Molecular marker related to drought resistance of alfalfa on chromosome 6 and application thereof

Abstract

This invention provides a molecular marker located on chromosome 6 associated with drought resistance in alfalfa and its application, belonging to the field of biotechnology. The molecular marker is located on chromosome 6 of alfalfa, and the nucleotide sequence of the inserted or deleted segment is shown in SEQ ID NO. 3. The primer pair used to amplify the InDel molecular marker has nucleotide sequences shown in SEQ ID NO. 1-2. The InDel molecular marker and its primer pair described in this invention can identify or assist in the identification of drought resistance traits in alfalfa. This invention also provides a method for rapidly identifying drought resistance in alfalfa using the InDel molecular marker; this method is simple, fast, and provides accurate results, with good prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker located on chromosome 6 that is associated with drought resistance in alfalfa and its application. Technical Background

[0002] In the breeding process, the selection of target traits is heavily influenced by genotype and phenotype. Traditional breeding relies on the identification and evaluation of plant appearance characteristics, but this is subject to certain limitations. Traditional methods are time-consuming, requiring years of observation and breeding to determine the genetic stability of the target trait. Furthermore, appearance characteristics are easily affected by the environment, leading to uncertain results. Molecular marker-assisted selection technology, however, demonstrates unique advantages in breeding practice. By utilizing the association between genetic markers and target traits, individuals or genotypes possessing the target trait can be identified more accurately and quickly. By analyzing molecular markers in the genome, breeders can better understand the relationship between genotype and traits, thus more precisely selecting individuals with superior traits for propagation.

[0003] Genome-wide association analysis (GWAS) has garnered significant attention in the field of breeding. By analyzing the associations between numerous genetic markers and target traits, key genes or loci associated with these traits can be identified. The development and application of this technology has become a major focus and area of ​​competition in the current breeding field. Drought-resistant breeding of alfalfa (Medicago sativa L.) is crucial for improving crop drought tolerance, increasing yield, and reducing resource consumption. Against the backdrop of climate change and increasing water scarcity, developing drought-resistant varieties can enhance crop adaptability to drought conditions, reduce disaster risks, maintain agricultural production stability, promote sustainable agricultural development, and increase economic benefits for farmers. This is also of great significance for ensuring food security and the continuous improvement of the ecological environment. Alfalfa breeding started relatively late, and reports on the development and mapping of drought-resistant markers using GWAS are very limited. Therefore, the development of alfalfa drought-resistant molecular markers is of great importance for constructing assisted selection breeding systems, improving germplasm resources, and breeding new varieties. Summary of the Invention

[0004] One of the objectives of this invention is to provide an InDel molecular marker associated with drought resistance in alfalfa.

[0005] The second objective of this invention is to provide the application of the InDel molecular markers mentioned above that are related to drought resistance in alfalfa.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The drought resistance-related InDel molecular marker disclosed in this invention is located on chromosome 6 of alfalfa and is named Ms_Chr6_52997265.

[0008] Primer pairs were used to amplify the InDel molecular marker associated with drought resistance in alfalfa. The primer pair sequence corresponding to the molecular marker Ms_Chr6_52997265 is as follows:

[0009] Ms_Chr6_52997265-F: CGTGCAACGAACAAGCCAC (as shown in SEQ ID NO.1);

[0010] Ms_Chr6_52997265-R: GGATCAAATACATATTTAACATTCAAATATAA (shown in SEQ ID NO. 2).

[0011] This invention also discloses the application of the above-mentioned molecular marker primer pairs in drought-resistant assisted breeding of alfalfa. That is, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, drought-resistant traits in alfalfa varieties can be identified. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0012] This invention also discloses the application of the above-mentioned molecular markers in identifying drought resistance traits in alfalfa, especially in screening and identifying the level of drought resistance in alfalfa. Specifically, the specific steps for identifying whether alfalfa has drought resistance traits are as follows:

[0013] (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Ms_Chr6_52997265. The PCR amplification reaction system is shown in Table 1:

[0014] Table 1. Reaction system for PCR amplification

[0015]

[0016] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 59℃ for 30 s, extension at 72℃ for 20 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.

[0017] (2) Detection of PCR products by agarose gel electrophoresis: Take 3 μL and judge the drought resistance of alfalfa based on the band results.

[0018] PCR amplification was performed using primers Ms_Chr6_52997265-F and Ms_Chr6_52997265-R. If the PCR amplification product contained only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa was drought-sensitive. If the PCR amplification product contained both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 257 bp as shown in SEQ ID NO.5, then the alfalfa was drought-resistant.

[0019] In addition, this invention also protects a kit for identifying drought resistance traits in alfalfa, the kit containing primer pairs Ms_Chr6_52997265-F and Ms_Chr6_52997265-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0020] The kit of this invention can rapidly identify drought-resistant traits in alfalfa and also rapidly identify drought-resistant genotypes in alfalfa. The specific method follows the steps for identifying whether alfalfa possesses drought-resistant traits. By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product contains only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa is homozygous for drought-resistant genotypes; if the PCR amplification product contains both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 257 bp as shown in SEQ ID NO.5, then the alfalfa is heterozygous for drought-resistant genotypes.

[0021] The present invention has the following advantages:

[0022] (1) The inventors of this invention screened out a molecular marker Ms_Chr6_52997265 that is associated with drought resistance in alfalfa. This molecular marker is located on chromosome 6. Using the molecular marker Ms_Chr6_52997265 of this invention, the drought resistance trait of alfalfa can be quickly and accurately identified.

[0023] (2) Using markers linked to drought resistance traits for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0024] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied to alfalfa drought-resistant breeding practice and variety identification in a simple, rapid and high-throughput manner. Attached Figure Description

[0025] Figure 1 The genome-wide association analysis results for drought tolerance in alfalfa are based on the Manhattan plot obtained using EMMAX software. The green dots indicate the InDel positions associated in this invention.

[0026] Figure 2 This is a box plot showing the drought resistance index distribution of the Ms_Chr6_52997265 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates a homozygous drought-sensitive genotype at the Ms_Chr6_52997265 locus, and 0 / 1 indicates a heterozygous drought-resistant genotype at the Ms_Chr6_52997265 locus. Dots represent extreme values, and **** represents P < 0.0001.

[0027] Figure 3 This is a partial sequence alignment result between drought-resistant and drought-sensitive varieties in the drought-resistant association region.

[0028] Figure 4 Electrophoresis images of molecular markers amplified from 23 alfalfa germplasm resources, using agarose gels with a concentration of 2%.

[0029] In the diagram, M represents a DNA marker. Detailed Implementation

[0030] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0031] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0033] Example 1: Development of molecular markers related to drought resistance in alfalfa

[0034] This invention uses the alfalfa drought resistance index (DRI) to measure the drought resistance of alfalfa. A higher DRI indicates greater drought resistance, while a lower DRI indicates less drought resistance (sensitivity to drought). After measuring the DRI in an alfalfa population, GWAS analysis located an InDel locus in the alfalfa. Figure 1 The green locus, named Ms_Chr6_52997265, is located at locus 52997265 on chromosome 6 of the alfalfa reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 0 / 1. A box plot showing the drought resistance index distribution corresponding to the genotypes at locus Ms_Chr6_52997265 in the population is also provided. Figure 2 This indicates that alfalfa lines with genotype 0 / 1 exhibit significantly higher drought tolerance than those with genotype 0 / 0. An insertion / deletion fragment TTTAGTATATGGAGGCCGAAGTGGGGTGATCGACATGATTGC (shown in SEQ ID NO. 3) is present at locus 52997265 on chromosome 6 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the drought resistance of alfalfa. Alfalfa with the fragment shown in SEQ ID NO.3 inserted is drought-sensitive alfalfa; alfalfa without the fragment shown in SEQ ID NO.3 is drought-resistant alfalfa.

[0035] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Primer 5.0 software:

[0036] Ms_Chr6_52997265-F: CGTGCAACGAACAAGCCAC (as shown in SEQ ID NO.1);

[0037] Ms_Chr6_52997265-R: GGATCAAATACATATTTAACATTCAAATATAA (shown in SEQ ID NO. 2).

[0038] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous drought-sensitive alfalfa sample had only a 300bp characteristic band, while the PCR product of the heterozygous drought-resistant alfalfa sample had both a 300bp characteristic band and a 257bp characteristic band.

[0039] Example 2: Accuracy verification of the molecular markers described in this invention

[0040] 170 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0041] Table 2. Drought resistance of 170 germplasm materials and genotypes corresponding to the Chr6_52997265 locus.

[0042]

[0043]

[0044]

[0045] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0046] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×Taq PCR Master Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 2% agarose gel. After loading, the samples are electrophoresed at 140V DC for 2 h, and the PCR banding patterns of each sample are then read.

[0047] 2) Determine the drought resistance of alfalfa based on the size of the PCR product: When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is a drought-resistant alfalfa.

[0048] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is drought-sensitive alfalfa.

[0049] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 300bp (SEQ ID NO.4), then the alfalfa to be identified is drought-sensitive alfalfa.

[0050] The sequence of SEQ ID NO.4 is as follows:

[0051]

[0052] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 257bp (SEQ ID NO.5), then the alfalfa to be identified is a drought-resistant alfalfa.

[0053] The sequence of SEQ ID NO.5 is as follows:

[0054]

[0055] If the PCR product of the alfalfa to be identified consists of two bands, one with the inserted fragment shown in SEQ ID NO.3 and the other with the deleted fragment shown in SEQ ID NO.3, and one band is 300 bp in length and the other is 257 bp, then the alfalfa to be identified is a heterozygous drought-resistant alfalfa.

[0056] Furthermore, Table 2 shows that among the 170 alfalfa germplasm accessions identified in this study, 147 accessions had the genotype 0 / 0. These 147 accessions had an average drought resistance index of 1.0353, classifying them as drought-sensitive alfalfa. The remaining 23 accessions had the genotype 0 / 1. These 23 accessions had an average drought resistance index of 1.9419, classifying them as drought-resistant alfalfa, which was 0.9066 higher than the average of the 147 drought-sensitive accessions. Analysis of variance showed a highly significant difference in drought resistance index between the drought-sensitive and drought-resistant types (P < 0.0001). Nineteen germplasm accessions ('Beilin 201', 'CF031928', 'W639947', 'Zhonglan No. 1', 'Xinmu No. 4', 'CF020828', 'Naiyanzhixing', 'CF050068', 'Ranger', 'CF050248', 'Suntory', 'Grassland No. 1', 'CF040145', 'Apex', 'Pioneer', 'Thunder', 'Longmu 806', 'CF039769', 'Huaiyang No. 4', 'WL440HQ') were selected for PCR testing. The test results were consistent with the genotype and the actual drought resistance index determination results. Figure 4 Therefore, the InDel molecular marker of the present invention can effectively identify the drought resistance of alfalfa and can be used for the prediction and screening of drought-resistant alfalfa varieties.

[0057] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker located on chromosome 6 associated with drought resistance in alfalfa, characterized by, The nucleotide sequences of the molecular marker are shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 6 of the alfalfa reference genome. The primer pair sequences for amplifying the molecular marker are as follows: Ms_Chr6_52997265-F: CGTGCAACGAACAAGCCAC; Ms_Chr6_52997265-R:GGATCAAATACATATTTAACATTCAAATATAA.

2. The application of the primer pair of the molecular marker described in claim 1 in the identification or auxiliary identification of drought resistance traits in alfalfa.

3. A method for identifying drought resistance traits in alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination is based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr6_52997265-F and Ms_Chr6_52997265-R. If the PCR amplification product contained only one characteristic band of 300 bp as shown in SEQ ID NO.4, then the alfalfa was drought-sensitive. If the PCR amplification product contained both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 257 bp as shown in SEQ ID NO.5, then the alfalfa was drought-resistant.

4. An application of a reagent kit in identifying drought-resistant genotypes in alfalfa, characterized in that, The kit contains primer pairs for the molecular markers described in claim 1. The method for identifying the drought-resistant genotype of alfalfa using the kit is as follows: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification products have only one characteristic band of 300 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous drought-sensitive genotype; if the PCR amplification products have both one characteristic band of 300 bp as shown in SEQ ID NO.4 and one characteristic band of 257 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous drought-resistant genotype.

Images