SNP markers affecting the ability of Tibetan sheep to resist oxidative stress and their application

Abstract

The present invention relates to the field of molecular biology detection technology, and in particular to SNP markers that affect the ability of Tibetan sheep to resist oxidative stress and their applications. A SNP molecular marker related to the oxidative stress ability of Tibetan sheep, the SNP molecular marker is located at the 72590068th base on chromosome 15 of the international sheep genome Oar_v4.0 version, and the mutant base is C or G. The present invention can determine the antioxidant stress index NO and T-AOC content of Tibetan sheep individuals by detecting the base at the 72590068th nucleotide site on chromosome 15 of Tibetan sheep. The present invention provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep antioxidant stress traits for non-diagnostic purposes.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology detection, and in particular to a SNP marker affecting the anti-oxidative stress ability of Tibetan sheep and an application thereof. Background Art

[0002] Tibetan sheep are an important part of the grassland animal husbandry in the high-altitude pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau are: high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, etc. Due to the harsh environment of the Qinghai-Tibet Plateau, Tibetan sheep will have a series of non-specific reactions, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one.

[0003] The antioxidant system is the main means of coping with oxidative stress. The antioxidant system is composed of a series of antioxidant enzymes and non-enzymatic antioxidants, including superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione-S transferase (GST), glutathione peroxidase (GPx) and vitamin C (VC). When an organism is subjected to oxidative stress, a large number of reactive oxygen free radicals (ROS) are produced. The body regulates the antioxidant system to resist the oxidative damage caused by ROS and maintains normal physiological and life activities by removing excess ROS in the body. Environmental stress can trigger the production of ROS in Tibetan sheep, damage the normal physiological functions and immune defense capabilities of cells and tissues, and cause oxidative stress or damage to the body.

[0004] NO and T-AOC are important indicators for detecting oxidative stress response, and the above indicators can evaluate the oxidative stress capacity and health status of Tibetan sheep. By detecting the indicators of anti-oxidative stress, the oxidative stress response capacity of Tibetan sheep can be discovered in time, and certain measures can be taken to improve their oxidative stress capacity, so that they can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, and provide a basis for the auxiliary breeding of Tibetan sheep.

[0005] Molecular markers are genetic markers based on nucleotide sequence variation in genetic material between individuals, and are a direct reflection of genetic polymorphism at the DNA level. Molecular marker technology can find variant sites in genes at the gene level, and through the association analysis between them and traits, the relationship between genes and traits can be discovered, and early selection can be carried out to improve the efficiency and accuracy of breeding. It can fundamentally improve the oxidative stress capacity of Tibetan sheep and has broad application value.

[0006] Therefore, molecular markers lay the foundation for people to study the genetic mechanism of oxidative stress capacity of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. There are not many studies on molecular markers related to the oxidative stress capacity of Tibetan sheep in the prior art for assisted breeding. It is particularly important to provide a molecular marker related to the oxidative stress capacity of Tibetan sheep, so as to be used in molecular marker-assisted breeding of Tibetan sheep and screen Tibetan sheep with strong anti-oxidative stress capacity. Summary of the invention

[0007] The purpose of the present invention is to provide a SNP marker affecting the anti-oxidative stress ability of Tibetan sheep and an application thereof.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The invention provides a SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 72590068th base on chromosome 15 of the international sheep genome Oar_v4.0 version, and the mutant base is C or G.

[0010] Preferably, the genotype of the Tibetan sheep with the mutant base C is CC or GC;

[0011] The genotype of Tibetan sheep with the mutant base G is GG;

[0012] The anti-oxidative stress indexes NO and T-AOC of the Tibetan sheep individuals with the GG and CG genotypes were significantly higher than those of the individuals with the CC genotype;

[0013] There was no significant difference in the antioxidant stress indicators NO and T-AOC between Tibetan sheep individuals with GG and CG genotypes.

[0014] The present invention also provides the use of the SNP molecular marker in marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes.

[0015] The present invention also provides application of the SNP molecular marker in Tibetan sheep assisted breeding.

[0016] The present invention also provides a primer pair for amplifying the SNP, and the primer pair is shown in SEQ ID NO. 2-3.

[0017] The present invention also provides the use of the primer pair in preparing a product for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes.

[0018] The present invention also provides application of the primer pair in preparing products for auxiliary breeding of Tibetan sheep.

[0019] The present invention also provides a method for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes, comprising the following steps:

[0020] (1) Extracting Tibetan sheep genomic DNA;

[0021] (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0022] (3) performing genotyping analysis on the amplified products to obtain Tibetan sheep with different genotypes; and correlating the genotypes of the Tibetan sheep with anti-oxidative stress indicators;

[0023] The anti-oxidative stress indicators include NO and / or T-AOC.

[0024] Preferably, the amplification system in step (2) is: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of template DNA;

[0025] The amplification program of step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0026] The present invention also provides a kit for marker-assisted selection of Tibetan sheep anti-oxidative stress traits and / or Tibetan sheep assisted breeding for non-diagnostic purposes, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention provides a SNP marker affecting the antioxidant stress resistance of Tibetan sheep and its application. The SNP molecular marker of the present invention is located at the 72590068th base on chromosome 15 of the international sheep reference genome Oar_v4.0 version; the variation type is C / G, named g72590068C>G, and there are three genotypes. When the 72590068th base on chromosome 15 is C, the genotype is CC or GC; when the 72590068th base on chromosome 15 is G, the genotype is GG. Through the association analysis of different genotypes with the content of antioxidant stress indicators NO and T-AOC, it is found that the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with the GG and CG genotypes are significantly higher than those of CC genotype individuals (p<0.05); the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with the GG and CG genotypes are not significantly different (p>0.05). By detecting the base at the 72590068th nucleotide site on chromosome 15 of Tibetan sheep, the content of NO and T-AOC, the antioxidant stress indicators of individual Tibetan sheep, can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the amplification product of SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of repeats;

[0030] Figure 2 The peak diagram and sequence are obtained after the PCR amplification product is purified and sequenced. DETAILED DESCRIPTION

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] Example 1

[0033] 1. Sample collection

[0034] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 70 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 49 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 177 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.

[0035] 2 Main reagents and instruments

[0036] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. NO (A012-1-2) and T-AOC (A015-2-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0037] 3 Methods

[0038] 3.1 Detection of NO and T-AOC in serum

[0039] The NO detection kit was used to measure the NO using the nitrate reductase method according to Nanjing Jiancheng Bioengineering Institute.

[0040] The assay steps are as follows: (1) add 0.1 mL of double distilled water and 0.4 mL of mixed reagent (reagent one and reagent two are mixed at a ratio of 1:1) to a blank tube, add 100 μmol / L standard application solution and 0.4 mL of mixed reagent to a standard tube, add 0.1 mL of serum to be tested and 0.4 mL of mixed reagent to a test tube, mix well and place in a water bath at 37°C for 60 min; (2) add 0.2 mL of reagent three and 0.1 mL of reagent four to the blank tube, standard tube and test tube, vortex mix thoroughly for 30 s, stand at room temperature for 40 min, and centrifuge at 3500 rpm for 10 min; (3) take 0.5 mL of supernatant, add 0.6 mL of color developer, mix well and place at room temperature for 10 min, and measure the absorbance of each tube at a wavelength of 550 nm; (4) calculate the NO content according to the formula provided in the kit instructions.

[0041] The determination was performed using the ABTS method according to the T-AOC detection kit from Nanjing Jiancheng Bioengineering Institute.

[0042] The assay steps are as follows: (1) add 10 μl of double distilled water and 20 μl of reagent IV application solution (reagent 1 and peroxidase are mixed at a ratio of 9:1) to a blank tube, add 10 μl of MTrolox solution of different concentrations and 20 μl of reagent IV application solution to a standard tube, and add 10 μl of serum to be tested and 20 μl of reagent IV application solution to a test tube; (2) add 170 μl of ABTS working solution (reagent 1: reagent 2: reagent 3 application solution = 76:5:4) to the blank tube, standard tube, and test tube; (3) react at room temperature for 6 minutes, and read the OD value of each well using an enzyme reader at a wavelength of 405 nm; (4) prepare a standard curve using the standard OD and obtain the curve formula, and substitute the OD measured in the sample test tube into the calculation formula to obtain the result.

[0043] 3.2 Extraction of genomic DNA from blood

[0044] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0045] 3.3 Primer design

[0046] Referring to the gene sequence of chromosome 15 of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019472.2), a pair of specific primers were designed using primerpremier5.0 software, including the g72590068C>G SNP site.

[0047] Primer sequences:

[0048] F: 5'-AGTTCCTCCTTGGTTGTT-3';

[0049] R: 5'-TCCAGCATTCTTGCCTTG-3'.

[0050] (as shown in SEQ ID NO. 2 and 3)

[0051] The length of the amplified fragment was 304 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0052] 3.4 PCR amplification and sequencing

[0053] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template 1 μL.

[0054] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 58.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0055] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No.1, and the SNP marker is located at position 264 of the nucleotide sequence shown in SEQ ID No.1.

[0056] The biological analysis software MEGA 6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0057] SEQ ID No.1

[0058] AGTTCCTCCTTGGTTGTTGACATGAGGGCCTCCATTCCTCCCAAGTGGTCAGCCCAATTTAGTTCCCTGCCACGTAGGCTTCTCCACAGAGAGTTCACAACATGGAAGGTGGCTTTATCAGAGCGAGCAGATGAGAGAGCAGGACAGAAGCC ACAGTATTTCATGACCCAGTCTCAGTGGCAGCCAGTACCCTTGCTGTGTGCATGCGCTCAGCCACTCAGTTGTGTGCAACTCTTTGCAACCTCATGTACTGTAGCCCATCACGCTCCTTTGTCCACTGAGTTTTCAAGGCAAGAATGCTGGA.

[0059] 4 Statistical analysis

[0060] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g72590068C>G gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the antioxidant stress indicators NO and T-AOC, and the results were expressed as "mean ± standard error".

[0061] 5 Results

[0062] 5.1 PCR amplification and sequencing results

[0063] The amplified product of the g72590068C>G SNP site on chromosome 15 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 304bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0064] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that a CG mutation occurred at the g72590068C>GSNP site, and there are three genotypes: CC, CG, and GG.

[0065] 5.2 Statistical analysis results

[0066] The genotype and allele frequencies of the g72590068C>G SNP locus on chromosome 15 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g72590068C>G SNP locus, the CC genotype frequency was the highest, which was the dominant genotype, and the C allele frequency was 77.4%, which was the dominant allele. The χ2 fitness test showed that the SNP locus deviated significantly from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.538, the PIC was 0.289, 0.25<PIC<0.50, and it was moderately polymorphic.

[0067] Table 1 Polymorphism of g72590068C>G SNP locus on chromosome 15 of Tibetan sheep

[0068]

[0069] 5.3 Association analysis between different genotypes and anti-oxidative stress indicators NO and T-AOC

[0070] The general linear model in IBM SPSS Statistics 22 software was used to analyze the correlation between different genotypes of Tibetan sheep and the content of antioxidant stress indicators NO and T-AOC. The results showed that the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with GG and CG genotypes were significantly higher than those of individuals with CC genotypes (p<0.05); the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with GG and CG genotypes were not significantly different (p>0.05). The results showed that the base of the g72590068C>G SNP site on chromosome 15 of Tibetan sheep was significantly correlated with NO and T-AOC of Tibetan sheep, and it was a SNP marker related to NO and T-AOC of Tibetan sheep. The results are shown in Table 2.

[0071] Table 2 Relationship between different genotypes and anti-oxidative stress indicators NO and T-AOC

[0072]

[0073]

[0074] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0075] In summary, the SNP molecular marker described in the present invention is located at the 72590068th base on chromosome 15 of the international sheep reference genome Oar_v4.0 version; the variation type is C / G, named g72590068C>G, and there are three genotypes. When the 72590068th base on chromosome 15 is C, the genotype is CC or GC; when the 72590068th base on chromosome 15 is G, the genotype is GG. Through the association analysis of different genotypes with the content of antioxidant stress indicators NO and T-AOC, it was found that the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with the GG and CG genotypes were significantly higher than those of individuals with the CC genotype (p<0.05); the antioxidant stress indicators NO and T-AOC of Tibetan sheep individuals with the GG and CG genotypes were not significantly different (p>0.05). By detecting the base at the 72590068th nucleotide site on chromosome 15 of Tibetan sheep, the content of NO and T-AOC, the antioxidant stress indicators of individual Tibetan sheep, can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, provides a basis for screening Tibetan sheep with strong antioxidant stress resistance, and provides a new direction for assisted breeding of Tibetan sheep.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for the antioxidant stress trait of Tibetan sheep or a Tibetan sheep antioxidant stress trait auxiliary breeding detection reagent, characterized in that: The SNP molecular marker is located at the 72590068th base on chromosome 15 of the international sheep genome Oar_v4.0 version, and the mutant base is C or G; the genotype of the Tibetan sheep with the mutant base is CC or GC or GG; The antioxidant stress indexes NO and T-AOC of the Tibetan sheep individuals with the GG and CG genotypes were significantly higher than those of the CC genotype individuals; the antioxidant stress indexes NO and T-AOC of the Tibetan sheep individuals with the GG and CG genotypes were not significantly different.

2. The use according to claim 1, characterized in that: The method for detecting the SNP molecular marker comprises the following steps: (1) Extraction of Tibetan sheep genomic DNA; (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pairs shown in SEQ ID NOs. 2-3 to obtain an amplified product; (3) performing genotyping analysis on the amplified product to obtain Tibetan sheep with different genotypes; and correlating the genotype of the Tibetan sheep with an anti-oxidative stress index; The anti-oxidative stress indicators include NO and / or T-AOC.

3. The use according to claim 2, characterized in that: The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

Images