3 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCF3 gene.

[0007] The rice OsABCF1 gene has the nucleotide sequence described in (I) or (II):

[0008] (I) The nucleotide sequence shown in SEQ ID NO: 1;

[0009] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.

[0010] Optionally, the mutant sequence is selected from at least one of the following sequences:

[0011] (1) The nucleotide sequence shown in SEQ ID NO: 6 obtained by deleting the ACTCG fragment from position 5 to position 9 of the target site I sequence of the rice OsABCF3 gene;

[0012] (2) The nucleotide sequence shown in SEQ ID NO:7 obtained by deleting the fragment CTGACTCGTACGTCGTCACCAT from position 2 to position 23 of the target site I of the rice OsABCF3 gene;

[0013] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0014] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 8 and / or SEQ ID NO: 9.

[0015] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;

[0016] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0017] The fourth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;

[0018] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0019] The fifth aspect of this disclosure is a method for reducing cadmium content in rice, the method comprising: gene editing of the rice OsABCF3 gene to mutate the nucleotide sequence of the rice OsABCF3 gene and alter the protein encoded by the OsABCF3 gene.

[0020] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCF3 gene.

[0021] Optionally, the gene editing method includes:

[0022] S1. Design of CRISPR / Cas9 editing vector based on target site I of rice OsABCF3 gene;

[0023] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.

[0024] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0025] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;

[0026] The sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0027] Optionally, in step S1, the mutation includes one of the following:

[0028] (a) Deletion of the ACTCG segment from position 5 to position 9 of the target site I of the rice OsABCF3 gene;

[0029] (b) Deletion of the CTGACTCGTACGTCGTCACCAT fragment from position 2 to position 23 of the target site I of the rice OsABCF3 gene.

[0030] The sixth aspect of this disclosure provides the application of the rice OsABCF3 gene and / or the protein encoded by the rice OsABCF3 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.

[0031] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCF3 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0032] Through the above-described technical solution, this disclosure achieves the loss of function of the OsABCF3 gene by mutating its nucleotide sequence, thereby reducing cadmium accumulation in rice. This provides genetic resources and technical support for cultivating rice varieties with reduced cadmium absorption, and offers new methods and ideas for breeding low-cadmium varieties and producing safe food. This disclosure can effectively address the problem of excessive cadmium content in rice, which is of great significance for solving food security issues. It also provides technical support for further in-depth research into the molecular mechanisms of cadmium absorption, translocation, and accumulation in rice.

[0033] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0034] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings:

[0035] Figure 1 This is the OsABCF3 gene structure and mutant type in the example.

[0036] Figure 2 Gene-edited rice osabcf3-1 and osabcf3-2 Cadmium content test results for mutants and wild-type (WT) cadmium. Detailed Implementation

[0037] The specific embodiments of this disclosure will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit this disclosure.

[0038] The first aspect of this disclosure is a mutant sequence of the rice OsABCF3 gene, which is obtained by mutating the nucleotide sequence of the rice OsABCF3 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides in the rice OsABCF3 gene.

[0039] The rice OsABCF1 gene has the nucleotide sequence described in (I) or (II):

[0040] (I) The nucleotide sequence shown in SEQ ID NO: 1;

[0041] (II) A nucleotide sequence that has more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site and encodes a protein with the same function.

[0042] The amino acid sequence of the protein encoded by the rice OsABCF3 gene is shown in SEQ ID NO: 2.

[0043] In this disclosure, the inventors have made a surprising discovery that the OsABCF3 gene (accession number: LOC_Os04g56330) can regulate the accumulation of cadmium in rice. This disclosure discloses that by mutating the nucleotide sequence of the rice OsABCF3 gene to cause the loss of function of the gene, the accumulation of cadmium in rice can be effectively reduced, and rice varieties with reduced cadmium content can be cultivated.

[0044] According to this disclosure, sequences having more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site include sequences having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with the nucleotide sequence shown in SEQ ID NO: 1 at a non-mutation site, wherein the aforementioned homologous sequences can encode proteins with the same function as the nucleotide sequence shown in SEQ ID NO: 1.

[0045] In one specific embodiment of this disclosure, the mutant sequence is selected from at least one of the following sequences:

[0046] (1) The nucleotide sequence shown in SEQ ID NO: 6 obtained by deleting the ACTCG fragment from position 5 to position 9 of the target site I sequence of the rice OsABCF3 gene;

[0047] (2) The nucleotide sequence shown in SEQ ID NO:7 obtained by deleting the fragment CTGACTCGTACGTCGTCACCAT from position 2 to position 32 of the target site I of the rice OsABCF3 gene;

[0048] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0049] In the above embodiments, the inventors of this disclosure designed and edited a vector based on target site I, and infected rice plants with Agrobacterium. Mutations were randomly performed at the target site within the rice plants. Then, mutation sequence detection was performed using designed primers, and mutant lines with deletions of either the ACTCG or CTGACTCGTACGTCGTCACCAT fragments were selected. The deletion of either the ACTCG or CTGACTCGTACGTCGTCACCAT fragments leads to corresponding changes in codon order and composition, resulting in the premature appearance of the stop codon and premature termination of the encoded protein. This alters the structure and function of the protein encoded by the mutant sequence. Furthermore, the inventors of this disclosure also discovered that homozygous mutant plants with functional defective mutations in the OsABCF3 gene obtained through transgenics, exhibiting significantly lower cadmium content in rice grains compared to wild-type plants with deletions of either the GTCTGG or CTGACTCGTACGTCGTCACCAT fragments in the OsABCF3 gene nucleotide sequence, can be used to analyze the biological function of the OsABCF3 gene in rice, and has potential application value in agricultural development.

[0050] The second aspect of this disclosure provides a protein encoded by the mutant sequence described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 8 and / or SEQ ID NO: 9.

[0051] According to this disclosure, the nucleotide sequence shown in SEQ ID NO: 6 encodes the protein shown in SEQ ID NO: 8; the nucleotide sequence shown in SEQ ID NO: 7 encodes the protein shown in SEQ ID NO: 9.

[0052] The third aspect of this disclosure is a vector, which is a CRISPR / Cas9 editing vector, wherein the vector is inserted with target site I and produces a mutant sequence as described in the first aspect;

[0053] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0054] The fourth aspect of this disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant contains a target site I, or the transformant contains the vector described in the third aspect;

[0055] The nucleotide sequence of target site I is shown in SEQ ID NO: 3.

[0056] In this disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.

[0057] The fifth aspect of this disclosure is a method for reducing cadmium content in rice, the method comprising: gene editing of the rice OsABCF3 gene to mutate the nucleotide sequence of the rice OsABCF3 gene and alter the protein encoded by the OsABCF3 gene.

[0058] The mutations include substitutions, deletions, and / or additions of one or more nucleotides in the rice OsABCF3 gene.

[0059] In this disclosure, gene editing of the rice OsABCF3 gene alters the protein encoded by the OsABCF3 gene, thereby reducing or eliminating the expression level of the OsABCF3 gene and decreasing the activity of the protein encoded by the rice OsABCF3 gene. This is beneficial for cultivating rice varieties with reduced cadmium absorption and effectively solves the problem of excessive cadmium content in rice.

[0060] In one specific embodiment of this disclosure, the gene editing method includes:

[0061] S1. Design of CRISPR / Cas9 editing vector based on target site I of rice OsABCF3 gene;

[0062] S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers.

[0063] S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content.

[0064] The nucleotide sequence of target site I is shown in SEQ ID NO: 3;

[0065] The sequences of the primers are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0066] In the above embodiments, CRISPR-Cas9 technology was used to construct mutant plants, and two different types of mutant plants were screened for subsequent experiments. After planting the mutant plants in soil contaminated with the heavy metal cadmium, the Cd content of individual plant grains was measured. The results showed that the cadmium content in the mutant plant grains was significantly lower than that in the wild type. This indicates that OsABCF3 participates in regulating the absorption and translocation of Cd in rice, and the mutant strain disclosed in this invention can significantly reduce the heavy metal cadmium content in rice grains, contributing to food security and human health.

[0067] In a preferred embodiment of this disclosure, in step S1, the mutation includes one of the following:

[0068] (a) Deletion of the ACTCG segment from position 5 to position 9 of the target site I of the rice OsABCF3 gene;

[0069] (b) Deletion of the CTGACTCGTACGTCGTCACCAT fragment from position 2 to position 23 of the target site I of the rice OsABCF3 gene.

[0070] The sixth aspect of this disclosure provides the application of the rice OsABCF3 gene and / or the protein encoded by the rice OsABCF3 gene in regulating cadmium accumulation in rice and / or breeding rice varieties with reduced cadmium uptake.

[0071] The seventh aspect of this disclosure provides the application of mutant sequences of the rice OsABCF3 gene described in the first aspect, the protein described in the second aspect, the vector described in the third aspect, or the transformant described in the fourth aspect in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium uptake.

[0072] In this disclosure, OsABCF3 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Modification of OsABCF3 can optimize the cadmium accumulation characteristics of rice and reduce the amount of cadmium accumulated in rice grains. Breeding rice varieties with reduced cadmium absorption using mutants of the rice OsABCF3 gene has potential application value in agriculture.

[0073] The present disclosure is further described in detail below through examples.

[0074] All raw materials used in the examples are commercially available. Unless otherwise specified, the experimental conditions in the examples were performed under conventional conditions known to those skilled in the art.

[0075] Example 1

[0076] 1. Construction of OsABCF3 mutant plants.

[0077] The OsABCF3 gene is 2030 bp in length. CRISPR-Cas9 genome knockout system was used to create mutant plants of the OsABCF3 gene. First, CRISPR target sites were designed based on the coding region sequence (sequence shown in SEQ ID NO: 3), and the pCRISPR-OsABCF3 plasmid with OsABCF3-specific target was constructed. Then, mutant plants were constructed by infecting wild-type Nipponbare rice callus with Agrobacterium strain. Finally, homozygous mutant plants were screened by PCR, and specific primers were designed:

[0078] Forward primer F: 5'-GAAGGCCGGTAGATCGAGG-3' (SEQ ID NO: 4); Reverse primer R: 5'-GTCTTCCCCTTGCCGTTGG-3' (SEQ ID NO: 5).

[0079] After PCR amplification and sequencing of the designed target sites, two independent homozygous mutant plants were selected. (osabcf3-1) SEQ ID NO: 6 and osabcf3-2 (SEQ ID NO: 7) The following experiments were performed. Target sites and mutation types for wild-type and mutant strains are as follows: Figure 1 As shown.

[0080] 2. Analysis of Cd content in OsABCF3 mutant plants.

[0081] Wild-type WT and osabcf3-1 and osabcf3-2 The mutants were transplanted to an experimental field in Beishan Town, Changsha County, Hunan Province. The soil there was slightly acidic (pH 5.4-6.2) with a Cd content of 1.8 mg / kg. Field planting was conducted using a randomized block design with 3-5 replicates. Except for intermittent irrigation, all other field management practices were standard. Rice grains were harvested from individual plants, and the Cd content was determined by ICP-MS after treatment. Results are as follows... Figure 2 As shown, "*" indicates a comparison with the wild type. p <0.05. osabcf3-1 and osabcf3-2 The Cd content in the seeds of the mutant plants was significantly lower than that of the wild type, indicating that... osabcf3-1 and osabcf3- 2 The mutation reduced the accumulation of Cd in rice grains.

[0082] The above examples show that OsABCF3 participates in the transport of the heavy metal cadmium in rice, increasing the rice's sensitivity to cadmium. Improving OsABCF3 can optimize the cadmium accumulation characteristics of rice and reduce the amount of heavy metal cadmium accumulated in rice.

[0083] The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings. However, the present disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0084] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0085] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A method of reducing cadmium content in rice grain, characterized by, The method includes: mutating the nucleotide sequence of the rice OsABCF3 gene by gene editing, thereby causing the protein encoded by the OsABCF3 gene to lose its function; The mutations include the substitution, deletion, and / or addition of one or more nucleotides in the rice OsABCF3 gene; The gene editing method includes: S1. Design a CRISPR / Cas9 editing vector based on target site I of the rice OsABCF3 gene; S2. The CRISPR / Cas9 editing vector was infected into rice plants by Agrobacterium tumefaciens. Mutations were randomly performed on the target site I in the rice plants. The T0 generation of positive plants with functional defect mutations were then screened according to the designed primers. S3. Self-pollinate the T0 generation positive plants and screen to obtain T1 generation homozygous mutant plants, thus obtaining rice plants with reduced cadmium content. The nucleotide sequence of target site I is shown in SEQ ID NO: 3; The sequences of the primers are shown in SEQ ID NO: 4 and SEQ ID NO: 5; The nucleotide sequence of the rice OsABCF3 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the rice OsABCF3 gene is shown in SEQ ID NO:

2.

2. The method of claim 1, wherein, In step S2, the mutation includes one of the following: (a) Deletion of the ACTCG segment from position 5 to position 9 of the target site I of the rice OsABCF3 gene; (b) Deletion of the CTGACTCGTACGTCGTCACCAT fragment from position 2 to position 23 of the target site I of the rice OsABCF3 gene.

3. The use of knocking out the rice OsABCF3 gene in breeding rice varieties with reduced cadmium uptake in rice grains, wherein, The nucleotide sequence of the rice OsABCF3 gene is shown in SEQ ID NO: 1.