Method for identifying brassica rapa and diplotaxis intergeneric hybrid based on InDel and primer pair
By using InDel primer pairs and gel electrophoresis, the problems of accuracy and simplicity in identifying allotetraploid hybrids between Chinese cabbage and Arugula genera were solved, and reliable identification of allotetraploid hybrids between Chinese cabbage and Arugula genera was achieved.
Patent Information
- Application Number
- CN202410950004.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2044-07-16
AI Technical Summary
Existing technologies for identifying allotetraploid hybrids between Chinese cabbage and Arugula are hampered by morphological factors, which are easily affected by environmental and human factors and are not reliable enough. Molecular marker designs are complex and few, making accurate identification difficult.
Amplification was performed using InDel primer pairs. The forward primer 5'-3': GCTGACAGAATCAAAAGCAGCT and the reverse primer 5'-3': GCACAAGGACACTGTCCAGC were used in conjunction with gel electrophoresis to observe the electrophoretic bands and confirm the authenticity of the allotetraploid.
It enables accurate identification of allotetraploid hybrids between Chinese cabbage and Arugula genus, with simple operation and reliable results, overcoming the shortcomings of traditional morphological identification and the difficulty of designing InDel molecular markers.
Smart Images

Figure CN118879836B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the identification of distantly related new germplasm, in particular to the development of a kit for identifying alien tetraploids of Brassica rapa and Sonchus intergeneric hybrid based on InDel technology. BACKGROUND
[0002] With the continuous growth of population and rapid economic development, the demand for agricultural production is also increasingly diversified. These demands include, for example, better taste, higher yield, better disease resistance, pest resistance, stress tolerance, etc. In order to meet the growing demand, breeding hybrid new germplasm has become a crucial technology in the field of agriculture. How to accurately identify the authenticity of hybrid offspring is another important problem faced after creation.
[0003] Brassica rapa and Sonchus are common crops with important economic value. For the identification of Brassica rapa and Sonchus distant hybrid, morphological and cytological identification is usually used. Morphological identification has the advantages of simple operation, but is easily affected by environmental and human factors, and the identification results are not reliable. Although molecular markers are also used for identification, they are difficult to design and sometimes require two or more pairs of primers for identification, which is relatively complex.
[0004] InDel refers to the addition or deletion of one or more nucleotides at a certain site in a sequence compared to the homologous sequence. Currently, there are few reports on the application of InDel molecular markers in the identification of authenticity of distant hybrid offspring, especially in the identification of distant hybrid offspring of cruciferous vegetables. In the field of fruit trees, Han Jian et al. (Creation of Citrus grandis x Citrus aurantium hybrid population and identification by InDel markers, Journal of Fruit Tree Research, 2023, 40(02):223-229) used Citrus grandis as the female parent and Citrus aurantium as the male parent for intergeneric hybridization. InDel markers were used to identify hybrid seedlings, but among the multiple pairs of InDel primers designed, some could not distinguish between Citrus aurantium and Citrus grandis, and some could not amplify Citrus grandis-specific bands. Only one pair of InDel primers could identify the hybrid offspring population.
[0005] Therefore, in the field of distant hybrid new germplasm, there is a strong need to provide a convenient and accurate identification method for new germplasm. SUMMARY
[0006] Therefore, in the first aspect, the present application provides a method for identifying alien tetraploids of Brassica rapa and Sonchus intergeneric hybrid based on InDel technology, comprising:
[0007] Obtaining the sample to be identified, which is obtained by intergeneric hybridization of Brassica rapa '72049' as the female parent and Sonchus 'ASTRO' as the male parent, followed by embryo rescue and chromosome doubling;
[0008] The genomic DNA of the material is used as a template to amplify using the following InDel primer pair:
[0009] Forward primer 5'-3': GCTGACAGAATCAAAAGCAGCT,
[0010] Reverse primer 5'-3': GCACAAGGACACTGTCCAGC;
[0011] The amplified product is subjected to gel electrophoresis; and
[0012] The authenticity of the alien tetraploid is determined by observing the electrophoresis bands.
[0013] In some embodiments, the method of the present application further comprises amplifying the maternal and paternal parents using the InDel primer pair.
[0014] In some embodiments, observing the bands comprises confirming that the alien tetraploid is obtained when the bands of the maternal and paternal parents appear simultaneously in the sample.
[0015] In specific embodiments, the amplification conditions comprise: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 30 s, 30-40 cycles.
[0016] In specific embodiments, the amplification object of the InDel primer pair is located on the A05 chromosome of the Brassica rapa hybrid, specifically on the exon of the BraA05g042250.3.5C gene.
[0017] The details are as follows:
[0018] Chr Start End Ref Alt location Gene A05 27756034 27756036 TTG - exonic BraA05g042250.3.5C
[0019] AAAGCAACAACATCTCCTCACGAGTGGCGAGCGCAATGTCCATGGAACGATGGTGTTCAAGGCAGTACATTATTTTCTTCTGTACCAGATTATTTAACTCACTCACTGCATTCAGATCACCTTCCGAGAAAGTTCCTAGAGCTGCCCTAGCTTGAGCACGGGCTGTTTCGGACCTTGGTGAATATTGTTTTCAAACAACTCGGACAAGATACCAGCTGCAACAAGTTGTTTCCTAGATCTTGGATGCTTCGACAGCATTTGAAGAATCTCGAGACATTGAGTGACAAATGTAGTGGCACAACCGTAACAATTGTTTGGGGTCTTTGAAACCACACATCTTGAAGCACCAGATGAAAAGTTCGAATTTTTCTGATGGAGGTAATTCATCAGAACTCTGCGAAGTCCCTGCAGTGTTTGTACACTTTT GCTGACAGAATCAAAAGCAGC T TTGCACTTCTCACCATACAGTACACCCAAAAGTGCGACTTTGCGGTTTATCTTGTTGCATGAGGGACCAGGCAAAGATGCCATCATTT GCTGGACAGTGTCCTTGTGCTGTGAATCCATTTCAGTTTCACCAATGCTTGATACAATCTTCAGAAGCGGCTTCTTGAAGCCTAAGAGTTGCTGATATCTCCTGTGAGCGTTTTCAGACTCGGACTCTATAGCAGCCAATCCCCTCTTCATATCTTCGTCATTTTCCATATTATCAAATATGAAGCTCGGTTTTGCCATGAAGTTGAACTCAAACCTCCCATACTTGCTATAACCACACTCGTTGCACAGGAAAGAATCCAAATTTTCGTAGTTGATGTTGCGGCATTGCCTGCACTGATAAGCATTCTCATGACAGTTGCTGCAGATACCATGCTTATCAGTAACCGGTCGACTGCATCGAGGGCATTGCAATGGTTCAAGAGATAACGCCTGAAGATTCTCATAGAAGGAATCCAACTCGATCATGAAGTTACAAGCCGTAATGGGAATGGGAAACTCCACCTT (SEQ ID NO: 11)
[0020] In a preferred embodiment, the step of obtaining comprises: using Brassica rapa '72049' as the female parent, Sonchus arvensis inbred 'ASTRO' as the male parent, cross pollination at the bud stage, taking the ovary 7 days after pollination, embryo rescue under aseptic conditions, and doubling treatment. Illustratively, at the bud stage, a 62.3 mg / L MgCl2.6H2O solution is sprayed on the column head, and after 15-20 minutes, cross pollination is performed using a smearing method.
[0021] In a second aspect, the present application provides a heterologous tetraploid InDel primer pair for identifying the intergeneric hybrid of the female parent Brassica rapa '72049' and the male parent Sonchus arvensis 'ASTRO', which consists of the forward primer 5'-3': GCTGACAGAATCAAAAGCAGCT, and the reverse primer 5'-3': GCACAAGGACACTGTCCAGC.
[0022] In a third aspect, the present application provides a kit for identifying the intergeneric hybrid of the female parent Brassica rapa '72049' and the male parent Sonchus arvensis 'ASTRO', which comprises the InDel primer pair defined in the second aspect.
[0023] In some embodiments, the kit of the present application further comprises the genomic DNA of Brassica rapa '72049' and the genomic DNA of Sonchus arvensis 'ASTRO'.
[0024] In a fourth aspect, the present application provides use of the InDel primer pair defined in the second aspect for identifying the alien tetraploid of the intergeneric cross between the maternal Brassica rapa ‘72049’ and the paternal Eruca sativa ‘ASTRO’.
[0025] In a fifth aspect, the present application provides use of the kit defined in the third aspect for identifying the alien tetraploid of the intergeneric cross between the maternal Brassica rapa ‘72049’ and the paternal Eruca sativa ‘ASTRO’.
[0026] After obtaining the ‘Brassica rapa 72049 x Eruca sativa ASTRO’ intermediate material, how to accurately and conveniently identify the hybrid is another problem faced by the inventors. The inventors have overcome the defects that the traditional morphological identification is easily affected by the environment and human factors and the identification result is not reliable. At the same time, the inventors have overcome the current situation that there are few studies on the identification of distant hybridization by InDel molecular markers and the design is difficult, and successfully screened a primer pair for identification. The primer pair is used for identifying the alien tetraploid of Brassica rapa 72049 x Eruca sativa ASTRO, which is simple to operate and the result is accurate. BRIEF DESCRIPTION OF DRAWINGS
[0027] Figure 1 The morphologies of the parent and the doubling material plants, a is Brassica rapa; b is Eruca sativa; c1-c7 are Progeny 1 to Progeny-7; the scale is 10 cm.
[0028] Figure 2 The root tip chromosome numbers of the doubling material; d1-d7 are Progeny 1 to Progeny-7.
[0029] Figure 3 The results of gel electrophoresis after amplification of 5 pairs of primers for the maternal, paternal and alien tetraploid.
[0030] Figure 4 The results of gel electrophoresis after amplification of the maternal, paternal and alien tetraploid 7 progeny groups using the BraA05g042250.3.5C_indel primer pair. DETAILED DESCRIPTION
[0031] MATERIALS
[0032] The maternal was Brassica rapa ‘72049’ (Brassica rapa; 2n = 20; AA), the paternal was Eruca sativa (EE, 2n = 22), the ‘72049 x Eruca sativa’ distant hybrid (AE) and the alien tetraploid (AAEE) after chromosome doubling.
[0033] These materials were provided by the Leafy Vegetable Research Group of the Institute of Vegetables, Henan Academy of Agricultural Sciences, and were planted and managed regularly at the Henan Modern Agriculture Research and Development Base.
[0034] Equipment and reagents
[0035] The main experimental instruments include: CyFlow Cube 8 flow cytometer, microscope, fluorescence microscope, centrifuge, autoclave, etc.
[0036] Main experimental tools: centrifuge tubes, tweezers, dissecting needles, coverslips, glass slides, pipettes, absorbent paper, scissors, blades, etc.
[0037] Main experimental reagents: Carnoy's fixative, distilled water, glacial acetic acid, anhydrous ethanol, 8-hydroxyquinoline, carbofuran stain, DAPI stain, 2% enzyme digestion solution, propidium iodide (PI), B5 medium, MS medium, etc.
[0038] Preparation of enzymatic hydrolysate: Weigh 200-400 mg of cellulase and 100-200 mg of pectinase (cellulase:pectinase = 2:1), dissolve in 0.01 mol citrate buffer, and store at -20°C. The 0.01 mol citrate buffer is prepared by weighing 0.30 g of trisodium citrate and 0.21 g of citric acid, and adding sterile water (double-dissolved led H2O, dd H2O) to a final volume of 100 mL.
[0039] Example 1: Distant hybridization and embryo rescue
[0040] A hybrid cross was constructed using Chinese cabbage '72049' (provided by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the female parent and arugula inbred line 'ASTRO' (collected and preserved by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the male parent. The cross was constructed using bagging at the bud stage and artificial pollination. Two to three days before hybridization, the opened flowers on the male parent inflorescence were removed, and the plant was isolated by bagging. On the day the bagged male parent opened, the anthers were collected and used to pollinate the appropriately sized buds on the female parent plant. During the bud stage, the stigmas of the Chinese cabbage were sprayed with a 62.3 mg / L MgCl2·6H2O solution. After the solution dried (approximately 15 to 20 minutes), pollination and hybridization were performed by smearing the stigmas on the stigmas, as well as in the untreated group. After pollination, the plants were isolated by bagging to strictly control contamination by pollen from sources other than the male parent. Seven days after pollination, the ovaries were harvested, and embryo rescue was performed under aseptic conditions.
[0041] The test material is placed in a 4°C refrigerator to keep fresh and reduce water evaporation; solid inoculation medium (MS+6-BA 1.0 mg / L+NAA 0.1 mg / L+hydrolyzed casein 0.5%+activated carbon 0.5%+agar 7.2 g / L+sucrose 20 g / L+activated carbon 0.5%), distilled water, culture dish with filter paper, inoculation culture dish 121°C, 25 min high-pressure sterilization standby, ultraclean workbench ultraviolet sterilization 20 min, gloves, mask, lab coat, 75% alcohol, 0.1% mercury, waste liquid tank, tweezers, surgical knife and blade, alcohol lamp, marker pen, sealing film.
[0042] The ovary is taken out with scissors and placed in the corresponding beaker, and the material name or corresponding code is marked. The selected test material is placed on the ultraclean workbench, first surface sterilized with 75% alcohol for 30 s, then sterilized with 0.1% mercury for 8 min, then rinsed with sterilized distilled water for 3-5 times, and the waste liquid is poured into the prepared waste liquid tank; after rinsing, the ovary is taken out with tweezers and placed in a sterile culture dish with filter paper, and the ovary is slowly cut along the midline with a surgical knife, with moderate force, and the embryo sac in the ovary is taken out with a blade and placed on a sterile solid inoculation medium, evenly arranged, with 30-50 grains per dish according to the size of the embryo sac. Finally, the culture dish is sealed tightly with sealing film, and the material name is marked on the culture dish cover after sealing, and the operation date is placed in the culture cabinet for dark normal temperature (25°C) culture. After about one week of culture, check for contaminated culture dishes, and remove contaminated culture dishes in time, and check every 5 days to prevent contamination of other normally growing culture dishes.
[0043] After about 20 days of culture, observe whether new embryos have grown, and place the culture dishes with growing embryos in a light culture rack for culture. When the embryos have grown and turned green, they can be transferred to a solid subculture medium (B5+6-BA 1.0 mg / L+NAA 0.1 mg / L+agar 7.2 g / L+sucrose 20 g / L+activated carbon 0.5%) for subculture and growth.
[0044] The germination rate of the embryo sac is calculated by observing whether new embryos have grown. The results show that the germination rate of the embryo sac after treatment with a 62.3 mg / L MgCl2.6H2O solution is 6.67%, 5.83%, and 9.17%, with an average germination rate of 7.22%, which is significantly higher than the control group without treatment.
[0045] Example 2: Colchicine double treatment
[0046] Weigh the required agar, sucrose, B5 medium, and prepare the subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%). Weigh 0.21 g of colchicine (0.02% concentration) into the subculture medium per liter of liquid, stir until completely dissolved, adjust the pH to 5.8-5.9, and obtain the colchicine double culture medium. Sterilize at 121°C for 25 min, and after sterilization, solidify to obtain the double culture medium for standby use.
[0047] Prepare the experimental tools and double culture medium, and select healthy and green plants from the regenerated seedlings that need to be doubled for 7 days.
[0048] After the treatment time, move to the normal subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%) for hardening and growth. Label the material name and doubling treatment days outside the culture bottle. If there are strong and weak seedlings in one culture bottle, move the strong seedlings to the double culture medium and the weak seedlings to the subculture medium without colchicine for further growth. Observe the plant growth, plant type, and leaf changes during the doubling treatment and hardening and growth stages, and make timely experimental adjustments and records based on the observations.
[0049] After embryo rescue and colchicine treatment, a total of 7 ovules formed doubled tissue culture seedlings. Then, 7 offspring populations were obtained by in vitro propagation, labeled as Offspring-1, Offspring-2, …, Offspring-7, each with 6 plants. The plants were planted in the field and managed routinely, as shown in the following table. Figure 1
[0050] Example 3 Confirmation of Distant Hybrid
[0051] Root tip chromosome observation
[0052] Rinse the medium on the root tips of the parent and hybrid offspring with tap water several times until clean. Use scissors to cut fresh lateral roots of 0.8-1.2 mm in diameter and 10-15 mm in length, and rinse the good lateral root samples with distilled water to further remove impurities. Place the clean lateral root samples in a centrifuge tube and fill it with 8-hydroxyquinoline, and incubate in a 25°C incubator for 3.5 hours in the dark.
[0053] After dark incubation, remove the lateral roots from the centrifuge tube and absorb the residual liquid on the root tips with filter paper, and fix them in a centrifuge tube containing Carnoy's fixative (alcohol: glacial acetic acid = 3:1) and store in a -20°C refrigerator.
[0054] The root tip was taken out and washed with distilled water, then placed in 2 ml of 1 mol / L hydrochloric acid solution, and dissociated in water bath at 55-60°C for 15 minutes.
[0055] After dissociation, the stem tip was taken out, washed, placed on a glass slide, crushed, and dyed with carboflavine for 5 minutes.
[0056] Cover the cover glass, press the tablet, and observe and take pictures under a microscope.
[0057] The chromosome number of the 7 groups of doubled materials was identified by root tip chromosome counting method. It can be accurately judged whether the hybrid is a true hybrid. The expected chromosome number of the true hybrid (AAEE) should be 42 (AA+EE=42). As shown in Table 1, the number of root tip chromosomes of the 7 groups of doubled materials is 42. Figure 2
[0058] Therefore, through root tip chromosome observation, the doubled material can be basically determined as a distant hybrid, and the heterologous diploid is successfully doubled to a heterologous tetraploid.
[0059] Example 4 Morphological analysis
[0060] The embryos obtained by the experiment were subcultured several times, and gradually grew into regenerated seedlings from the new embryos. At this time, strong seedlings can be selected for rooting culture, and strong root systems can be selected after about 10-15 days.
[0061] Prepare a hole tray of appropriate size, a tray, a protective cover, sterile substrate, carbendazim solution to prevent pests, a certain concentration of rooting agent, tweezers, etc. The mixed wet sterile substrate is loaded into the hole tray, and the strong seedlings and well-grown roots are carefully clamped out with tweezers. The roots are dipped in carbendazim solution and rooting agent, and then planted in the hole opposite to the label. Each plant tissue culture seedling is transplanted into the hole tray according to this method. After the tray is fully planted, water is poured, the protective cover is covered, and it is placed in the light incubator for seedling growth. When the plant seedlings grow to a certain size, they can be transplanted to the test field and grow normally in the natural environment.
[0062] In addition, whether the tissue culture seedlings are transplanted to the hole tray or transplanted from the light incubator to the test field, they should be transplanted and planted according to the type, quantity, and size of the material, so as to investigate the plant traits and record them later.
[0063] Observe and record the morphological characteristics of the different growth and development stages of the Brassica rapa mother plant, the Eruca sativa father plant, and the F1 generation plant, such as the main stem, lateral branches, flower shape, petal number, bud morphology, inflorescence, stamen, and flower color.
[0064] Morphological data of the allotetraploids and the parents, as shown in Table 1.
[0065] Table 1. Statistical data of the phenotypes of the allotetraploids and the parents
[0066]
[0067] Example 5. InDel molecular marker development and identification
[0068] Leaves of the parents and F1 plants were taken, and RNA was extracted using the Trizol method to construct a library, and the parents and their hybrid offspring were subjected to high-throughput sequencing using the Illumina platform.
[0069] After obtaining clean reads by high-throughput sequencing, the data was filtered to obtain Clean data. The data was compared with the Brassica rapa reference genome (http: / / www.brassicadb.cn / # / Download / Brara_Chiifu_V3.5 / ) to obtain Mapped data. According to the position information of the reads aligned to the genome, StringTie (Pertea M, Pertea GM, Antonescu CM, et al, StringTie enables improved reconstruction of a transcriptome from RNA-seq reads, Nature biotechnology, 2015, 33(3): 290-295) was used to assemble the reads into transcripts. The transcripts obtained by splicing were compared with the annotation information of the genome using GffCompare. After detecting InDel using GATK (McKenna A, Hanna M, Banks E, et al, The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data, Genome research, 2010, 20(9): 1297-1303), ANNOVAR (Wang K, Li M, Hakonarson H, ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data, Nucleic acids research, 2010, 38(16): e164-e164) was used to annotate the variant sites to obtain the analysis results and annotation information of InDel. The obtained InDel was first classified and analyzed. For the sites where the same site appeared heterozygous in the hybrid, the same site in the maternal parent was the same as the reference genome Ref, and the variation base in the paternal parent occurred, subsequent analysis was performed, and 5 pairs of primers were preliminarily screened from a plurality of pairs of primers for subsequent experiments.
[0070] Table 2
[0071]
[0072] PCR amplification was performed using genomic DNA of the parent and hybrid, and the PCR program was set according to the melting temperature, base number, base composition and base sequence of the primer: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles of PCR, and 4℃ storage for standby. The 20 μL reaction system included: 2 μL of DNA template, 1 μL of forward primer and 1 μL of reverse primer, 10 μL of PCR Mix and 6 μL of dd H2O.
[0073] Polyacrylamide gel electrophoresis was performed at 180 V (ice bags were placed on both sides of the electrophoresis tank) for 2 h, and then the gel was fixed, washed, silver-stained, developed and observed. The selected primer was subjected to PCR amplification with DNA of the parent and hybrid F1 generation, and the suitable primer which could exhibit the specific bands of the parent and hybrid F1 generation simultaneously was selected for the authenticity identification of the hybrid. Only the heterologous tetraploid under the BraA05g042250.3.5C_indel primer had the bands of the parent and hybrid, and the results are shown in Fig. 2, while the other four primers failed to achieve the identification successfully. Figure 3
[0074] Next, the method in the foregoing was used, and the DNA of the 7 groups was subjected to PCR and polyacrylamide gel electrophoresis under the BraA05g042250.3.5C_indel primer, and the electrophoresis results are shown in Fig. 3. It was found that the 7 groups of heterologous tetraploids had the bands of the parent and hybrid, which confirmed the authenticity of the hybrid. Figure 4
[0075] The above merely describes preferred embodiments of the present application, but is not used to limit the protection scope of the present application.
Claims
1. A method for identifying Brassica rapa L. and Diplotaxis intergeneric hybridization heterologous tetraploid based on InDel technology, comprising: obtaining a sample to be identified, which is obtained by embryo rescue and chromosome doubling after Brassica rapa L. ‘72049’ as the female parent and Diplotaxis ‘ASTRO’ as the male parent intergeneric hybridization; using the genomic DNA of the material as a template, amplifying using the following InDel primer pair: forward primer 5'-3': GCTGACAGAATCAAAAGCAGCT, reverse primer 5'-3': GCACAAGGACACTGTCCAGC; performing gel electrophoresis on the amplified product; and observing the electrophoresis bands, determining the authenticity of the heterologous tetraploid in the presence of the electrophoresis bands of the male parent and the female parent at the same time.
2. The method of claim 1, wherein, The method further comprises amplifying the female parent and the male parent using the InDel primer pair.
3. The method of claim 1, wherein, The step of observing includes confirming that a heterologous tetraploid is obtained when the sample simultaneously appears the bands of the female parent and the male parent.
4. The method of claim 1, wherein, The amplification conditions are: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, 30-40 cycles.
5. The method of claim 1, wherein, The amplification object of the InDel primer pair is located on the gene shown in SEQ ID NO:
11.
6. The method of any one of claims 1-5, wherein, The step of obtaining includes: using Brassica rapa L. ‘72049’ as the female parent and Diplotaxis inbred line ‘ASTRO’ as the male parent, cross pollination at the bud stage, taking the ovary 7 days after pollination, embryo rescue under aseptic conditions, and doubling treatment. 7.An InDel primer pair for identifying the heterologous tetraploid of the female parent Brassica rapa L. ‘72049’ and the male parent Diplotaxis ‘ASTRO’ intergeneric hybridization, the primer pair consists of forward primer 5'-3': GCTGACAGAATCAAAAGCAGCT, and reverse primer 5'-3': GCACAAGGACACTGTCCAGC. 8.A kit for identifying the heterologous tetraploid of the female parent Brassica rapa L. ‘72049’ and the male parent Diplotaxis ‘ASTRO’ intergeneric hybridization, the kit comprising the InDel primer pair of claim 7.
9. The kit of claim 8, wherein, The kit further comprises the genomic DNA of Brassica rapa L. ‘72049’ and the genomic DNA of Diplotaxis ‘ASTRO’. 10.Use of the InDel primer pair of claim 7 or the kit of claim 8 or 9 for identifying the heterologous tetraploid of the female parent Brassica rapa L. ‘72049’ and the male parent Diplotaxis ‘ASTRO’ intergeneric hybridization.
Citation Information
Patent Citations
Method and primer pair for identifying intergeneric hybridization of Chinese cabbage and sesames based on KASP technology
CN118755863A