Semi-dominant gene glk53 for controlling plant height of maize and application thereof
By identifying and utilizing the glk53-1 mutant of the GLK53 gene, designing specific primer sets for PCR amplification and sequencing, and screening individual plants carrying the glk53-1 mutant allele, the problem of low efficiency in improving maize plant height in existing technologies has been solved, and rapid and stable improvement of plant height and increase in biomass have been achieved.
Patent Information
- Application Number
- CN202610731426.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-26
- Publication Date
- 2026-06-26
Smart Images

Figure CN122279093A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of maize breeding technology, and specifically relates to a semi-dominant gene controlling maize plant height. GLK53 And its applications. Background Technology
[0002] Maize plant height is a key agronomic trait affecting yield formation and mechanized harvesting. In agricultural production, moderately increasing plant height helps improve biomass accumulation and photosynthetic efficiency, thereby enhancing yield potential. However, existing methods for increasing maize plant height have significant limitations.
[0003] Traditional hybridization breeding methods rely on phenotypic selection, requiring multiple generations of self-crossing and backcrossing to obtain stable, heritable height-improving lines. The breeding cycle typically takes 8-10 years, resulting in low efficiency and difficulty in precisely controlling the target trait. While marker-assisted selection (MAG) technology can shorten the breeding cycle, its application in height improvement primarily targets recessive genes. However, recessive genes require a homozygous state to express the target phenotype, limiting its direct application in hybrids.
[0004] Semi-dominant genes can express part of the target phenotype in the heterozygous state, theoretically making them more suitable for improving plant height in hybrids. However, there is currently a lack of plant height-related gene resources with stable semi-dominant inheritance characteristics, making it impossible to achieve a significant increase in plant height in the F1 generation of hybrids through simple parental replacement. In addition, existing technologies lack molecular marker systems capable of accurately identifying and selecting semi-dominant plant height genes, making it difficult to accurately screen target individual plants in the early stages of breeding.
[0005] In maize production, the main technical challenge faced by breeders is how to quickly and accurately introduce plant height improvement traits into superior inbred lines and ensure that this trait is stably expressed in the F1 generation of hybrids. Existing technologies cannot simultaneously meet the requirements of breeding efficiency, phenotypic stability, and ease of application, necessitating the development of a new method for improving maize plant height based on semi-dominant genes. Summary of the Invention
[0006] The purpose of this invention is to provide a semi-dominant gene for controlling maize plant height. GLK53 Its applications, through identification and utilization GLK53 Genetic glk53-1 The mutants significantly increased maize plant height and biomass, and this effect remained stably expressed in the F1 generation of the hybrids.
[0007] To achieve the above-mentioned objectives, the present invention adopts the following technical solution: This invention provides a method for identifying maize mutants E3693The primer set, wherein the primer set consists of an upstream primer with the sequence shown in SEQ ID NO. 3 and a downstream primer with the sequence shown in SEQ ID NO. 4; E3693 mutant GLK53 A mutation occurs 394 bp downstream of the start codon ATG, changing the gene from G to A. E3693 The mutant described GLK53 The nucleotide sequence after gene mutation is shown in SEQ ID NO.1; GLK53 The CDS sequence of the gene is shown in SEQ ID NO. 7.
[0008] The present invention also provides a method for identifying maize mutants. E3693 The detection kit contains the aforementioned primer set.
[0009] This invention also provides a method for identifying maize mutants. E3693 The method includes the following steps: S1. Extract genomic DNA from the maize plants to be tested; S2. Using the genomic DNA as a template, perform PCR amplification using the above-mentioned primer set; S3. Sequencing the PCR amplification products, if... GLK53 If the base 394 bp downstream of the start codon ATG is A, then it is a mutant. E3693 ; Among them, the GLK53 The CDS sequence of the gene is shown in SEQ ID NO.7.
[0010] This invention also provides an application of the above-mentioned primer set in improving the height of maize plants.
[0011] The present invention also provides a method for increasing the height of maize plants, comprising the following steps: (1) Provide GLK53 A maize mutant with a G / A point mutation occurring 394 bp downstream of the start codon ATG. glk53-1 ; (2) As stated glk53-1 The mutant was used as a parent and crossed with the target maize inbred line; (3) Molecular marker detection was performed on the hybrid offspring, and PCR amplification was carried out using the above primer set; (4) Choose to carry glk53-1 Single plants with mutated alleles; Among them, the GLK53 The CDS sequence of the gene is shown in SEQ ID NO.7.
[0012] Furthermore, the aforementioned GLK53 A G / A point mutation occurs 394 bp downstream of the start codon ATG, causing the transcript to change from wild-type T2 to mutant T1, and this mutation has a semi-dominant inheritance characteristic.
[0013] Furthermore, the mutant T1 transcript has 9 extra bases at the end of the second exon, corresponding to the insertion of three amino acids VVR inside the Myb DNA binding domain in the encoded amino acid sequence.
[0014] The beneficial effects of this invention are: The present invention provides glk53-1 The mutant exhibits semi-dominant genetic characteristics, is controlled by a single gene, and is easily controlled by marker-assisted selection. This mutant significantly increases maize plant height and biomass, and the height-enhancing effect is still stably expressed in F1 hybrids. Through marker-assisted selection, this mutation can be rapidly introduced into maize inbred lines with different genetic backgrounds, shortening the breeding cycle. The method of this invention is simple to operate, has significant effects, and is applicable to maize breeding practices. Attached Figure Description
[0015] Figure 1 Wild-type B73 (WT), mutant E3693 (Also known as: glk53-1 Allelic mutation glk53-2 as well as glk53-1 × glk53-2 The results include plant height, number of leaves, and fresh weight.
[0016] Figure 2 Wild-type B73 (WT) and B73× E3693 The plant height results are shown in the figure.
[0017] Figure 3 These are genomic regions related to maize plant height, identified using Mutmap.
[0018] Figure 4 for glk53-1 (A) and glk53-2 (B) Schematic diagram of mutation sites.
[0019] Figure 5 To identify wild-type B73 (WT) and mutant B73 using primer sets (SEQ ID NO.3, SEQ ID NO.4) via Sanger sequencing. E3693 ( glk53-1 The result graph.
[0020] Figure 6 for GLK53 A schematic diagram of the differentially expressed DNA sequences of gene T1 and T2 transcripts.
[0021] Figure 7The image shows the sequence alignment results of the GLK53 homologous protein with the differentially expressed GLK53-T1 and GLK53-T2 proteins.
[0022] Figure 8 for glk53-1 The results of plant height and fresh weight of hybrids of mutants with different genetic backgrounds are shown in the figure. Detailed Implementation
[0023] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.
[0024] The maize plant height-increasing mutant used in this invention E3693 (Named glk53-1) was obtained by EMS mutagenesis screening using B73 as background material, and its allelic mutant glk53-2 was obtained from the maize EMS mutant library (http: / / maizeems.qlnu.edu.cn / ).
[0025] Example 1: Mutant E3693 Phenotypic analysis Wild-type B73 (WT), mutant E3693 (Also known as: glk53-1 Allelic mutation glk53-2 as well as glk53-1 and glk53-2 After self-pollination, plants were sown in the field at the same time, with a row length of 5m and a plant spacing of 0.25m. Plant height, total number of leaves, and fresh weight were all calculated using 10 plants per plant. Regarding the total number of leaves, the number of leaves was counted once during stage V8, and the position of the 7th leaf was marked; at pollen shedding stage, the total number of leaves was counted based on the position of the 7th leaf. Plant height was also counted at pollen shedding stage. Fresh weight was measured 26 days after pollen shedding. One-way ANOVA was performed using SPSS 25.0 software, and significance was tested using Duncan's multiple comparison method (P < 0.01).
[0026] The results showed that ( Figure 1 ), glk53-1 , glk53-2 as well as glk53-1 × glk53-2 The plant height increased by 25.84%, 24.83%, and 30.09% compared to B73, respectively; the total number of leaves increased by 3.4, 3.8, and 3.4, respectively; and the number of fresh seeds increased by 15.06%, 13.14%, and 24.39%, respectively, all showing significant differences. P <0.01).
[0027] Example 2: Mutant E3693 Genetic characteristics analysis For investigation E3693The genetic characteristics and location-related genes of (also known as: glk53-1) will be analyzed. E3693 The mutant was crossed with the background inbred line B73 to obtain the F1 generation. F1 plants were sown in Langfang, Hebei Province (39.5°N, 116.7°E). The F1 plant height was significantly increased by approximately 13.28% compared to B73 (P<0.01), indicating that the mutant... E3693 The gene that determines plant height phenotype has a semi-dominant effect. Figure 2 ).
[0028] F1 generation was self-pollinated to construct F2 generation segregating populations. Over 800 F2 generation individual plants were sown in Sanya, Hainan (18.4°N, 109.2°E). Plant height phenotype was analyzed after all individual plants shed pollen. Because the plant height difference between B73 and F1 was small, it was difficult to clearly distinguish them in the F2 population. Therefore, the number of short-statured individual plants with plant heights close to B73 or F1 generation was counted, as well as the number of plants with similar heights... E3693 The ratio of tall to short plants was 603:192, χ²=0.41, P>0.05, consistent with a 3:1 segregation ratio, indicating that a single gene controls the growth of tall plants. E3693 Plant height phenotype.
[0029] Example 3: Mutant E3693 Gene positioning The F2 population constructed in the above embodiment has E3693 From the leaves of F2 individual plants, 20 leaf aliquots of DNA were extracted. 1 μL of the DNA solution was subjected to 1% agarose gel electrophoresis for DNA quality testing. After passing quality control, the concentration of each DNA solution was determined and the aliquots were mixed in equal quantities, with a concentration not less than 25 ng / μL and a volume not less than 50 μL. Libraries were constructed using the F2 individual plant DNA pool and the B73 DNA control, followed by next-generation high-throughput sequencing. After quality control analysis, the sequencing data were aligned and assembled with the maize B73V4.32 genome. SNP site statistical analysis was performed using the Mutmap localization analysis package.
[0030] First, SNPs were screened based on the G→A (or C→T) base transition type, with an SNP-Index of 1.0 as the threshold. Subsequently, functional impact analysis was performed on the screened SNPs, including assessing whether they caused premature transcription termination or loss of the stop codon, whether they affected splice site donor / receptor, whether they caused gain or loss of the start codon ATG, and whether they led to nonsynonymous mutations. Simultaneously, the average SNP-Index value was calculated in 3 Mb windows, and its distribution along chromosome positions was mapped to screen for major-effect SNP sites.
[0031] Following the above method, 9817 SNPs with GA or CT mutations were obtained through next-generation sequencing, with 623 sites having an SNP index > 0.9. A significant signal peak was found on chromosome 5. Figure 3 Within this interval, there are 11 SNP sites with nonsynonymous mutations.
[0032] For these 11 SNPs, 140 F2 plants with increased plant height were selected, and further validation of these sites was performed using Sanger sequencing. Of these 11 SNPs, only one SNP was entirely mutant in all 140 plants with increased plant height, located at... GLK53 The gene (whose CDS sequence is shown in SEQ ID NO.7) undergoes a mutation from G to A 394 bp downstream of the start codon ATG. glk53-1 Therefore, it was further confirmed that this site is the mutation site that leads to the increased plant height phenotype. Figure 4 A).
[0033] To further validate the localization results, we obtained another allelic mutant containing a premature termination mutation from the maize EMS mutant library (http: / / maizeems.qlnu.edu.cn / ). glk53-2 The mutation site is located 149 bp from the start codon, where G is mutated to A, forming a premature stop codon tAg. Figure 4 B).
[0034] Example 4: Wild type and mutant E3693 Molecular marker design Wild-type B73 and mutant were extracted separately. E3693 The genomic DNA, after passing quality testing by electrophoresis, was used for subsequent PCR analysis. E3693 mutant GLK53 The gene (whose CDS sequence is shown in SEQ ID NO.7) undergoes a mutation from G to A 394 bp downstream of the start codon ATG (the nucleotide sequence after the mutation is shown in SEQ ID NO.1). Based on this mutation site, specific primers were designed, and the amplification sequence is shown in SEQ ID NO.2. The primer sequences are as follows: SEQ ID NO.3: 885-F:TGAAGCACCTAACGTACGGA; SEQ ID NO. 4: 886-R: GCGCGGGGAGAATAGTAGAC.
[0035] Using PCR amplification technology, specific primers were used to amplify wild-type B73 and... E3693The PCR system was prepared according to the instructions, and PCR amplification was performed under the recommended expansion conditions. After the PCR reaction, 1% agarose gel electrophoresis was used for detection. The product size was consistent with the theoretical fragment size, the product specificity was high, and there were no impurity bands. The PCR product was sent to a biosequencing company for sequencing. The sequencing results were analyzed for mutation sites using Sequencher software, and the results showed that... E3693 The mutant has an A base at the mutation site, while the wild type (B73) has a G base at the corresponding site. Figure 5 This indicates that the marker can identify wild-type and mutant genotypes and can be used for molecular identification aids in molecular breeding.
[0036] Example 5: GLK53 Gene cloning Take B73 under normal growth conditions and E3693 Leaves from the V3 stage of inbred line were flash-frozen in liquid nitrogen and stored at -80℃. Total RNA was extracted from the leaves using the Full Gold Plant RNA Extraction Kit (ER302) according to the instructions. The extracted RNA was reverse transcribed using the Full Gold First-Strand cDNA Synthesis Kit (AE311) and used as a template for the PCR system. Primers 907-F / 908-R were designed, and the PCR system and recommended extension conditions were prepared using Novizan High Fidelity DNA Polymerase (P501) according to the instructions to amplify the GLK53 coding sequence. The primer sequences are as follows: SEQ ID NO.5:907-F:ATGTTCCTTCCAAGAAGGCCACTAG; SEQ ID NO. 6:908-R: TTACCCGTAGGACAGGTTCCTCGTCT.
[0037] After PCR products were separated by 1% agarose gel electrophoresis, the target band was excised. The DNA fragments were purified using a complete gold gel extraction kit (EG101) according to the instructions. B73 and... E3693 The amplified product was recovered and ligated into the pEASY-Blunt Cloning vector (CB111), which was then transformed into pEASY Trans1-T1 competent cells (CD501). The cells were plated on LB agar plates containing the corresponding antibiotics and incubated overnight at 37°C. Positive clones were identified by colony PCR, and single clones were selected and cultured in LB liquid medium containing the corresponding antibiotics. The sequences were confirmed by Sanger sequencing.
[0038] The GLK53 gene was successfully cloned from a cDNA library obtained using B73 reverse transcription. Seventeen single clones were taken, sequenced by Sanger sequencing, and compared with sequences in the NCBI database. The results showed that all sequences were T2 transcripts. E3693The cDNA library obtained from reverse transcription was sequenced by Sanger sequencing of 15 single clones, of which 14 clones contained mutant T1 transcript sequences and 1 clone contained a T2 transcript sequence. These results indicate... E3693 ( glk53-1 The mutations that occurred in the T1 transcript significantly reduced the abundance of the T2 transcript in the wild type, while simultaneously causing the accumulation of the T1 transcript. The main difference between the T1 and T2 transcripts is that the T1 transcript has 9 extra bases at the end of the second exon; otherwise, the T1 and T2 transcripts are completely identical. Figure 6 ) We compared them. GLK53 Homologous genes were discovered in Arabidopsis and maize. GLK53 It has a conserved Myb DNA-binding domain ( Figure 7 The 3-amino acid sequence VVR, corresponding to the 9 bases unique to the T1 sequence, is located inside the conserved Myb DNA-binding domain. Figure 7 This may disrupt GLK53's ability to bind to downstream genes, thus leading to the emergence of the plant height phenotype.
[0039] Example 6: Mutant E3693 Breeding applications E3693 Increasing plant height has a semi-dominant genetic characteristic, in order to verify... E3693 The effect of B73 on enhancing plant height under different genetic backgrounds was investigated using B73 and... E3693 As the male parent, it was crossed with the backbone inbred lines Zheng 58 and PH6WC respectively to obtain B73 × Zheng 58. E3693 ×Zheng58, and B73×PH6WC, E3693 The F1 generation of ×PH6WC was used, and the F1 generation of these combinations was sown in Langfang, Hebei Province for phenotypic identification. The results showed that... E3693 The plant height of ×Zheng58 was significantly increased by approximately 5.71% compared to B73×Zheng58 (P<0.01), and the fresh weight of the whole plant was significantly increased by approximately 13.26% (P<0.05). Figure 8 ). E3693 The plant height and fresh weight of ×PH6WC increased by 10.07% and 15.27% respectively compared with B73×PH6WC at a significant level of P<0.01. Figure 8 ),show E3693 The semi-dominant effect of plant height can be applied to inbred lines with different genetic backgrounds.
Claims
1. A method for identifying maize mutants E3693 The primer set is characterized by, The primer set consists of an upstream primer with the sequence shown in SEQ ID NO. 3 and a downstream primer with the sequence shown in SEQ ID NO. 4; E3693 mutant GLK53 A mutation occurs 394 bp downstream of the start codon ATG, changing the gene from G to A. E3693 The mutant described GLK53 The nucleotide sequence after gene mutation is shown in SEQ ID NO.1; GLK53 The CDS sequence of the gene is shown in SEQ ID NO.
7.
2. A method for identifying maize mutants E3693 The detection kit is characterized by, The kit contains the primer set as described in claim 1.
3. A method for identifying maize mutants E3693 The method is characterized by, Includes the following steps: S1. Extract genomic DNA from the maize plants to be tested; S2. Using the genomic DNA as a template, perform PCR amplification using the primer set described in claim 1; S3. Sequencing the PCR amplification products, if... GLK53 If the base 394 bp downstream of the start codon ATG is A, then it is a mutant. E3693 ; Among them, the GLK53 The CDS sequence of the gene is shown in SEQ ID NO.
7.
4. The application of the primer set of claim 1 in improving the height of maize plants.
5. A method for increasing the height of maize plants, characterized in that, Includes the following steps: (1) Provide GLK53 A maize mutant with a G / A point mutation occurring 394 bp downstream of the start codon ATG. glk53-1 ; (2) with glk53-1 The mutant was used as a parent and crossed with the target maize inbred line; (3) Molecular marker detection was performed on the hybrid offspring, and PCR amplification was performed using the primer set described in claim 1; (4) Choose to carry glk53-1 Single plants with mutated alleles; Among them, the GLK53 The CDS sequence of the gene is shown in SEQ ID NO.
7.
6. The method according to claim 5, characterized in that, The GLK53 A G / A point mutation occurs 394 bp downstream of the start codon ATG, causing the transcript to change from wild-type T2 to mutant T1, and this mutation has a semi-dominant inheritance characteristic.
7. The method according to claim 5, characterized in that, The mutant T1 transcript has 9 extra bases at the end of the second exon, corresponding to the insertion of three amino acids VVR inside the Myb DNA binding domain in the encoded amino acid sequence.