A method for in situ detection of the quaternary structure of oligomeric enzymes displayed on the yeast surface based on FRET

Abstract

The present application discloses a method for in-situ detecting the quaternary structure of oligomeric enzymes on the surface of yeast based on FRET, including: using Saccharomyces cerevisiae as the chassis strain, knocking out genes PPQ1, ALO1, NAM7 and GAL80, and introducing multiple copies of tyrosyl-tRNA synthetase and tRNA CUA Tyr ; selecting sites at the oligomeric enzyme interface and mutating them into cysteine and TAG codons respectively, and using an anchor protein to mediate the surface display of the oligomeric enzyme on Saccharomyces cerevisiae; inducing protein expression by adding galactose and fermenting para-azido-phenylalanine; adding Cy3-maleimide for coupling with the cysteine of the oligomeric enzyme displayed on the yeast surface, and adding Cy5-DBCO for coupling with the azide group of the oligomeric enzyme displayed on the yeast surface; using a confocal microscope to characterize the donor, acceptor and FRET signals. The present invention does not require separating the displayed oligomeric enzyme from the yeast cell surface and can detect the quaternary structure of the oligomeric enzyme in-situ on the cell surface.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular, relates to a method for in situ detection of a quaternary structure of an oligomerase displayed on a yeast surface based on FRET (fluorescence resonance energy transfer). Background Art

[0002] The dissociation of oligomerase subunits is a major limiting factor affecting its application prospects. However, the current technology used to detect the quaternary structure of oligomerase displayed on the yeast surface mainly characterizes the structure indirectly by cutting off the enzyme displayed on the yeast surface. There may be problems such as low enzyme cutting efficiency, changes in the oligomeric structure after enzyme cutting, and failure to truly reflect the structure of the cell surface enzyme. Traditional biophysical techniques (e.g., circular dichroism, fluorescence, FTIR, NMR, crystallography) are sometimes difficult to apply to interface systems (e.g., due to poor signal / background ratio). Summary of the invention

[0003] The present invention aims to solve at least one of the technical problems in the related art to a certain extent. To this end, the present invention proposes a method for in situ detection of the quaternary structure of oligomeric enzymes displayed on the surface of yeast based on FRET. The present invention introduces a fluorescent probe into the oligomeric enzymes displayed on the surface of yeast, and uses the FRET technology to in situ detect the oligomeric structure of the enzyme on the cell surface. The present invention avoids the method of cutting the enzyme from the cell wall, and realizes the real-time and in situ detection of the oligomeric structure of the oligomeric enzymes displayed on the surface of yeast. The method of using FRET improves the signal-to-noise ratio of the interface system between the protein and the cell.

[0004] The technical solution adopted by the present invention is:

[0005] The present invention provides a method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET, comprising:

[0006] (1) Using Saccharomyces cerevisiae as the base strain, the genes PPQ1, ALO1, NAM7, and GAL80 were knocked out, and multiple copies of tyrosyl-tRNA synthase (OmeRS) and its corresponding tRNA were introduced simultaneously CUA Tyr ;

[0007] (2) Select sites at the oligomerase interface to be mutated into cysteine ​​and TAG codons respectively, and use anchor protein to mediate the oligomerase on the surface of Saccharomyces cerevisiae; and induce protein expression by adding galactose and p-azido-phenylalanine (pAzF) for fermentation;

[0008] (3) adding donor fluorescent molecule Cy3-maleimide to couple with cysteine ​​of oligomeric enzyme displayed on yeast surface, and adding acceptor fluorescent molecule Cy5-DBCO to couple with azide group of oligomeric enzyme displayed on yeast surface;

[0009] (4) characterization of donor, acceptor, and FRET signals using confocal microscopy;

[0010] The gene sequence of tyrosyl-tRNA synthase is shown in SEQ ID NO.1, tRNA CUA Tyr The sequence is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0011]

[0012]

[0013] In step (1) of the method of the present invention, genes PPQ1, ALO1 and NAM7 that can affect the insertion of unnatural amino acids are knocked out, and GAL80 is knocked out to increase the activity of the GAL1 promoter, and tyrosyl-tRNA synthase and tRNA derived from Escherichia coli are expressed in Saccharomyces cerevisiae. CUA Tyr It is used to introduce the unnatural amino acid pAzF at the position of the specific amber codon TAG. The side chain of pAzF contains an azide group, which can be coupled to the cyclooctyne-functionalized Cy5 fluorescent molecule. Rare cysteine ​​mutations are used to couple maleimide-functionalized Cy3 fluorescent molecules. Confocal microscopy is then used to characterize the donor, acceptor and FRET signals, realizing the in situ detection of the quaternary structure of the oligomerase on the cell surface.

[0014] In some embodiments, the Saccharomyces cerevisiae is Saccharomyces cerevisiae BY4741.

[0015] In some embodiments, the promoter for expressing OmeRS is the GPD promoter, the terminator is the GPM1 terminator, and the tRNA is expressed CUA Tyr The promoter is SNR52 promoter, and the terminator is SUP4 terminator, wherein the gene sequence of GPD promoter is shown as SEQ ID NO.4, the gene sequence of GPM1 terminator is shown as SEQ ID NO.5, the sequence of SNR52 promoter is shown as SEQ ID NO.6, and the sequence of SUP4 terminator is shown as SEQ ID NO.7.

[0016]

[0017]

[0018] In some embodiments, the two sites at the oligomerase interface that are mutated to cysteine ​​and TAG codons, respectively, are located in the inactive center, and the distance between the two sites is less than that of Cy3 and Cy5. distance.

[0019] In some embodiments, inducing protein expression in step (2) is performed in YPG-G418 medium supplemented with pAzF at a final concentration of 0.5-10 mM.

[0020] In some embodiments, the excitation wavelength of the donor fluorescent molecule is 500-554 nm, and the detection wavelength is 546-630 nm; the excitation wavelength of the acceptor fluorescent molecule is 582-648 nm, and the detection wavelength is 650-740 nm. The excitation wavelength of the FRET channel is 500-535 nm, and the detection wavelength is 649-740 nm.

[0021] In a specific embodiment, the excitation wavelength of the Cy3 channel is 516nm, the detection wavelength is 550-590nm, the excitation wavelength of the FRET channel is 516nm, the detection wavelength is 650-730nm, the excitation wavelength of the Cy5 channel is 640nm, and the detection wavelength is 650-730nm; the laser "intelligent gain" values ​​of the Cy3 channel, Cy5 channel and FRET channel are set to 15%, 15% and 20% respectively.

[0022] In some embodiments, when there are obvious donor signals, acceptor signals, and FRET signals, it is determined that a subunit interface exists; when there are obvious donor signals and acceptor signals but no FRET signal is shown, it is determined that the subunits of the oligomerase are dissociated;

[0023] In some embodiments, the method further comprises the step of calculating the FRET ratio, FRET ratio = F FRET / F 供体 , where F FRET is the fluorescence signal of Cy5 at its detection wavelength, F 供体 is the fluorescence signal of Cy3 at its detection wavelength.

[0024] In some embodiments, the method further comprises determining the effect of external conditions on the subunit interface stability of the oligomerase displayed on the yeast surface based on the change in FRET ratio.

[0025] In some embodiments, the method further comprises determining the effects of different expression systems of the yeast surface-displayed oligomerase on the subunit interface stability based on the change in FRET ratio.

[0026] In a specific embodiment, the FRET ratio is quantified using ImageJ and Leica Las X software.

[0027] In some embodiments, the anchoring protein is selected from one of a Pir1 anchoring protein, a Sed1 anchoring protein, or an Agα anchoring protein.

[0028] The gene sequence of the Pir1 anchoring protein is shown in SEQ ID NO.8; the gene sequence of the Sed1 anchoring protein is shown in SEQ ID NO.9, and the gene sequence of the Agα anchoring protein is shown in SEQ ID NO.10.

[0029]

[0030]

[0031] In a specific embodiment, the oligomerase is β-glucuronidase (PGUS), and the accession number of the gene sequence of β-glucuronidase in GeneBank is EU095019.

[0032] In some embodiments, the promoter used in step (2) for the surface display of oligomerase mediated by anchor protein in Saccharomyces cerevisiae is GAL1 promoter, the signal peptide is SED1 signal peptide, and the terminator is ENO2 terminator. The gene sequence of the GAL1 promoter is shown in SEQ ID NO.11, the gene sequence of the SED1 signal peptide is shown in SEQ ID NO.12, and the sequence of the ENO2 terminator is shown in SEQ ID NO.13.

[0033]

[0034]

[0035] Advantages and beneficial effects of the present invention.

[0036] 1. The present invention does not need to separate the displayed oligomerase from the yeast cell surface, and can detect the quaternary structure of the oligomerase in situ on the cell surface, which has the advantages of fewer experimental steps and simple operation.

[0037] 2. The FRET technology used in the present invention to detect the quaternary structure of oligomerase on the cell surface has the characteristics of high signal-to-noise ratio and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the following description of the embodiments in conjunction with the accompanying drawings, in which:

[0039] Figure 1 Schematic diagram for the construction of BY4741-ΔPANG strain.

[0040] Figure 2 This is a picture of colony PCR and agarose gel electrophoresis verification of the successful construction of BY4741-ΔPANG strain.

[0041] Figure 3Schematic diagram of the construction of pRS41K-EGFP-TAG-mRFP plasmid.

[0042] Figure 4 This is a picture of colony PCR and agarose gel electrophoresis verification of the successful construction of the ΔPANG-ERFP strain.

[0043] Figure 5 Schematic diagram for the construction of pRS41K-PGUS-Pir1 and pRS41K-PGUS-Pir1+Flag plasmids.

[0044] Figure 6 Images of successful colony PCR agarose gel electrophoresis verification of the construction of LA, LA-W522A, SA, SA-W522A, PGUS-Pir1, S35C-Pir1, D220TAG-Pir1, G153C-Pir1, E488TAG-Pir1, LC, and SC strains.

[0045] Figure 7 The fluorescence of EGFP and mRFP of the reporter gene-containing strains with or without the addition of 5 mM pAzF is shown.

[0046] Figure 8 Selection of sites that can produce FRET effects at the interface of the large (a) and small (b) subunits of PGUS. (c) Fluorescence gel image of mutants containing pAzF after cross-linking with Cy3 and Cy5.

[0047] Fig. 9 Figure 2 FRET-based detection of the subunit interface of surface-displayed PGUS. (a) FRET signals characterize the interface of the large subunit displaying PGUS in strains LA, LA-W522A, and LC. (b) FRET signals characterize the interface of the small subunit displaying PGUS in strains SA, SA-W522A, and SC. (c) FRET ratios (F FRET / F 供体 ). (d) shows the FRET ratios of SA, SA-W522A, and SC.

[0048] Fig.10 The FRET ratios of strains LA and SA change with temperature (a) or urea concentration (b).

[0049] Fig.11 The FRET signals and corresponding FRET ratios of strains BY4741-ΔPANG, S35C-Pir1, D220pAzF-Pir1, G153C-Pir1, and E488pAzF-Pir1 were used to exclude the FRET effects of other cell surface proteins and surface-displayed PGUS. DETAILED DESCRIPTION

[0050] Embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0051] The present application is made by the inventors based on the following facts: FRET (fluorescence resonance energy transfer) is widely used to monitor intermolecular binding between macromolecules and conformational changes within biomolecules. Since the fluorescence of donor and acceptor fluorophores varies according to the distance between the donor and the acceptor, changes in the spatial position or distance between different domains or subunits can be observed. Common strategies for labeling proteins with FRET fluorescence include fusion expression of fluorescent proteins, but they can only be incorporated into the C-terminus or N-terminus of the target protein, but not into the target protein sequence, and they may disrupt the structure and function of the protein. The present invention benefits from the development of genetic codon expansion technology, which enables many unnatural amino acids to be introduced into specific sites of yeast cell surface proteins, and coupled to various synthetic fluorescent dyes through click reactions to reduce the impact on the structure and function of the protein.

[0052] The following is a description of the terminology:

[0053] The term "surface display system" refers to the use of cell surface display technology to immobilize exogenous proteins or polypeptides on the cell surface. Surface display systems include, for example, prokaryotic surface display systems and eukaryotic surface display systems. In one embodiment, the eukaryotic surface display system includes a yeast surface display system. In one embodiment, the eukaryotic surface display system can be used to display proteins or polypeptides that require post-translational modifications such as phosphorylation, glycosylation, methylation, acetylation, hydroxylation, disulfide bond isomerization, etc.

[0054] The term "oligomeric enzyme" refers to a multi-subunit enzyme consisting of at least two polypeptide chains covalently or non-covalently linked together. The term "oligomeric enzyme" encompasses a multi-subunit enzyme, wherein at least two subunits of the enzyme are covalently or non-covalently linked together. The term "oligomeric enzyme" includes homo-oligomeric enzymes, which are multi-subunit enzymes consisting of only one type of monomer (subunit), and hetero-oligomeric enzymes, which are composed of different types of monomers (subunits).

[0055] The term "promoter" refers to a nucleic acid sequence that is usually present upstream (5' end) of the target gene coding sequence and can guide the transcription of the nucleic acid sequence into mRNA. Generally, the promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for the correct initiation of transcription.

[0056] The term "terminator" refers to a nucleic acid sequence that is usually present downstream (3' end) of the coding sequence of a gene of interest and is capable of terminating the transcription of the nucleic acid sequence into mRNA.

[0057] Sources

[0058] Restriction endonucleases were purchased from Takara Bio, DNA polymerase was purchased from Novazonics, primer synthesis, gene synthesis and gene sequencing were performed by GeneWeiZhi, gel recovery kit and plasmid extraction kit were purchased from Tiangen, glycyrrhizic acid was purchased from Xinjiang Tianshan Pharmaceutical, His-tag ELISA kit was purchased from GenScript, p-azido-phenylalanine (pAzF) was purchased from Merrill, and Cy3-maleimide and Cy5-DBCO were purchased from Xi’an Dianhua.

[0059] Example 1 Construction of chassis strains

[0060] Expression cassette P SNR52 -tRNA2 CUA Tyr -T SUP4 , P GPD -OmeRS-T GPM1 and P PGK1 -3×(P SUP4 -tRNA1 CUA Tyr -T SUP4 ) was obtained by gene synthesis. tRNA1 CUA Tyr (Gene sequence is shown in SEQ ID NO.2) and tRNA2 CUA Tyr (The gene sequence is shown in SEQ ID NO.3) are two tRNA substrates corresponding to tyrosyl tRNA synthase, tRNA1 CUA Tyr and tRNA2 CUA Tyr Both can bind to pAzF under the catalysis of tyrosyl tRNA synthase. The gene sequence of PGK1 promoter is shown in SEQ ID NO.14, and the sequence of SUP4 promoter is shown in SEQ ID NO.15:

[0061]

[0062]

[0063] The expression cassette P was amplified using primers tRNA2-F and tRNA2-R. SNR52 -tRNA2 CUA Tyr -T SUP4Sequence, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, expression cassette P SNR52 -tRNA2 CUA Tyr -T SUP4 1 μL of gene template, 2 μL of primers tRNA2-F and tRNA2-R (10 μM), 1 μL of Phanta high-fidelity DNA polymerase, and double distilled water to 50 μL. Amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. Use primers OmeRS-F and OmeRS-R to amplify the expression cassette P GPD -OmeRS-T GPM1 Sequence, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, expression cassette P GPD -OmeRS-T GPM1Gene template 1μL, primers OmeRS-F and OmeRS-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water supplemented to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (30 cycles); 72℃ extension for 10 minutes. Primers His3-F and His3-R were used to amplify the histidine auxotrophic selection marker His3 gene sequence from the Saccharomyces cerevisiae genome. The amplification system is: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, template Saccharomyces cerevisiae genome 1μL, primers His3-F and His3-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water supplemented to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute (30 cycles); 72℃ extension for 10 minutes. The left arm sequence of the PPQ1 gene was amplified from the Saccharomyces cerevisiae genome using primers PPQ1L-F and PPQ1L-R. The amplification system was: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, template Saccharomyces cerevisiae genome 1μL, primers PPQ1L-F and PPQ1L-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, and double distilled water supplemented to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute (30 cycles); 72℃ extension for 10 minutes. The right arm sequence of the PPQ1 gene was amplified from the Saccharomyces cerevisiae genome using primers PPQ1R-F and PPQ1R-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers PPQ1R-F and PPQ1R-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water was added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The expression cassette P was recovered by Tiangen agarose gel DNA recovery kit SNR52 -tRNA2 CUA Tyr -T SUP4 Gene fragment, expression cassette P GPD -OmeRS-T GPM1 Gene fragment, histidine auxotrophic screening marker His3 gene sequence, and PPQ1 left and right arm genes, primer sequences are as follows:

[0064] tRNA2-F:GATGCGTAAGGAGAAAATACCGCATCAGGCTTGATATCGAATTCCTGCAGCCCG(SEQ IDNO.16)

[0065] tRNA2-R:CACCCCGCGAATTCGTTCAAGTCTACAAAAAAGATCTCGGCTCTAGAC(SEQ IDNO.17)OmeRS-F:ACTTGAACGAATTCGCGGGGTG(SEQ ID NO.18)

[0066] OmeRS-R:CCCGTTGTAACGCTCATTACTGCCGGCTTCTAATCCGTCGAGTTTATCATTATCAATACTGC(SEQ ID NO.19)

[0067] His3-F:GAGAAGAAGCCCGTCCAGATCAACTAGTACACTCTATATTTTTTTATGCCTCGG(SEQ IDNO.20)

[0068] His3-R:GCAGGAATTCGATATCAAGCCTGATGCGGTATTTTCTCCTTACGCATC(SEQ ID NO.21)PPQ1L-F:CTCTCTGCAGCCGACTACGAGG(SEQ ID NO.22)

[0069] PPQ1L-R:CCGAGGCATAAAAAAATATAGAGTGTACTAGTTGATCTGGACGGGCTTCTTCTC(SEQ IDNO.23)

[0070] PPQ1R-F:GATAAACTCGACGGATTAGAAGCCGGCAGTAATGAGCGTTACAACGGG(SEQ IDNO.24)PPQ1R-R:CGTATTACGCCGATTAGGCTGACAC(SEQ ID NO.25)

[0071] The fragments amplified above were mixed in an equimolar ratio, and 10 μL was taken for electroporation transformation into fresh Saccharomyces cerevisiae BY4741 competent cells. Spread on SD solid medium lacking histidine (SD-his) and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on the SD-his plate for preservation. Randomly pick recombinant bacteria from the preserved SD-his streaked plate, pick 3 parallel control groups each, inoculate them into a test tube containing 5 mL of SD-his liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use primers PPQ1L-F and tRNA2-R to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplified the target band were preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown below. Figure 1 As shown, the colony PCR verification results are as follows Figure 2 As shown. PPQ1 was knocked out and one copy of tRNA2 was introduced CUA Tyr The positive strain for OmeRS was named BY4741-ΔP.

[0072] The tandem expression cassette P was amplified from the BY4741-ΔP strain using primers tRNA2-OmeRS-F and tRNA2-OmeRS-R. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1Gene fragment, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, BY4741-ΔP genome template 1μL, primers tRNA2-OmeRS-F and tRNA2-OmeRS-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water added to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (30 cycles); 72℃ extension for 10 minutes. The leucine auxotrophic screening marker Leu2 gene sequence was amplified from the Saccharomyces cerevisiae genome using primers Leu2-F and Leu2-R. The amplification system was: PhantaBuffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers Leu2-F and Leu2-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. Primers ALO1L-F and ALO1L-R were used to amplify the left arm sequence of the ALO1 gene from the Saccharomyces cerevisiae genome. The amplification system was: PhantaBuffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers ALO1L-F and ALO1L-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The right arm sequence of the ALO1 gene was amplified from the Saccharomyces cerevisiae genome using primers ALO1R-F and ALO1R-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers ALO1R-F and ALO1R-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water was added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The tandem expression cassette P was recovered by Tiangen agarose gel DNA recovery kit. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1Gene fragment, leucine auxotrophic screening marker Leu2 gene sequence and ALO1 site left and right arm sequences, primer sequences are as follows:

[0073] tRNA2-OmeRS-F: CCTAATTTGATATTGGAGGGCTTGATATCGAATTCCTGCAGCCCG (SEQ IDNO.26)

[0074] tRNA2-OmeRS-R: CCTTCAATGCCATCCCCCTCAGGCTTCTAATCCGTCGAGTTTATCATTATCAATACTG (SEQ ID NO.27) Leu2-F: CGATATTATCAGGTTTTTCACCCCATGTCAACTGTGGGAATACTCAGGTATCGTAAG (SEQ ID NO.28)

[0075] Leu2-R: CCCGGGCTGCAGGAATTCGATATCAAGCCCTCCAATATCAAATTAGGAATCGTAGTTTCATG (SEQ ID NO. 29)

[0076] ALO1L-F:GTGGGTGCCGACTCATACGC(SEQ ID NO.30)

[0077] ALO1L-R:CTTACGATAACCTGAGTATTCCCACAGTTGACATGGGGTGAAAAACCTGATAATATCGG(SEQ ID NO.31)

[0078] ALO1R-F: ATGATAAACTCGACGGATTAGAAGCCTGAGGGGGATGGCATTGAAGG (SEQ ID NO. 32) ALO1R-R: GCATGTCTCTACTATCGACATTGTTGCG (SEQ ID NO. 33)

[0079] The fragments amplified above were mixed in an equimolar ratio, and 10 μL was transformed into fresh Saccharomyces cerevisiae BY4741-ΔP competent state by electroporation. Spread on SD solid culture medium lacking leucine (SD-leu) and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on an SD-his plate for preservation. Randomly pick recombinant bacteria from the preserved SD-leu streaked plate, pick 3 parallel control groups each, inoculate them into a test tube containing 5 mL of SD-leu liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use primers ALO1L-F and tRNA2-R to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplified the target band were preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown in the figure. Figure 1 As shown, the colony PCR verification results are as follows Figure 2 As shown. PPQ1 and ALO1 were knocked out, and two copies of tRNA2 were introduced at the same time. CUA Tyr and OmeRS-positive strain, named BY4741-ΔPA.

[0080] The tandem expression cassette P was amplified from the BY4741-ΔPA strain using primers tRNA2-OmeRS-2F and tRNA2-OmeRS-2R. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1 Gene fragment, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, BY4741-ΔPA genome template 1μL, primers tRNA2-OmeRS-2F and tRNA2-OmeRS-2R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water added to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (30 cycles); 72℃ extension for 10 minutes. The hygromycin resistance gene HygR sequence was amplified from the Saccharomyces cerevisiae genome using primers hyg-F and hyg-R. The amplification system was: PhantaBuffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers hyg-F and hyg-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The expression cassette P was amplified using primers tRNA1-F and tRNA1-R. PGK1-3×(P SUP4 -tRNA1 CUA Tyr -T SUP4 ) sequence, the amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, containing P PGK1 -3×(P SUP4 -tRNA1 CUA Tyr -T SUP4 ) plasmid template 1μL, primers tRNA1-F and tRNA1-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water supplemented to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute (30 cycles); 72℃ extension for 10 minutes. The left arm sequence of the NAM7 locus gene was amplified from the Saccharomyces cerevisiae genome using primers NAM7L-F and NAM7L-R. The amplification system is: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, template Saccharomyces cerevisiae genome 1μL, primers NAM7L-F and NAM7L-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water supplemented to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute (30 cycles); 72℃ extension for 10 minutes. The right arm sequence of the NAM7 locus gene was amplified from the Saccharomyces cerevisiae genome using primers NAM7R-F and NAM7R-R. The amplification system was: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, template Saccharomyces cerevisiae genome 1μL, primers NAM7R-F and NAM7R-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, and double distilled water supplemented to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 1 minute (30 cycles); 72℃ extension for 10 minutes. The tandem expression cassette P was recovered by Tiangen agarose gel DNA recovery kit. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1 Gene fragment, hygromycin resistance gene HygR sequence, expression cassette P PGK1 -3×(P SUP4 -tRNA1 CUA Tyr -T SUP4 ) sequence and the left and right arm sequences of the NAM7 site, and the primer sequences are as follows:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0081] <h2 style=";text-align:left;direction:ltr"> tRNA2-OmeRS-2F:CGTCCGGAGGGCAAAGGAATAATGACACCGATTATTTAAAGCTGCAGCATACG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0082] <h2 style=";text-align:left;direction:ltr"> (SEQ ID NO.34)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0083] <h2 style=";text-align:left;direction:ltr"> tRNA2-OmeRS-2R:GGGAGGGACACCTTTTATACGCTTTCGGGCTTCTAATCCGTCGAGTTTATCATTATCAATACTG(SEQ ID NO.35)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0084] <h2 style=";text-align:left;direction:ltr"> hyg-F:GTAGAAATGGATCCCCACACACCGACATGGAGGCCCAGAATACCCTC(SEQ ID NO.36) hyg-R:GCTGCAGCTTTAAATAATCGGTGTCATTATTCCTTTGCCCTCGGACGAG(SEQ ID NO.37)tRNA1-F:ATGACTGGGCCCAGTTGCTGGTGGGTCATGCATCGATTTGGGCGC(SEQ ID NO.38)tRNA1-R:GAGGGTATTCTGGGCCTCCATGTCGGTGTGTGGGGGATCCATTTCTAC(SEQ ID NO.39)NAM7L-F:CCAATGGCCTGTTGTTCATTGGC(SEQ ID NO.40)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0085] <h2 style=";text-align:left;direction:ltr"> NAM7L-R:GCGCCCAAATCGATGCATGACCCACCAGCAACTGGGCCCAGTC(SEQ ID NO.41)NAM7R-F:TAAACTCGACGGATTAGAAGCCCGAAAGCGTATAAAGGTGTCCCTCCC(SEQ ID NO.42)NAM7R-R:CCACTATCACAGAGAACGAACGCC(SEQ ID NO.43)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0086] The fragments amplified above were mixed in an equimolar ratio, and 10 μL was transformed into fresh Saccharomyces cerevisiae BY4741-ΔPA competent cells by electroporation. Spread on a YPD plate (YPD-hyg) containing 7 / 1000 hygromycin and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on a YPD-hyg plate for preservation. Randomly pick recombinant bacteria from the preserved YPD-hyg streaked plate, pick 3 parallel control groups each, inoculate them into a test tube containing 5 mL of YPD-hyg liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use primers NAM7L-F and tRNA2-R to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplified the target band were preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown in the figure. Figure 1 As shown, the colony PCR verification results are as follows Figure 2 As shown. PPQ1, ALO1 and NAM7 were knocked out, and three copies of tRNA1 were introduced at the same time. CUA Tyr tRNA2 CUA Tyr The positive strain for the gene and OmeRS was named BY4741-ΔPAN.

[0087] The tandem expression cassette P was amplified from the BY4741-ΔPAN genome using primers tRNA2-OmeRS-3F and tRNA2-OmeRS-3R. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1Gene fragment, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, BY4741-ΔPAN genome template 1μL, primers tRNA2-OmeRS-3F and tRNA2-OmeRS-3R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water added to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (30 cycles); 72℃ extension for 10 minutes. Primers ura3-F and ura3-R were used to amplify the uracil auxotrophic marker gene Ura3 sequence from the Saccharomyces cerevisiae genome. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers ura3-F and ura3-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The left arm sequence of the GAL80 locus gene was amplified from the Saccharomyces cerevisiae genome using primers GAL80L-F and GAL80L-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers GAL80L-F and GAL80L-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The right arm sequence of the GaL80 locus gene was amplified from the Saccharomyces cerevisiae genome using primers GAL80R-F and GAL80R-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, template Saccharomyces cerevisiae genome 1 μL, primers GAL80R-F and GAL80R-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water supplemented to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. The tandem expression cassette P was recovered by Tiangen agarose gel DNA recovery kit SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD -OmeRS-T GPM1Gene fragment, uracil auxotrophic screening marker Ura3 gene sequence and NAM7 site left and right arm sequences, primer sequences are as follows:

[0088] tRNA2-OmeRS-3F:CGTCCGAGGGCAAAGGAATAATGACACCGATTATTTAAAGCTGCAGCATACG

[0089] (SEQ ID NO.44)

[0090] tRNA2-OmeRS-3R:GGGAGGGACACCTTTATACGCTTTCGGGCTTCTAATCCGTCGAGTTTATCATTATCAATACTG (SEQ ID NO.45)

[0091] ura3-F: GCTAATCCGGTCACTGCCGTACTGAGAGTGCAGCTTCAATTCATC (SEQ ID NO. 46) ura3-R: GGCTGCAGGAATTCGATATCAAGCGGTATTTCACACCGCATAGGGTAATAACTG (SEQ ID NO. 47)

[0092] GAL80L-F: CTCACTCTGCACTGCCGTGC (SEQ ID NO.48)

[0093] GAL80L-R: GATGAATTGAAGCTGCACTCTCAGTACGGCAGTGACCGGATTAGCATTGG (SEQ IDNO.49)

[0094] GAL80R-F: GGAGTACAGTCACTTTGAGAACCCCTTTTTCGTGCATGCGGGTG (SEQ ID NO. 50) GAL80R-R: CATCTTGAAATGCTGCAATTATGTCGGG (SEQ ID NO. 51)

[0095] The fragments amplified above were mixed in an equimolar ratio, and 10 μL was transformed into fresh Saccharomyces cerevisiae BY4741-ΔPAN competent cells by electroporation. Spread on uracil-deficient SD solid culture medium (SD-ura) and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on the SD-ura plate for preservation. Randomly pick recombinant bacteria from the preserved SD-ura streaked plate, pick 3 parallel control groups each, inoculate them into a test tube containing 5 mL of SD-ura liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use primers GAL80L-F and tRNA2-R to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplified the target band were preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown below. Figure 1 As shown, the colony PCR verification results are as follows Figure 2 As shown. PPQ1, ALO1, NAM7 and GAL80 were knocked out, and three copies of tRNA1 were introduced at the same time. CUA Tyr 、Four tRNA2 CUA Tyr The positive strain for the gene and OmeRS was named BY4741-ΔPANG.

[0096] Example 2 Construction of a strain containing a fluorescent protein reporter gene and verification of the introduction of pAzF

[0097] 2.1 Construction of plasmids and strains containing fluorescent protein reporter genes

[0098] The selected plasmid was pRS41K, which contained the G418 selection marker kMX gene, the prokaryotic replicons ColE1 and f1, the self-replication sequence CEN / ARS in Saccharomyces cerevisiae, and the ampicillin selection marker AmpR gene. The linearized plasmid was amplified using primers pRS41K-F and pRS41K-R. The amplification system was: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, pRS41K plasmid template 1μL, primers pRS41K-F and pRS41K-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, and double distilled water supplemented to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 3 minutes (35 cycles); 72℃ extension for 10 minutes.

[0099] The tandem expression cassette P was amplified from the BY4741-ΔPANG genome using primers tRNA2-OmeRS-4F and tRNA2-OmeRS-4R. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD-OmeRS-T GPM1 Gene fragment, amplification system: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, BY4741-ΔPANG genome template 1μL, primers tRNA2-OmeRS-4F and tRNA2-OmeRS-4R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water supplemented to 50μL. Amplification conditions are 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (35 cycles); 72℃ extension for 10 minutes. Primers pGal1-F and pGal1-R, tENO2-F and tENO2-R were used to amplify the pGal1 promoter and tENO2 terminator from the BY4741-ΔPANG genome, respectively. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, BY4741-ΔPANG genome template 1 μL, primers pGal1-F and pGal1-R or tENO2-F and tENO2-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 2 minutes (35 cycles); 72°C extension for 10 minutes. EGFP was amplified using primers EGFP-F and EGFP-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, EGFP gene fragment template 1 μL, primers EGFP-F and EGFP-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (35 cycles); 72°C extension for 10 minutes. mRFP was amplified using primers mRFP-F and mRFP-R. The amplification system was: PhantaBuffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, mRFP gene fragment template 1 μL, primers mRFP-F and mRFP-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (35 cycles); 72°C extension for 10 minutes. The linearized pRS41K plasmid fragment and the tandem expression cassette P were recovered by Tiangen agarose gel DNA recovery kit. SNR52 -tRNA2 CUA Tyr -T SUP4 -P GPD-OmeRS-T GPM1 gene fragment, pGal1 promoter gene fragment, EGFP gene fragment, mRFP gene fragment and tENO2 terminator gene fragment, the primer sequences are as follows: pRS41K-F: GAGAACGAGCTCCAGCTTTTGTTCCCTTTAGTG (SEQ ID NO.52)

[0100] pRS41K-R: CCCGGGCTGCAGGAATTCG (SEQ ID NO.53)

[0101] tRNA2-OmeRS-4F: CGAATTCCTGCAGCCCGGGTCTTTGAAAAGATAATGTATGATTATGCTTTCACTC (SEQ ID NO.54)

[0102] tRNA2-OmeRS-4R: GCTCGGCGGCTTCTAATCCGTCGAGTTTATCATTATCAATACTGCCATTTCAAAGAATACG (SEQ ID NO.55)

[0103] pGal1-F: CGGATTAGAAGCCGCCGAGC (SEQ ID NO.56)

[0104] pGal1-R: CCTCGCCCTTGCTCACCATGTTTTTTCTCCTGACGTTAAAGTATAGAGG (SEQ ID NO. 57) tENO2-F: CACTCCACCGGTGCTTGAAGTGCTTTTAACTAAGAATTATTAGTCTTTTCTGC (SEQ ID NO. 58)

[0105] tENO2-R: GGAACAAAAGCTGGAGCTCGTTCTCAAAGTGACTGTACTCCATG (SEQ ID NO. 59) EGFP-F: ATGGTGAGCAAGGGCGAGG (SEQ ID NO. 60)

[0106] EGFP-R: CCGCTGCCGCTCTTGTACAGCTCGTCCATGCCGAG (SEQ ID NO. 61)

[0107] mRFP-F: GCTGTACAAGAGCGGCAGCGGTAGCGGCAGCGGTAGCTAAATGGCTTCCTCCGAAGACG (SEQ ID NO. 62)

[0108] mRFP-R: CGTCACTCCACCGGTGCTTGAAGTGCTTTTAACTAAG (SEQ ID NO.63)

[0109] Gibson assembly system: calculate the volume of vector and fragment to be added so that the concentration ratio of fragment and vector is 2:1, take out Gibson Mix from -20℃, 6.5μL per tube, add 2.5μL DNA fragment and 1μL Taq DNA ligase; put the EP tube in the PCR instrument, 50℃, 1 hour, the Gibson assembly products were transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0110] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers tRNA2-OmeRS-4F and EGFP-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 3 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmid was named pRS41K-EGFP-TAG-mRFP.

[0111] Take 10 μL of the above pRS41K-EGFP-TAG-mRFP and transform it into fresh Saccharomyces cerevisiae BY4741-ΔPANG competent cells by electroporation. Spread on a YPD-G418 plate containing 2 / 1000 G418 and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on a YPD-G418 plate for preservation. Randomly pick recombinant bacteria from the preserved YPD-G418 streaked plate, pick 3 parallel control groups each, inoculate them into a test tube containing 5 mL of YPD-G418 liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use the corresponding upstream and downstream primers to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplify the target band are preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown below. Figure 3 As shown, the colony PCR verification results are as follows Figure 4 The positive strain successfully constructed above was named ΔPANG-ERFP.

[0112] 2.2 Verification of pAzF introduction using fluorescent protein

[0113] Inoculate three single colonies from the plate into 5 mL of YPD-G418 medium. Grow the liquid culture to saturation and then dilute to OD 1 in 5 mL of the same medium. 600 = 1. The diluted culture was grown at 30°C overnight and then at OD 600 =1 in 5 mL of galactose medium (YPG-G418) containing 2 / 1000 G418, and pAzF was added at a final concentration of 5 mM (the mother solution was 1 M, dissolved in 2 M NaOH, ready for use). The wild-type control was induced without the addition of pAzF, and cultured at 30°C with shaking at 200 rpm for 2 days.

[0114] from Figure 7 It can be seen that most of the yeasts with added pAzF showed both green fluorescence and red fluorescence, while most of the yeasts without added pAzF showed only green fluorescence, proving that the yeast strain ΔPANG-ERFP can specifically introduce pAzF into the position of the TAG codon between the green fluorescent protein EGFP and the red fluorescent protein mRFP.

[0115] Example 3 Construction of yeast surface display strains

[0116] (1) The plasmid pRS41K-EGFP-TAG-mRFP was linearized using primers pRS-F and pRS-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-EGFP-TAG-mRFP plasmid template 1 μL, primers pRS-F and pRS-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water was added to 50 μL. The amplification conditions were pre-denaturation at 98°C for 3 minutes; denaturation at 98°C for 10 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 2.5 minutes (35 cycles); extension at 72°C for 10 minutes. Primers PGUS-F and Pir1-R were used to amplify the β-glucuronidase PGUS gene and the anchor protein Pir1 gene from the laboratory-stored plasmid pGAPZ-Pir-PGUS (the preparation method of the plasmid is detailed in Patent 201910023085.8). The amplification system was: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, pGAPZ-Pir-PGUS plasmid template 1μL, primers PGUS-F and Pir-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, and double distilled water was added to 50μL. The amplification conditions were pre-denaturation at 98℃ for 3 minutes; denaturation at 98℃ for 10 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 2 minutes (35 cycles); extension at 72℃ for 10 minutes. The linearized plasmid fragment and PGUS-Pir1 gene fragment were recovered by Tiangen agarose gel DNA recovery kit. The primer sequences are as follows:

[0117] pRS-F: GCGCCCATCATCATCATCACTGAAGTGCTTTTAACTAAGAATTATTAGTCTTTTCTGC

[0118] (SEQ ID NO.64)

[0119] pRS-R: CCGGCAGATAATAGGACAGTTGATAATTTCATGTTTTTTCTCCTGACGTTAAAGTATAGAGG (SEQ ID NO.65)

[0120] PGUS-F: CCTATTATCTGCCGGTTTAGCCTCGACTACTTTGGCCCAAATGCTCAAACCGCAGCAAACTAC (SEQ ID NO.66)

[0121] Pir1-R: CAGTGATGATGATGATGATGGGCGCTATTCAGATCCTCTTCTGAG (SEQ ID NO.67)

[0122] Gibson assembly system: calculate the volume of vector and fragment to be added so that the concentration ratio of fragment and vector is 2:1, take out Gibson Mix from -20℃, 6.5μL per tube, add 2.5μL DNA fragment and 1μL Taq DNA ligase; put the EP tube in the PCR instrument, 50℃, 1 hour, the Gibson assembly products were transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0123] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and Pir1-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 3 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmid was named pRS41K-PGUS-Pir1.

[0124] The PGUS sequence was amplified using primers S35C-F and D220TAG-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-PGUS-Pir1 plasmid template 1 μL, S35C-F and D220TAG-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. pRS41K-PGUS-Pir1 was linearized using primers D220TAG-F and S35C-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-PGUS-Pir1 plasmid template 1 μL, D220TAG-F and S35C-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 3 minutes (30 cycles); 72°C extension for 10 minutes. The linearized plasmid fragment and PGUS gene fragment were recovered by Tiangen agarose gel DNA recovery kit. The primer sequences are as follows:

[0125] S35C-F: CAACAATACGCAACCATGGACATGCCAACTAAAAACGTC (SEQ ID NO.68)

[0126] D220TAG-R:GCTACGGTTGTGCCCTACTCATCTATCACGGC(SEQ ID NO.69)

[0127] D220TAG-F: GTGATAGATGAGTAGGGCACAACCGTAGCGACAAGC (SEQ ID NO.70)

[0128] S35C-R: GGCATGTCCATGGTTGCGTATTGTTG (SEQ ID NO.71)

[0129] Gibson assembly system: calculate the volume of vector and fragment to be added so that the concentration ratio of fragment and vector is 2:1, take out Gibson Mix from -20℃, 6.5μL per tube, add 2.5μL DNA fragment and 1μL Taq DNA ligase; put the EP tube in the PCR instrument, 50℃, 1 hour, the Gibson assembly products were transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0130] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and Pir1-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 3 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmid was named pRS41K-S35C-D220TAG-Pir1.

[0131] The PGUS sequence was amplified using primers G153C-F and E488TAG-R. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-PGUS-Pir1 plasmid template 1 μL, G153C-F and E488TAG-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 1 minute (30 cycles); 72°C extension for 10 minutes. pRS41K-PGUS-Pir1 was linearized using primers E488TAG-F and G153C-R. The amplification system was: Phanta Buffer (2×) 25μL, dNTP (2.5mM) 1μL, pRS41K-PGUS-Pir1 plasmid template 1μL, D220TAG-F and S35C-R primers (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, and double distilled water was added to 50μL. The amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 3 minutes (30 cycles); 72℃ extension for 10 minutes. The linearized plasmid fragment and PGUS gene fragment were recovered by Tiangen agarose gel DNA recovery kit. The primer sequences are as follows:

[0132] G153C-F: CTCGAGGCGACGTGCAAGAAGGTGCAGACTTATCAGCATG (SEQ ID NO.72)

[0133] E488TAG-R: CGAAGTCCTATTCCAGCGCAGCTTCTGCCTCG (SEQ ID NO.73)

[0134] E488TAG-F: GCTGCGCTGGAATAGGAACTTCGCGGATGGACCGAG (SEQ ID NO.74)

[0135] G153C-R: CCTTCTTGCACGTCGCCTCGAGAATCTCC (SEQ ID NO.75)

[0136] Gibson assembly system: calculate the volume of vector and fragment to be added so that the concentration ratio of fragment and vector is 2:1, take out Gibson Mix from -20℃, 6.5μL per tube, add 2.5μL DNA fragment and 1μL Taq DNA ligase; put the EP tube in the PCR instrument, 50℃, 1 hour, the Gibson assembly products were transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0137] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and Pir1-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 3 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmid was named pRS41K-G153C-E488TAG-Pir1.

[0138] Primers W522A-F and W522A-R were used to mutate the PGUS sequence of the above pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 plasmids. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 plasmid template 1 μL, W522A-F and W522A-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water was added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, and 72°C extension for 2 minutes (30 cycles); 72°C extension for 10 minutes. The amplified product was digested with DpnI enzyme, and the digestion system was: 10×DpnI buffer 1μL, PCR amplification product 8μL, DpnI enzyme 1μL. The digestion conditions were incubated at 37°C for 1h. The digested product was transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37°C. The primer sequences are as follows:

[0139] W522A-F: GGTTACTCCCGCGAGCGAGGAGTTCCAGGTCGAG (SEQ ID NO.76)

[0140] W522A-R: GGGAGTAACCATGACCGAGTGC (SEQ ID NO.77)

[0141] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and Pir1-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 2 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmids were named pRS41K-S35C-D220TAG-W522A-Pir1 or pRS41K-G153C-E488TAG-W522A-Pir1, respectively.

[0142] Single point mutations were made to the PGUS sequence in plasmid pRS41K-PGUS-Pir1 using primers S35C-F and S35C-R, D220TAG-F and D220TAG-R, G153C-F and G153C-R, and E488TAG-F and E488TAG-R, respectively. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-PGUS-Pir1 plasmid template 1 μL, S35C-F and S35C-R, D220TAG-F and D220TAG-R, G153C-F and G153C-R or E488TAG-F and E488TAG-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 2 minutes (30 cycles); 72°C extension for 10 minutes. The amplified product was digested with DpnI enzyme, and the digestion system was: 10×DpnI buffer 1μL, PCR amplified product 8μL, DpnI enzyme 1μL. The digestion condition was incubated at 37℃ for 1h. The digestion product was transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0143] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and Pir1-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 2 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmids were successfully constructed. The plasmids were named pRS41K-S35C-Pir1, pRS41K-D220TAG-Pir1, pRS41K-G153C-Pir1 and pRS41K-E488TAG-Pir1.

[0144] Primers Flag-F and Flag-R were used to remove the Pir1 anchor protein of plasmid pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 and replace the Flag immune tag (the underline is the Flag tag sequence). The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, plasmid pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 template 1 μL, Flag-F and Flag-R primers (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water was added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, and 72°C extension for 3 minutes (35 cycles); 72°C extension for 10 minutes. The amplified product was digested with DpnI enzyme, and the digestion system was: 10×DpnI buffer 1μL, PCR amplification product 8μL, DpnI enzyme 1μL. The digestion conditions were incubated at 37°C for 1h. The digested product was transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 50mg / L bleomycin, and cultured at 37°C. The primer sequences are as follows:

[0145] Flag-F: CGGTAGC GATTACAAGGATGACGACGATAAG TGAAGTGCTTTTAACTAAGAATTATTAGTCTTTTCT GC(SEQ ID NO.78)

[0146] Flag-R: CGTCGTCATCCTTGTAATC GCTACCGCTGCCGCTCTGGAAGGTCTTCCCTCCCTCAGC(SEQID NO.79)

[0147] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-F and tENO2-R 1μL each, 2xrTaq mix (Takara Biotechnology Co., Ltd.) 10μL, and double distilled water to make up to 20μL. PCR conditions: pre-denaturation at 94℃ for 5 minutes, denaturation at 94℃ for 30 seconds, annealing at 60℃ for 30 seconds, extension at 72℃ for 2 minutes, 30 cycles, 72℃ for 10 minutes, and storage at 4℃. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmids were named pRS41K-S35C-D220TAG-Flag or pRS41K-G153C-E488TAG-Flag, respectively.

[0148] The expression cassettes pGal1-S35C-D220TAG-Flag-tENO2 and pGal1-G153C-E488TAG-Flag-tENO2 were amplified from plasmids pRS41K-S35C-D220TAG-Flag or pRS41K-G153C-E488TAG-Flag using primers PGUS-Flag-F and PGUS-Flag-R. taBuffer (2×) 25μL, dNTP (2.5mM) 1μL, pRS41K-S35C-D220TAG-Flag or pRS41K-G153C-E488TAG-Flag plasmid template 1μL, primers PGUS-Flag-F and PGUS-Flag-R (10μM) 2μL each, Phanta high-fidelity DNA polymerase 1μL, double distilled water added to 50μL. Amplification conditions were 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 2 minutes (35 cycles); 72℃ extension for 10 minutes. Plasmid pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 was linearized using primers pRS-Pir-Flag-F and pRS-Pir-Flag-R, respectively. The amplification system was: Phanta Buffer (2×) 25 μL, dNTP (2.5 mM) 1 μL, pRS41K-S35C-D220TAG-Pir1 or pRS41K-G153C-E488TAG-Pir1 plasmid template 1 μL, primers PGUS-Flag-F and PGUS-Flag-R (10 μM) 2 μL each, Phanta high-fidelity DNA polymerase 1 μL, and double distilled water added to 50 μL. The amplification conditions were 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 72°C extension for 5 minutes (35 cycles); 72°C extension for 10 minutes. The expression cassette pGal1-S35C-D220TAG-Flag-tENO2 and pGal1-G153C-E488TAG-Flag-tENO2 gene fragments and linearized pRS41K-S35C-D220TAG-Pir1 and pRS41K-G153C-E488TAG-Pir1 plasmid fragments were recovered by Tiangen Agarose Gel DNA Recovery Kit. The primer sequences are as follows:

[0149] PGUS-Flag-F:AGGAGCCGGAAGCGTTCTCAAAGTGACTGTACTCCATGTTTTCTTATCATCC(SEQID NO.80)

[0150] PGUS-Flag-R:CACCGGATTAGAAGCCGCCGAGC(SEQ ID NO.81)

[0151] pRS-Pir-Flag-F: CGGCGGCTTCTAATCCGGTGTAAAGCCTGGGGTGCC (SEQ ID NO. 82) pRS-Pir-Flag-R: GAGAACGCTTCCGGCTCCTATGTTGTGTG (SEQ ID NO. 83)

[0152] Gibson assembly system: calculate the volume of vector and fragment to be added so that the concentration ratio of fragment and vector is 2:1, take out Gibson Mix from -20℃, 6.5μL per tube, add 2.5μL DNA fragment and 1μL Taq DNA ligase; put the EP tube in the PCR instrument, 50℃, 1 hour, the Gibson assembly products were transformed into E.coli Trans1-T1 competent cells, spread on solid LB medium (peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agarose 20g / L) containing 100mg / L ampicillin, and cultured at 37℃.

[0153] The transformants were identified by colony PCR and sequencing. Colony PCR system: template LB plate single colony, upstream and downstream primers PGUS-Flag-F and PGUS-Flag-R 1 μL each, 2xrTaq mix (Takara Biotech Co., Ltd.) 10 μL, and double distilled water to make up to 20 μL. PCR conditions: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 3 minutes, 30 cycles, 72°C for 10 minutes, and storage at 4°C. The transformants containing the target bands verified by colony PCR were sent for DNA sequencing to confirm that the plasmid was successfully constructed. The plasmids were named pRS41K-S35C-D220TAG-Pir1+Flag or pRS41K-G153C-E488TAG-Pir1+Flag, respectively.

[0154] Take 10 μL of the above pRS41K-S35C-D220TAG-Pir1, pRS41K-S35C-D220TAG-W522A-Pir1, pRS41K-S35C-D220TAG-Pir1+Flag, pRS41K-G153C-E488TAG-Pir1, pRS41K-G153C-E488TAG-W522A-Pir1 and pRS41K-G153C-E488TAG-Pir1+Flag and transform them into fresh Saccharomyces cerevisiae BY4741-ΔPANG competent cells by electroporation. Spread on YPD-G418 plates containing 2 / 1000 G418 and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on a YPD-G418 plate for storage. Randomly pick recombinant bacteria from the preserved YPD-G418 streaked plates, pick 3 parallel control groups for each, inoculate into a test tube containing 5mL YPD-G418 liquid medium and culture for about 24h. Take 2mL of bacterial liquid to extract the yeast genome, and then use the corresponding upstream and downstream primers to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplify the target band are preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown in Figure 5 As shown, the colony PCR verification results are as follows Figure 6 The above successfully constructed positive strains were named LA, LA-W522A, LC, SA, SA-W522A and SC.

[0155] Take 10 μL of plasmids pRS41K-PGUS-Pir1, pRS41K-S35C-Pir1, pRS41K-D220TAG-Pir1, pRS41K-G153C-Pir1 and pRS41K-E488TAG-Pir1 and transform them into fresh Saccharomyces cerevisiae BY4741-ΔPANG competent cells by electroporation. Spread on YPD-G418 plates containing 2 / 1000 G418 and culture until a single yeast colony is clearly visible. Pick a single colony and streak it on a YPD-G418 plate for preservation. Randomly pick recombinant bacteria from the preserved YPD-G418 streaked plates, pick 3 parallel control groups each, and inoculate them into a test tube containing 5 mL of YPD-G418 liquid culture medium and culture for about 24 hours. Take 2 mL of bacterial solution to extract the yeast genome, and then use the corresponding upstream and downstream primers to perform PCR to verify the amplification of the target band. The recombinant bacteria that amplified the target band were preliminarily determined to be positive bacteria. The schematic diagram of strain construction is shown in Figure 5 As shown, the colony PCR verification results are as follows Figure 6 The above successfully constructed positive strains were named PGUS-Pir1, S35C-Pir1, D220pAzF-Pir1, G153C-Pir1 and E488pAzF-Pir1.

[0156] from Figure 8 It can be seen that according to the crystal structure of PGUS, a large (interface area of ) and small (interface area is ) subunit interface. The S35 site in the A chain, which is close to the large subunit interface and does not participate in the interface interaction, and the D220 site in the B chain were selected to be mutated to cysteine ​​and the termination codon TAG, respectively. The distance between the two sites is approximately Compared with Cy3 and Cy5 distance The distance between adjacent FRET pairs (respectively and ) than Cy3 and Cy5 distance Similarly, surface residues G153 in chain A and E488 in chain C are located near the small interface, away from the active center, and were selected to be mutated to cysteine ​​and amber codons, respectively, for incorporation into pAzF ( Figure 8 (b) The distance between the two sites is approximately Also shorter than Cy3 and Cy5 distance Therefore, a FRET signal will be generated. The distances of different FRET pairs (respectively and ) is greater than or close to that of Cy3 and Cy5 distance The FRET signals from different FRET pairs can be ignored. (2) Characterization of the activity and display amount of PGUS containing pAzF displayed on the surface

[0157] Inoculate three single colonies from the plate into 5 mL of YPD-G418 medium. Grow the liquid culture to saturation and then dilute to OD 1 in 5 mL of the same medium. 600 = 1. The diluted culture was grown at 30°C overnight and then at OD 600 = 1 in 5 mL of galactose medium (YPG-G418) containing 2 / 1000 G418, and pAzF (the stock solution is 1 M, dissolved in 2 M NaOH, ready to use) was added to a final concentration of 5 mM. The wild-type control was induced without adding pAzF and cultured at 30°C with shaking at 200 rpm for 2 days. PGUS glycyrrhizic acid hydrolysis activity: 100 μL of washed yeast cell suspension (OD 600=20) was added to 300 μL of ammonium glycyrrhizinate solution. After incubation at 40°C for 10 minutes, 900 μL of methanol was added to terminate the reaction, and then all impurities were removed using a filter, and the substrate and product were analyzed by HPLC. The amount of PGUS displayed on the yeast surface was measured using a commercial His tag ELISA kit (GenScript) according to the instructions.

[0158] As can be seen from Table 1, the recombinant Saccharomyces cerevisiae cells containing the stop codon mutation have glycyrrhizic acid hydrolysis activity, and the His-tag label on the cell surface can be detected by ELISA, indicating that pAzF can be introduced into the position of the TAG codon of the PGUS sequence, so that the PGUS-Pir1 sequence is fully expressed and secreted outside the cell for surface display. In addition, the introduction of pAzF has no effect on the specific enzyme activity of LA and SA, indicating that the introduction of pAzF will not affect the oligomeric structure of surface-displayed PGUS.

[0159] 3. Chemical labeling of yeast surface

[0160] The induced cells were pelleted, washed three times with PBS (pH 7.2), and resuspended in 199 μL ice-cold PBS (pH 7.2). 1 μL 20 mM Cy3-maleimide (dissolved in DMSO) was then added to the sample and vortexed briefly. The thiol-maleimide reaction was allowed to react at 4°C for 4 hours, and then the sample was diluted in PBS (pH 7.2), precipitated by centrifugation, and then washed three times with ice-cold PBS (pH 7.2). The cells were then resuspended in 199 μL PBS (pH 7.2), 1 μL 20 mM DBCO-Cy5 (dissolved in DMSO) was added, and the cells were incubated at 4°C for 2.5 hours, after which the sample was diluted in PBS (pH 7.2), precipitated by centrifugation, and then washed three times with ice-cold PBS (pH 7.2). From Figure 8 As can be seen in Figure C, the purified proteins were labeled with Cy5-DBCO and Cy3-maleimide, respectively, and the SDS-PAGE gel had a single fluorescent band corresponding to PGUS, further proving the successful incorporation of pAzF and the correct modification of the fluorophore.

[0161] 4. Confocal Microscopy

[0162] Cell fluorescence was detected using a Leica STELLARIS 8 system with a 63× objective. Taking into account direct excitation of the acceptor and leakage of donor fluorescence into the acceptor channel, the Cy3 and FRET channels used 516 nm excitation at detection wavelengths of 550-590 nm and 650-730 nm, respectively. The excitation and detection wavelengths of the Cy5 channel were 640 nm and 650-730 nm, respectively. In order to obtain clear signals and avoid overexposure, the laser "smart gain" values ​​for the Cy3 channel, Cy5 channel, and FRET channel were set to 15%, 15%, and 20%, respectively. For all fluorescence channels, the laser used was 15% and the pinhole was 1 AU. The FRET ratio (F FRET / F 供体 ) were quantified using ImageJ and Leica Las X software.

[0163] Fig. 9 It can be seen that strains LA and LA-W522A show clear and bright FRET signals, indicating that when PGUS or dimer W522A (W522A is the mutation of the W522 site at the PGUS small subunit interface to alanine to turn the PGUS tetramer into a dimer, Tetramerization of GH2β-Glucuronidases is Essential for Catalyzing theHydrolysis ofthe Large Substrate Glycyrrhizin) is displayed on the yeast surface, the large subunit interface of PGUS is stably present. Strain SA shows FRET signals from the small subunit interface, while the negative control SA-W522A does not show any FRET signals because the small subunit interface does not exist in the dimer mutant W522A. These results demonstrate the feasibility of the FRET strategy to detect the PGUS subunit interface displayed on the surface.

[0164] In order to compare the structural differences between the yeast surface display PGUS anchor expression system and the co-expression system, yeast surface display strains (named LC and SC, respectively) co-expressing S35C-D220pAzF and G153C-E488pAzF anchored subunits and free subunits were constructed. These two strains show FRET signals at the large subunit interface and the small subunit interface, respectively. Since the difference in the number of donor fluorophores between different strains is eliminated, the FRET ratio can represent the proportion of protein subunits that form a large or small interface. Fig. 9It can be seen that the FRET ratio of the co-expression strain LC is 0.764, which is unchanged compared with LA (FRET ratio 0.763) and LA-W522A (FRET ratio 0.788). This proves that the large subunit interface can be stably present in all yeast surface display PGUS systems. The FRET ratio of SA is much lower (0.337). Compared with it, the FRET ratio of the co-expression strain SC increased by 94.4% (FRET ratio of 0.655). The increase in the FRET ratio of SC indicates an increase in the small subunit interface and indicates that the co-expression of anchored and free subunits is beneficial to maintain the small subunit interface.

[0165] from Fig.10 It can be seen that at high temperature (above 40 °C) and urea concentration (above 4 M), the FRET ratio of the small interface in SA is significantly reduced, indicating the instability of the PGUS small subunit interface.

[0166] from Fig.11 It can be seen that all four single-point mutant strains S35C-Pir1, D220pAzF-Pir1, G153C-Pir1, E488pAzF-Pir1 and the control strain BY4741-ΔPANG showed obvious donor and acceptor signals, but almost no FRET signal was observed, proving that the FRET signal detected above originated from the subunit interface of PGUS displayed on the yeast surface, rather than generated by the surface-displayed PGUS between other surface proteins.

[0167] Table 1 Characterization of the activity and display amount of PGUS containing pAzF displayed on the surface of Saccharomyces cerevisiae

[0168]

[0169] In the present invention, the terms "one embodiment", "some embodiments", "examples", etc. mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example.

[0170] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A method for in situ detection of the quaternary structure of oligomeric enzymes displayed on the surface of yeast based on FRET, characterized in that: include: (1) Using Saccharomyces cerevisiae as the base strain, the genes PPQ1, ALO1, NAM7 and GAL80 were knocked out, and multiple copies of tyrosyl-tRNA synthase (OmeRS) and its corresponding two tRNAs were introduced simultaneously. CUA Tyr ; (2) Two sites at the oligomerase interface were selected to be mutated into cysteine ​​and TAG codons, respectively, and the oligomerase was displayed on the surface of Saccharomyces cerevisiae using anchor protein; protein expression was induced by adding galactose and p-azido-phenylalanine (pAzF) for fermentation; (3) Adding the donor fluorescent molecule Cy3-maleimide to couple with the cysteine ​​of the oligomerase displayed on the yeast surface, and adding the acceptor fluorescent molecule Cy5-DBCO to couple with the azide group of the oligomerase displayed on the yeast surface; (4) Characterize donor, acceptor, and FRET signals using confocal microscopy; The gene sequence of tyrosyl-tRNA synthase is shown in SEQ ID NO.1, tRNA CUA Tyr The sequences are shown in SEQ ID NO.2 and SEQ ID NO.3; The two sites at the oligomerase interface that mutated into cysteine ​​and TAG codons, respectively, are located in the inactive center, and the distance between the two sites is smaller than the Förster distance of Cy3 and Cy5.

2. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 1, characterized in that: The brewer's yeast is brewer's yeast BY4741.

3. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 1, characterized in that: The promoter for expressing OmeRS is the GPD promoter, the terminator is the GPM1 terminator, and the gene sequence for expression is the tRNA shown in SEQ ID NO.2 CUA Tyr The promoter is SUP4 promoter, the terminator is SUP4 terminator, and the expressed gene sequence is tRNA shown in SEQ ID NO.3 CUA Tyr The promoter is the SNR52 promoter, and the terminator is the SUP4 terminator, wherein the gene sequence of the GPD promoter is shown in SEQ ID NO.4, the gene sequence of the GPM1 terminator is shown in SEQ ID NO.5, the sequence of the SNR52 promoter is shown in SEQ ID NO.6, the sequence of the SUP4 promoter is shown in SEQ ID NO.15, and the sequence of the SUP4 terminator is shown in SEQ ID NO.

7.

4. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 1, characterized in that: In the step (2), the induction of protein expression is carried out in a YPG-G418 medium to which pAzF is added at a final concentration of 0.5-10 mM.

5. The method for in situ detection of the quaternary structure of oligomeric enzymes displayed on the surface of yeast based on FRET according to claim 1, characterized in that: The excitation wavelength of the donor fluorescent molecule is 500-554nm, and the detection wavelength is 546-630nm; the excitation wavelength of the acceptor fluorescent molecule is 582-648nm, and the detection wavelength is 650-740nm. The excitation wavelength of the FRET channel is 500-535nm, and the detection wavelength is 649-740nm.

6. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 5, characterized in that: The excitation wavelength of the Cy3 channel is 516 nm, the detection wavelength is 550-590 nm, the excitation wavelength of the FRET channel is 516 nm, the detection wavelength is 650-730 nm, the excitation wavelength of the Cy5 channel is 640 nm, the detection wavelength is 650-730 nm; the laser "intelligent gain" values ​​of the Cy3 channel, Cy5 channel and FRET channel are set to 15%, 15% and 20% respectively.

7. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 1, characterized in that: When there are obvious donor signals, acceptor signals, and FRET signals, it is determined that a subunit interface exists. When there are obvious donor signals and acceptor signals but no FRET signal is shown, it is determined that the subunits of the oligomerase are dissociated.

8. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 1 or 7, characterized in that: The method further comprises the step of calculating the FRET ratio, FRET ratio=F FRET / F 供体 , where F FRET is the fluorescence signal of Cy5 at its detection wavelength, F 供体 is the fluorescence signal of Cy3 at its detection wavelength.

9. The method for in situ detection of the quaternary structure of oligomerase displayed on the surface of yeast based on FRET according to claim 8, characterized in that: The method further includes determining the influence of external conditions on the subunit interface stability of the yeast surface displayed oligomerase based on the change of FRET ratio; Alternatively, the method further comprises determining the effects of different expression systems of yeast surface-displayed oligomerase on the stability of the subunit interface based on the change in FRET ratio.

10. The method for in situ detection of the quaternary structure of oligomeric enzyme displayed on the surface of yeast based on FRET according to claim 1, characterized in that: The anchoring protein is selected from one of Pir1 anchoring protein, Sed1 anchoring protein or Agα anchoring protein; The gene sequence of the Pir1 anchor protein is shown in SEQ ID NO.8; the gene sequence of the Sed1 anchor protein is shown in SEQ ID NO.9, and the gene sequence of the Agα anchor protein is shown in SEQ ID NO.10; The oligomerase is β-glucuronidase (PGUS), and the accession number of the gene sequence of β-glucuronidase in GeneBank is EU095019; The promoter used in step (2) for the surface display of oligomerase mediated by anchor protein in Saccharomyces cerevisiae is the GAL1 promoter, the signal peptide is the SED1 signal peptide, and the terminator is the ENO2 terminator; wherein the gene sequence of the GAL1 promoter is shown in SEQ ID NO.11, the gene sequence of the SED1 signal peptide is shown in SEQ ID NO.12, and the sequence of the ENO2 terminator is shown in SEQ ID NO.13.

Images