Molecular marker of wheat kernel type related gene ta cyt-5a and application
By developing the wheat grain shape-related gene TaCYT-5A molecular marker and utilizing SNP sites and KASP molecular marker primers, the problem of wheat grain weight identification was solved, improving the efficiency and yield of wheat breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GANSU AGRI UNIV
- Filing Date
- 2024-07-24
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify wheat grain weight-related genes and their variation types, which affects the selection of parental lines and the breeding process for high-yield wheat breeding.
We developed a molecular marker for the wheat grain shape-related gene TaCYT-5A. By providing the polymorphic site C or T at the SNP locus located at 495818646 on wheat chromosome 5, we designed KASP molecular marker primers to screen or identify wheat varieties with superior traits. Combined with phenotypic analysis, we achieved efficient detection and tracking of the TaCYT-5A gene.
It enables efficient detection and tracking of the TaCYT-5A genotype in wheat varieties, significantly improving thousand-grain weight, grain length, and grain shape, and promoting the breeding process for high-yield wheat.
Smart Images

Figure CN118879908B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of wheat grain shape gene technology, and more specifically, to the molecular marker TaCYT-5A of wheat grain shape-related genes and its application. Background Technology
[0002] Wheat is one of the most widely distributed, largest-acreage, highest-yielding, most traded, and most nutritious grain crops, and is one of the three major cereals. Its stable yield growth is crucial for ensuring global food security. The three factors determining wheat yield are: number of ears per unit area, number of grains per ear, and grain weight. An increase in the number of grains per ear leads to a decrease in the number of ears per unit area, while grain weight has a relatively independent effect on yield. Furthermore, grain weight is primarily influenced by genetic factors and is stably inherited among the three yield factors. Therefore, grain weight plays a vital role in increasing wheat yield.
[0003] Molecular markers are specific DNA fragments or other biomolecules used to reflect certain differences in the genomes of individuals or populations. As an efficient and accurate tool, they can quickly and precisely identify phenotypic variations caused by polymorphisms in the internal sequences of genes.
[0004] Currently, molecular markers have been widely used in various crops and traits. For wheat, with the continuous advancement of cloning of wheat grain weight genes and molecular marker development technology, molecular marker-assisted selection breeding of wheat can be aided.
[0005] Rapid and accurate identification of the distribution of genes related to grain weight formation and their variants in different wheat varieties can provide a theoretical basis for parental selection in high-yield wheat breeding. Therefore, developing molecular markers highly correlated with grain shape has significant scientific research value and broad breeding application prospects.
[0006] To address the aforementioned issues, this application proposes the molecular marker TaCYT-5A for wheat grain shape and its application. Summary of the Invention
[0007] The purpose of this invention is to provide a molecular marker for the wheat grain shape-related gene TaCYT-5A and its application, in order to solve the problems in the prior art.
[0008] The objective of this invention can be achieved through the following technical solutions:
[0009] The wheat grain shape-related gene TaCYT-5A molecular marker provides a wheat grain shape-related SNP site located at position 495818646 on wheat chromosome 5, with a polymorphic site of C or T.
[0010] Furthermore, wheat varieties with the genotype CC at chromosome 5, location 495818646, exhibited greater thousand-grain weight, grain length, and grain shape than wheat varieties with the genotype TT.
[0011] Preferably, the KASP molecular marker for the SNP site is provided, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, 187-264 bp, and the polymorphic site at 201 bp of the sequence is C or T.
[0012] Preferably, the amplification primers for the molecular marker are provided, and the nucleotide sequences of the amplification primers are shown in SEQ ID NO.2-4.
[0013] Preferably, the application is carried out by providing any one of the following: the SNP site, the molecular marker, or the amplification primer:
[0014] 1) Screening or identifying wheat varieties with superior traits;
[0015] 2) Cultivate wheat varieties with superior traits;
[0016] 3) The superior traits are characterized by high thousand-grain weight, grain length, and grain shape.
[0017] Preferably, a method for identifying wheat traits is provided, comprising the following steps:
[0018] The genotype at 495818646 bp on chromosome 5 of the wheat genome was detected. If the genotype at 495818646 bp on chromosome 5 of the wheat genome was CC, it was a high thousand-grain weight wheat. If the genotype at 495818646 bp on chromosome 5 of the wheat genome was TT, it was a low thousand-grain weight wheat.
[0019] Furthermore, the method for detecting the genotype at 495818646 bp on chromosome 5 of the wheat genome to be tested includes the following 1) or 2):
[0020] Preferably, a method for breeding wheat varieties with superior traits includes the following steps:
[0021] First, the genotype at 495818646 bp on chromosome 5 of the wheat genome was detected, and then wheat with the genotype CC was selected as the parent for breeding.
[0022] The superior traits are characterized by high thousand-grain weight, grain length, and grain shape.
[0023] In view of the shortcomings of the prior art, the present invention provides a molecular marker for the wheat grain shape gene TaCYT-5A and its application, and adopts the following technical solution:
[0024] The sites in the sequence are shown in Table 1:
[0025] 1. A molecular marker for the wheat grain shape-related gene TaCYT-5A, wherein the molecular marker is located in the TaCYT-5A gene, which encodes 4-hydroxyphenylacetaldehyde oximemonooxygenase, an enzyme that is a member of the cytochrome P450 family. Analysis of 677 resequencing data from hexaploid wheat obtained from the Wheat Genome Variation Database (http: / / wheat.cau.edu.cn / WheatUnion / ) revealed four polymorphic sites in the TaCYT-5A gene at positions 62 bp, 124 bp, 280 bp, and 448 bp downstream of the start codon. The inverse complementary sequences at these four polymorphic sites correspond to positions 498518322 bp, 495818490 bp, 495818646 bp, and 498518708 bp on wheat chromosome 5, respectively. Two haplotypes of TaCYT-5A exist in natural wheat populations, named haplotype Hap-5A-1 and haplotype Hap-5A-2. The haplotype locations in the sequence are shown in Table 1.
[0026] 2. The KASP molecular marker for the wheat grain shape-related gene TaCYT-5A is located at 495818646 bp (CC / TT) on chromosome 5A. This site is 124 bp downstream of the TaCYT-5A start codon. A KASP molecular marker was designed targeting this SNP site.
[0027] The KASP-labeled primer set includes primers KASP-TaCYT-5A-F1, KASP-TaCYT-5A-F2, and a common primer KASP-TaCYT-5A-R;
[0028] The nucleotide sequence of the primer KASP-TaCYT-5A-F1 is as follows:
[0029] 5'-GAAGGTCGGAGTCAACGGATTTCCCGATGGCCCATGC-3';
[0030] The nucleotide sequence of the primer KASP-TaCYT-5A-F2 is as follows:
[0031] 5'-GAAGGTGACCAAGTTCATGCTTCCCGATGGCCCATGT-3';
[0032] The nucleotide sequence of the shared primer KASP-TaCYT-5A-R is as follows:
[0033] 5'-CTGCAGAGGGTGGAGATCG-3'.
[0034] Based on the N site, wheat is divided into the following two haplotypes:
[0035] I: C / C (i.e., haplotype I);
[0036] II: T / T (i.e., haplotype II);
[0037] 3. Application of the TaCYT-5A molecular marker method for wheat grain shape-related genes. The method for obtaining the molecular marker is as follows:
[0038] First, wheat DNA was extracted, then SNP sites were detected, and finally, data analysis was performed.
[0039] 4. The application of the TaCYT-5A molecular marker for wheat grain shape-related genes is as follows:
[0040] (The wheat germplasm resources from 220 different ecological zones listed in Table 1 were used. These materials were planted at the Tongwei County Experimental Station and the Nanhu Experimental Station in Zhuanglang County, Gansu Province, in 2021-2022. The three planting environments are designated as: 2021TW (Tongwei, 2021), 2022TW (Tongwei, 2022), and 2022ZL (Zhuanglang, 2022). The field trials were randomized block experiments with three replicates. Each material was planted in three rows with a row spacing of 20 cm and a row length of 1 m, with 60 seeds per row. After grain maturity, 200 plump seeds were selected from each line for seed evaluation, and each line was replicated three times.)
[0041] 2. The seed weight, length, width and area were analyzed using the Wanshen SC-G automatic seed analysis and thousand-grain weight analyzer. The specific data are shown in Table 1.
[0042] 3. Using the TaCYT-5A molecular marker provided in Example 1 and the method provided in Example 2, the significance between the phenotypes of the two wheat germplasm resources was analyzed. The genotyping results are as follows: Figure 2 As shown in Table 1, the one-way ANOVA method of Excel (2016) was used to analyze whether there were significant differences in grain shape among wheat varieties carrying different genotypes.
[0043] The beneficial effects of this invention are:
[0044] This invention developed the KASP molecular marker targeting the SNP site of the TaCYT-5A gene and performed genotyping and phenotypic association analysis on 220 wheat germplasm resources from different ecological regions. The results showed that the KASP-TaCYT-5A marker can classify different wheat varieties into two haplotypes: Hap-5A-1 and haplotype Hap-5A-B; the genotype of haplotype Hap-5A-1 is C / C, and the genotype of haplotype Hap-5A-2 is T / T. Based on the phenotypic data, the materials with different genotypes were further analyzed... Association analysis revealed that wheat materials with the C / C genotype had significantly greater thousand-grain weight, grain length, and grain shape than those with the T / T genotype. This indicates that the C / C genotype is a superior allelic variant that has a positive effect on wheat grain weight and grain shape. In the breeding process, the aggregation of beneficial mutant alleles is consistent with the increase in yield during crop breeding. Therefore, the KASP-TaCYT-5A molecular marker provided by this invention can efficiently detect and track the TaCYT-5A gene in wheat varieties / lines, providing technical support for improving high-yield wheat breeding. Attached Figure Description
[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0046] Figure 1 This is a schematic diagram showing the genotypic identification results of wheat germplasm resources in different wheat-growing areas of my country using the KASP marker primer set in this invention.
[0047] In the above figures, red dots represent HEX type allele C / C, and blue dots represent FAM type allele T / T;
[0048] Figure 2 This is a schematic diagram comparing the grain types of wheat germplasm resources with different TaCYT-5A genotypes in this invention;
[0049] In the above figures, the grain size of wheat varieties containing the C / C genotype is significantly larger than that of varieties with the T / T genotype;
[0050] Figure 3 The figure shows a schematic diagram of the expression of the TaCYT-5A gene in different wheat tissues in this invention.
[0051] In the above figures, the transcriptional expression of the TaCYT-5A gene in young spikelets is significantly higher than that in roots, stems, leaves, and grains. Detailed Implementation
[0052] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0053] Please see Figure 1-3 This invention provides a molecular marker for the wheat grain shape-related gene TaCYT-5A and its application.
[0054] Example 1
[0055] This embodiment provides the molecular marker TaCYT-5A, a gene related to wheat grain shape, as follows:
[0056] The wheat grain shape-related gene TaCYT-5A in this embodiment encodes 4-hydroxyphenylacetaldehyde oxime monooxygenase, which is a member of the cytochrome P450 family. Analysis of 677 resequencing data from hexaploid wheat in the Wheat Genome Variation Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ) revealed that the TaCYT-5A gene has SNP variants at positions 62, 124, 280, and 448 bp downstream of the start codon. The inverse complementary sequences of these four polymorphic sites correspond to positions 498518322 bp, 495818490 bp, 495818646 bp, and 498518708 bp on wheat chromosome 5, respectively. Two haplotypes of the four TaCYT-5A polymorphic sites exist in natural wheat populations, named haplotype Hap-5A-1 and haplotype Hap-5A-2, respectively. The haplotype loci in the sequence are shown in Table 1.
[0057] Table 1. Nucleotides at each SNP site for the two haplotypes
[0058] <![CDATA[ 5A chromosome position ]]> <![CDATA[ 498518322 bp ]]> <![CDATA[ 495818490 bp ]]> <![CDATA[ 495818646 bp ]]> <![CDATA[ 498518708 bp ]]> <![CDATA[ Hap-5A-1 ]]> <![CDATA[ C ]]> <![CDATA[ C ]]> <![CDATA[ C ]]> <![CDATA[ G ]]> <![CDATA[ Hap-5A-2 ]]> <![CDATA[ T ]]> <![CDATA[ T ]]> <![CDATA[ T ]]> <![CDATA[ A ]]>
[0059] The KASP molecular marker for the wheat grain shape-related gene TaCYT-5A in this embodiment is located at 495818646 bp (CC / TT) on chromosome 5A, 124 bp downstream of the start codon of TaCYT-5A. A KASP molecular marker was designed targeting this SNP site. The KASP marker primer set includes primers KASP-TaCYT-5A-F1, KASP-TaCYT-5A-F2, and a common primer KASP-TaCYT-5A-R. The nucleotide sequence of primer KASP-TaCYT-5A-F1 (SEQ ID NO.2) is as follows:
[0060] 5'-GAAGGTCGGAGTCAACGGATTTCCCGATGGCCCATGC-3';
[0061] The nucleotide sequence of the primer KASP-TaCYT-5A-F2 (SEQ ID NO.3) is as follows:
[0062] 5'-GAAGGTGACCAAGTTCATGCTTCCCGATGGCCCATGT-3';
[0063] The nucleotide sequence of the shared primer KASP-TaCYT-5A-R (SEQ ID NO.4) is as follows:
[0064] 5'-CTGCAGAGGGTGGAGATCG-3'.
[0065] Example 2
[0066] This embodiment provides a method for obtaining the molecular marker TaCYT-5A, a gene related to wheat grain shape, as follows:
[0067] 1. Extraction of wheat genomic DNA:
[0068] DNA was extracted from the leaves of wheat seedlings at the two-leaf-one-heart stage using the CTAB method. Several DNA working solutions were randomly selected, and the concentration was measured using NanoDrop2000. An A260 / A280 ratio of around 1.8 indicates that the sample quality is qualified.
[0069] 2. KASP marker amplification and detection:
[0070] A PCR reaction system consisting of two temperature steps was used: DNA was denatured at a higher temperature and then annealed and extended at the same lower temperature. PCR amplification could be performed on any suitable PCR instrument. The PCR reaction system consisted of 2 μL of 2xTaq DNA Polymerase Mix, 1 μL of SNP Primer Mix (4x), and 2 μL of DNA. The PCR amplification system consisted of: (1) 94 °C for 15 min; (2) 94 °C for 20 s; decreasing by 0.6 °C per cycle from 61 to 55 °C; for a total of 10 cycles; (3) 94 °C for 20 s; 55 °C for 45 s; for 37 cycles. After the PCR amplification cycles were completed, fluorescence values were read using an OMEGA SNP genotyping instrument. In this method, SNP loci were detected using fluorophores FAM (excitation 485 nm, emission 520 nm) and VIC (excitation 535 nm, emission 556 nm) to distinguish between two isogenetic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) was used to correct signal differences between pores caused by reaction volume errors.
[0071] 3. Data Analysis
[0072] Data were analyzed using the genotyping software Kluster Caller, in which VIC and FAM data were plotted on the x and y axes, respectively. The VIC and FAM values for each reaction well were corrected using the value of the reference dye (ROX) for that specific well. The fluorescence values were standardized to obtain the relative fluorescence values corresponding to VIC and FAM for each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and genotypes were further determined according to the sample clusters and fluorescence patterns.
[0073] Example 3
[0074] This embodiment provides the application of the TaCYT-5A molecular marker, a gene related to wheat grain shape, as detailed below:
[0075] 1. Using 220 wheat germplasm resources from different ecological regions of my country listed in Table 1, these materials were planted at the Tongwei County Experimental Station and the Nanhu Experimental Station in Zhuanglang County, Gansu Province, respectively, in 2021-2022. The three planting environments are designated as: 2021TW (Tongwei, 2021), 2022TW (Tongwei, 2022), and 2022ZL (Zhuanglang, 2022). The field trials were randomized block experiments with three replicates. Each material was planted in three rows with a row spacing of 20 cm and a row length of 1 m, with 60 seeds per row. After grain maturity, 200 plump seeds were selected from each line for seed evaluation, and each line was subjected to three biological replicates.
[0076] 2. The seed weight, length, width and area were analyzed using the Wanshen SC-G automatic seed analysis and thousand-grain weight analyzer. The specific data are shown in Table 1.
[0077] 3. Using the TaCYT-5A molecular marker provided in Example 1 and the method provided in Example 2, the significance between the phenotypes of the two wheat germplasm resources was analyzed. The genotyping results are as follows: Figure 2 As shown in Table 1, the one-way ANOVA method of Excel (2016) was used to analyze whether there were significant differences in grain shape among wheat varieties carrying different genotypes.
[0078] Wheat materials with the CC genotype predominate. Specific geographical information on wheat germplasm resources is shown in Table 2, sourced from "Information Query of First Agriculturally Approved Varieties" and Zhuang Qiaosheng's "Chinese Wheat Variety Improvement and Pedigree Analysis".
[0079] Table 1 Grain data and genotypes of wheat germplasm resources in different ecological zones
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087] Table 2 Geographical Release Status of Wheat Germplasm Resources
[0088]
[0089]
[0090]
[0091] This invention developed a KASP marker targeting the SNP site 124 bp downstream of the start codon of the 4-hydroxyphenylacetaldehyde oxime monooxygenase gene TaCYT-5A. Genotyping and phenotypic association analyses were performed on 220 wheat germplasm resources from different ecological regions in my country. The results showed that the KASP-TaCYT-5A marker can classify different wheat varieties into two genotypes: CC and TT. Combined with phenotypic data, association analysis of materials with different genotypes revealed that wheat materials carrying the CC genotype had significantly greater thousand-grain weight, grain length, and grain shape than those carrying the TT genotype. This indicates that the CC genotype is a superior allelic variant with a positive effect on wheat grain weight and grain shape. In the breeding process, the aggregation of beneficial mutant alleles is consistent with increased yield in crop breeding. Therefore, the KASP-TaCYT-5A molecular marker provided by this patent can efficiently detect and track the TaCYT-5A gene in wheat varieties / lines, providing technical support for improving high-yield wheat breeding.
[0092] Example 4
[0093] This embodiment provides an analysis of the expression patterns of the wheat grain shape-related gene TaCYT-5A in various organs, as detailed below:
[0094] 1. Extraction of total RNA from plants and synthesis of cDNA:
[0095] Chinese spring wheat seedlings at the two-leaf-one-heart stage, wheat roots, stems, leaves, and young spikes at the booting stage, and grains at 5, 10, 15, 20, 25, and 30 days after flowering were sampled and frozen in liquid nitrogen. Total RNA was extracted from the samples using the TRIzol method (method referred to Molecular Cloning: A Laboratory Manual). RNA concentration was measured using a Nanodrop 2000 spectrophotometer (ND2000; Thermo Scientific, Wilmington, NC), and the quality of the RNA samples was determined by agarose gel electrophoresis. First-strand cDNA was synthesized using the TIANGEN® FastKing gDNADispelling RT SuperMix kit (Tiangen, Beijing). The total reverse transcription volume for this experiment was 20 μl. The reaction system and reaction conditions are as follows:
[0096] (1) Reverse transcription reaction system
[0097]
[0098] The reverse transcription product was stored at -20°C for subsequent experiments.
[0099] 2. Expression analysis of TaCYT-5A in different organs of wheat using qRT-PCR technology.
[0100] qPT-PCR analysis was performed using TIANGEN® FastReal qPCR PreMix (SYBR Green) on a Roche LightCycler® 96 (Roche, Switzerland). GAPDH (TraesCS6B01G243700.1) was used as an internal reference gene for expression in different tissues / organs. All data were analyzed using three biological replicates and three technical replicates.
[0101] (1) qRT-PCR reaction system
[0102]
[0103] (2) qRT-PCR amplification system
[0104]
[0105] The relative quantities are calculated using the 2-ΔΔC(t) method.
[0106] Figure 3 The expression of the TaCYT-5A gene in different wheat tissues was shown. The transcriptional expression of the TaCYT-5A gene in the young spike was significantly higher than that in the root, stem, leaf and grain.
[0107] The TaCYT-5A promoter region was used to develop SNP sites and their nearby sequence information (±200 bp) developed by the KASP marker. The underlined part shows the KASP marker primer amplification sequence.
[0108] The TaCYT-5A coding region developed SNP sites and their nearby sequence information (±200 bp) using KASP markers. The underlined sequence is the KASP marker primer amplification sequence.
[0109] GTTGGCCAACGTGAACTCCATGTTCGCCACCCCATGACCAGTGCTGGGCAGATTCGCCGGCCGGCGCCGAACGGCATCAGTTCCAAGTGAGCGCCACGGAAGTCCACCTTGCCGTGCCTCCCGCCGGCCTCGAACCTCTCCGGCTCGAACTCCTCCGCGTCCTGCCCCCAGCTCATGGGGTCCCTCCCGATGGCCCATG[C / T]GTTCACGAGCACCCGCGACCCCGCCGGCACGTCGTAGCCGCCGATCTCCACCCTCTGCAGCGTCTCCCGCGGCAGAAGCAGCGTAATCGGCGGGTGCAGCCGCAGGGTCTCTTTGACGACCATCTTCAGGTAGGTCAGCTTCGGTAGGTCGTCCGGCTGCACCCGCTGCTCATTGCCGGCGACCACGGCCCTGATCTCCT.
[0110] To make the objectives, technical solutions, and advantages of the invention clearer, specific embodiments of the invention will be described in detail below with reference to the accompanying drawings. Examples of these preferred embodiments are illustrated in the drawings. The embodiments of the invention shown in and described with reference to the drawings are merely exemplary, and the invention is not limited to these embodiments.
[0111] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A kind TaCYT-5 The application of molecular marker A in assisted breeding is characterized by: The molecular marker is shown in SEQ ID NO. 1, 182-249 bp, and the polymorphism of the 201st bp of the sequence shown in SEQ ID NO. 1 is C or T; The specific methods for its application in assisted breeding are as follows: S1: DNA was extracted from the offspring of natural wheat populations and amplified using primers KASP-TaCYT-5A-F1, KASP-TaCYT-5A-F2, and a common primer KASP-TaCYT-5A-R. The products were then genotyped. The nucleotide sequence of the primer KASP-TaCYT-5A-F1 is SEQ ID NO.2; The nucleotide sequence of the primer KASP-TaCYT-5A-F2 is SEQ ID NO.3; The nucleotide sequence of the shared primer KASP-TaCYT-5A-R is SEQ ID NO.4; S2: The genotype is determined by detecting the fluorescence signal of the amplification product. If the product only shows the color of the DNA molecule with the FAM fluorescent tag attached to the 5′ end as shown in SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is CC; if the product only shows the color of the DNA molecule with the HEX fluorescent tag attached to the 5′ end as shown in SEQ ID NO.3, the genotype of the wheat SNP marker to be tested is TT. S3: The offspring identified as having the CC genotype are high thousand-grain weight trait lines.
2. The application according to claim 1, characterized in that: The applications of the molecular markers or primers include screening or identifying wheat varieties with superior traits and cultivating wheat varieties with superior traits. Among them, the superior trait is high thousand-grain weight.