Preparation method and application of post-fermentation raw material powder of Pediococcus acidilactici IOB701

Abstract

The present invention provides a preparation method and application of post-fermentation biotic powder of Pediococcus acidilactici IOB701, which relates to the field of microorganisms. The Pediococcus acidilactici IOB701 was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on July 10, 2018, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 16077. Pediococcus acidilactici IOB701 is fermented in cereals or beans treated with hypoxia stress as a culture medium, and the obtained post-fermentation biotic powder of Pediococcus acidilactici IOB701 can improve the depressive-like behavior of mice subjected to chronic unpredictable mild stimulation.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to a preparation method and application of biotic powder obtained by fermentation of Pediococcus acidilactici IOB701. Background Art

[0002] GABA is a natural non-protein amino acid and the main inhibitory neurotransmitter in the central nervous system. It is associated with a variety of neurological and psychiatric diseases such as anxiety, depression, and schizophrenia. Studies have shown that the occurrence of depression is closely related to central GABA functional defects. GABA is widely distributed in food crops, such as broad beans, buckwheat, and brown rice, but the current GABA content is still low.

[0003] Studies have shown that there is a certain correlation between depression and gastrointestinal dysfunction, and gastrointestinal dysfunction is mostly caused by an imbalance of intestinal flora. The intestinal flora can achieve two-way communication with the brain through direct and indirect pathways such as neurotransmitters, immune signals and metabolites. Therefore, the intestinal flora is expected to become a new target for the treatment and improvement of emotional health diseases such as depression.

[0004] In recent years, consumers have shown a strong interest in health foods containing probiotics. However, the application of probiotics in food faces major technical challenges. During industrial processing, factors such as processing and storage conditions (time, temperature, etc.) may reduce the vitality of probiotics. Inactivated probiotics are not the same as dead bacteria. Dead bacteria are broken bacterial cells, which have no complete structure and lose their efficacy. Inactivated probiotics are bacteria that retain the original structure and characteristics of probiotics through special inactivation technology, but do not have the ability to grow and reproduce. In May 2021, the International Scientific Association of Probiotics and Prebiotics clarified the definition and scope of postbiotics: postbiotics refer to preparations of inanimate microorganisms and / or other ingredients that are beneficial to the health of the host, not purified microbial metabolites and vaccines. Compared with probiotic products, postbiotic products can not only simulate the health benefits of probiotics, but also have good safety and allow addition before heat treatment, and the advantages of maintaining stable product properties during storage and transportation.

[0005] For this reason, in-depth research and development of a probiotic postbiotic powder that can enrich γ-aminobutyric acid in large quantities will have important value and great help for emotional health and regulation, and will have a positive effect on the improvement of depression. Summary of the invention

[0006] In view of the technical problems existing in the prior art, the present invention aims to provide a preparation method and application of post-fermentation biotic powder of Pediococcus acidilactici IOB701.

[0007] One of the purposes of the present invention is to provide a method for preparing post-fermentation biotic powder of Pediococcus acidilactici IOB701, the preparation method comprising the following steps:

[0008] (1) Cereals or beans are subjected to hypoxia stress and sterilization;

[0009] (2) first activating the lactic acid Pediococcus IOB701 strain to obtain a slant strain, and then preparing a seed solution of the lactic acid Pediococcus IOB701;

[0010] (3) The seed liquid of Pediococcus acidilactici IOB701 is inoculated on cereals or beans that have been subjected to hypoxia stress and sterilization for fermentation. The obtained fermentation product is inactivated, dried, and crushed to obtain Pediococcus acidilactici IOB701 fermentation postbiotic powder.

[0011] Preferably, the hypoxia stress and sterilization treatment comprises:

[0012] First, wash the grains or beans with distilled water to remove impurities and dust, disinfect them with 1% sodium hypochlorite solution by volume for 30 minutes, wash the residual sodium hypochlorite with distilled water, soak them in clean water for 6-8 hours, and the soaking temperature is 24-26℃. After soaking, take them out and drain the water, place them in an incubator away from light for 48-72 hours, keep the relative humidity above 95%, and the ventilation volume is 1.0L / min-1.2L / min. After the incubation is completed, sterilize them at 121℃ for 20 minutes.

[0013] Preferably, the cereals include brown rice, corn, oats, wheat or barley; the beans include soybeans, mung beans, broad beans, chickpeas or lentils.

[0014] Preferably, the strain activation is to inoculate the Pediococcus acidilactici IOB701 in the cryopreservation tube into a slant culture medium, the temperature is set at 36-38° C., and the activation time is 18-22 hours.

[0015] Preferably, the slant medium formula is: peptone 10.0 g, beef extract 10.0 g, yeast extract 5.0 g, glucose 20.0 g, Tween 80 1.0 mL, dipotassium hydrogen phosphate 2.0 g, sodium acetate 5.0 g, ammonium citrate 2.0 g, magnesium sulfate (7H 2 O) 0.2 g, manganese sulfate (1H 2 O) 0.05g, agar 15.0g, pH=6.0~6.4, and the amount of water added is 1L.

[0016] Preferably, the method for preparing the seed solution of Pediococcus acidilactici IOB701 comprises: taking fresh slant strains and inoculating them into a basic culture medium for the seed solution, maintaining the temperature at 35-39° C., and conducting a closed static culture for 18-22 hours.

[0017] Preferably, the basic medium formula of the seed solution is: peptone 10.0g, beef extract 10.0g, yeast extract 5.0g, glucose 20.0g, Tween 80 1.0mL, dipotassium hydrogen phosphate 2.0g, sodium acetate 5.0g, ammonium citrate 2.0g, magnesium sulfate (7H 2 O) 0.2 g, manganese sulfate (1H 2 O) 0.05g, pH = 6.0 ~ 6.4, the amount of water added is 1L.

[0018] Preferably, the inoculation amount in step (3) is 8-12%, the fermentation temperature is 34-38°C, the culture is kept in a closed state, the culture time is 22-26 hours, and the activity of the fermentation product finally obtained is 1×10 8 CFU / g After the culture was completed, it was inactivated by treating at 115℃ for 30min.

[0019] The second object of the present invention is to provide an application of post-fermentation biotic powder of Pediococcus acidilactici IOB701 in the preparation of medicines for improving emotional health.

[0020] The third object of the present invention is to provide an application of a post-fermentation raw material powder of Pediococcus acidilactici IOB701 in food or health products.

[0021] Beneficial effects of the present invention:

[0022] The invention provides a method for preparing postbiotic powder fermented by Pediococcus acidilactici IOB701. The method uses cereals or beans treated with hypoxia stress as a fermentation medium to ferment Pediococcus acidilactici IOB701, and then prepares the postbiotic powder. The content of gamma-aminobutyric acid in the postbiotic powder is 312.52 mg / 100 g, which is 26.53 times the content of gamma-aminobutyric acid in broad beans that have not been treated with hypoxia stress. Through hypoxia stress treatment, γ-aminobutyric acid in cereals or beans is enriched for the first time, and the γ-aminobutyric acid content in broad beans that are only treated with hypoxia stress is 8.96 times that of broad beans that are not treated with hypoxia stress. This is then used as a fermentation medium to ferment lactic acid Pediococcus acidilactici IOB701, so that γ-aminobutyric acid is enriched for the second time. The γ-aminobutyric acid content of the fermented lactic acid Pediococcus acidilactici IOB701 postbiotic powder obtained by using the broad bean fermentation medium that is not treated with hypoxia stress is 12.34 times that of the γ-aminobutyric acid content in broad beans that are not treated with hypoxia stress. Therefore, the culture medium obtained by treating cereals or beans with hypoxia stress and the fermentation of Pediococcus acidilactici IOB701 can both produce γ-aminobutyric acid, and the two have a synergistic effect, and can enrich γ-aminobutyric acid in large quantities. The obtained postbiotic powder is used to prepare antidepressant drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 GABA content;

[0024] Figure 2 Results of the forced swim test;

[0025] Figure 3 Open field test results;

[0026] Figure 4 Mouse liver index;

[0027] Figure 5 Serum and hippocampal γ-aminobutyric acid levels in mice;

[0028] Figure 6 Changes in the ratio of kynurenine (KYN) to tryptophan (TRP) in mouse serum;

[0029] Figure 7 Changes in corticotropin-releasing hormone (CRH) content in the mouse hypothalamus;

[0030] Figure 8 Changes in adrenocorticotropic hormone (ACTH) content in the hypothalamus of mice;

[0031] Fig. 9 Changes in hypothalamic corticosterone (CORT) content in mice;

[0032] Fig.10 The content of inflammatory factor IL-1β in mouse serum;

[0033] Fig.11 The content of inflammatory factor IL-10 in mouse serum;

[0034] Fig.12 Changes in abundance of mouse microbiota (phylum level);

[0035] Fig.13 Mouse microbiota abundance ratio (Firmicutes / Bacteroidetes);

[0036] Fig.14 Heat map of mouse gut microbiota correlation (gate level).

[0037] The lactic acid Pediococcus IOB701 of the present invention is classified and named as lactic acid Pediococcus Pediococcus acidilactici It was deposited on July 10, 2018 in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.16077. DETAILED DESCRIPTION

[0038] According to a first aspect of the present invention, a method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 is provided, the preparation method comprising the following steps:

[0039] (1) Cereals or beans are subjected to hypoxia stress and sterilization;

[0040] (2) first activating the lactic acid Pediococcus IOB701 strain to obtain a slant strain, and then preparing a seed solution of the lactic acid Pediococcus IOB701;

[0041] (3) The seed liquid of Pediococcus acidilactici IOB701 is inoculated on cereals or beans that have been subjected to hypoxia stress and sterilization for fermentation. The obtained fermentation product is inactivated, dried, and crushed to obtain Pediococcus acidilactici IOB701 fermentation postbiotic powder.

[0042] In a preferred embodiment of the present invention, the hypoxia stress and sterilization treatment comprises:

[0043] First, wash the grains or beans with distilled water to remove impurities and dust, disinfect them with 1% sodium hypochlorite solution by volume for 30 minutes, wash the residual sodium hypochlorite with distilled water, soak them in clean water for 6-8 hours, and the soaking temperature is 24-26℃. After soaking, take them out and drain the water, place them in an incubator away from light for 48-72 hours, keep the relative humidity above 95%, and the ventilation volume is 1.0L / min-1.2L / min. After the incubation is completed, sterilize them at 121℃ for 20 minutes.

[0044] In a preferred embodiment of the present invention, the cereals include brown rice, corn, oats, wheat or barley; the beans include soybeans, mung beans, broad beans, chickpeas or lentils.

[0045] In the present invention, the cereals are, for example, brown rice, corn, oats, wheat or barley; the beans are, for example, soybeans, mung beans, broad beans, chickpeas or lentils.

[0046] In a preferred embodiment of the present invention, the strain activation is to inoculate the Pediococcus acidilactici IOB701 in the cryopreservation tube into a slant culture medium, the temperature is set to 36-38° C., and the activation time is 18-22 hours.

[0047] In a preferred embodiment of the present invention, the slant medium formula is: peptone 10.0g, beef extract 10.0g, yeast extract 5.0g, glucose 20.0g, Tween 80 1.0mL, dipotassium hydrogen phosphate 2.0g, sodium acetate 5.0g, ammonium citrate 2.0g, magnesium sulfate (7H 2 O) 0.2 g, manganese sulfate (1H 2 O) 0.05g, agar 15.0g, pH=6.0~6.4, and the amount of water added is 1L.

[0048] In a preferred embodiment of the present invention, the method for preparing the seed solution of Pediococcus acidilactici IOB701 comprises: taking fresh slant strains and inoculating them into a basic culture medium for seed solution, maintaining the temperature at 35-39° C., and conducting closed static culture for 18-22 hours.

[0049] In a preferred embodiment of the present invention, the seed liquid basic culture medium formula is: peptone 10.0g, beef extract 10.0g, yeast extract 5.0g, glucose 20.0g, Tween 80 1.0mL, dipotassium hydrogen phosphate 2.0g, sodium acetate 5.0g, ammonium citrate 2.0g, magnesium sulfate (7H 2 O) 0.2 g, manganese sulfate (1H 2 O) 0.05g, pH = 6.0 ~ 6.4, the amount of water added is 1L.

[0050] In a preferred embodiment of the present invention, the inoculation amount in step (3) is 8-12%, the fermentation temperature is 34-38°C, the closed static culture is carried out, and the culture time is 22-26 hours. The activity of the fermentation product finally obtained is 1×10 8 CFU / g After the culture was completed, it was inactivated by treating at 115℃ for 30min.

[0051] According to a second aspect of the present invention, there is provided a use of post-fermentation biotic powder of Pediococcus acidilactici IOB701 in the preparation of medicines for improving emotional health.

[0052] According to a third aspect of the present invention, there is provided an application of a post-fermentation biotic powder of Pediococcus acidilactici IOB701 in food or health products.

[0053] In the present invention, the 16s rRNA sequencing sequence of the Pediococcus acidilactici IOB701 is:

[0054] TCGAACGAAC TTCCGTTAAT TGATTATGAC GTGCTTGCAC TGAATGAGAT

[0055] TTTAACACGA AGTGAGTGGC GGACGGGTGA GTAACACGTG GGTAACCTGC

[0056] CCAGAAGCAG GGGATAACAC CTGGAAACAG ATGCTAATAC CGTATAACAG

[0057] AGAAAACCGC CTGGTTTTCT TTTAAAAGAT GGCTCTGCTA TCACTTCTGG

[0058] ATGGACCCGC GGCGCATTAG CTAGTTGGTG AGGTAACGGC TCACCAAGGC

[0059] GATGATGCGT AGCCGACCTG AGGGTAAT CGGCCACATT GGGACTGAGA

[0060] CACGGCCCAG ACTCCTACGG GAGGCAGCAG TAGGGAATCT TCCACAATGG

[0061] ACGCAAGTCT GATGGAGCAA CGCCGCGTGA GTGAAGAAGG GTTTCGGCTC

[0062] GTAAAGCTCT GTTGTTAAAG AAGAACGTGG GTGAGAGTAA CTGTTCACCC

[0063] AGTGACGGTA TTTAACCAGA AAGCCACGGC TAACTACGTG CCAGCAGCCG

[0064] CGGTAATACG TAGGTGGCAA GCGTTATCCG GATTTATTGG GCGTAAAGCG

[0065] AGCGCAGGCG GTCTTTTAAG TCTAATGTGA AAGCCTTCGG CTCAACGAA

[0066] GAAGTGCATT GGAAACTGGG AGACTTGAGT GCAGAAGAGG ACAGTGGAAC

[0067] TCCATGTGTA GCGGTGAAAT GCGTAGATAT ATGGAAGAAC ACCAGTGGCG

[0068] AAGGCGGCTG TCTGGTCTGT AACTGACGCT GAGGCTCGAA AGCATGGGTA

[0069] GCGAACAGGA TTAGATACCC TGGTAGTCCA TGCCGTAAAC GATGATTACT

[0070] AAGTGTTGGA GGGTTTCCGC CCTTCAGTGC TGCAGCTAAC GCATTAAGTA

[0071] ATCCGCCTGG GGAGTACGAC CGCAAGGTTG AAACTCAAAA GAATTGACGG

[0072] GGGCCCGCAC AAGCGGTGGA GCATGTGGTT TAATTCGAAG CTACGCGAAG

[0073] AACCTTACCA GGTCTTGACA TCTTCTGCCA ACCTAAGAGA TTAGGCGTTC

[0074] CCTTCGGGGA CAGAATGACA GGTGGTGCAT GGTTGTCGTC AGCTCGTGTC

[0075] GTGAGATGTT GGGTTAAGTCCCGCAACGAG CGCAACCCTT ATTACTAGTT

[0076] GCCAGCATTC AGTTGGGCAC TCTAGTGAGA CTGCCGGTGA CAAACCGGAG

[0077] GAAGGTGGGG ACGACGTCAA ATCATCATGC CCCTTATGAC CTGGGCTACA

[0078] CACGTGCTAC AATGGATGGT ACAACGAGTC GCGAAACCGC GAGGTTTAGC

[0079] TAATCTCTTA AAACCATTCT CAGTTCGGAC TGTAGGCTGC AACTCGCCTA

[0080] CACGAAGTCG GAATCGCTAG TAATCGCGGA TCAGCATGCC GCGGTGAATA

[0081] CGTTCCCGGG CCTTGTACACACCGCCCGTC ACACCATGAG AGTTTGTAAC

[0082] ACCCAAAGCC GGTGGGGTAA CCTTTTAGGA GCT

[0083] In the present invention, Pediococcus acidilactici IOB701 is classified and named as Pediococcus acidilactici Pediococcus acidilactici It was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on July 10, 2018, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.16077.

[0084] The Pediococcus acidilactici IOB701 has the following biological characteristics:

[0085] Pediococcus acidilactici IOB701 was isolated from naturally fermented sourdough in the homes of residents in Tianjin.

[0086] Bacterial identification test: The detection method is FMIC-QO01-001-2015 microbiological test, bacterial multiphase identification test, and the test result is lactic acid Pediococcus ( Pediococcus acidilactici IOB701).

[0087] Bacterial characteristics: The bacteria are spherical, with a diameter of 0.5-0.8µm, arranged singly or in pairs, and are Gram-positive.

[0088] Colony characteristics: The colonies are milky white, round, moist, opaque, and have neat edges.

[0089] Growth characteristics: The minimum growth temperature of the strain is 15°C, the maximum growth temperature is 45°C, the best growth temperature is 35-37°C, the optimal growth pH is 6.5, and it enters the stable phase after 18 hours of cultivation. The strain was cultured in MRS medium at 36°C for 48 hours.

[0090] Acute oral toxicity test: The test items and basis are GB15193.3-2014 National Food Safety Standard Acute Oral Toxicity Test, and the test results are actually non-toxic level.

[0091] In order to further explain the technical means and effects adopted by the present invention, the technical solution of the present invention is further described below in conjunction with the preferred embodiments of the present invention, but the present invention is not limited to the scope of the embodiments.

[0092] Example 1

[0093] Enrichment of γ-aminobutyric acid from biogenic powder after hypoxia stress treatment combined with fermentation of Pediococcus acidilactici IOB701.

[0094] Four groups of samples were set up, sample 1: broad beans; sample 2: broad beans treated with hypoxia stress; sample 3: postbiotic powder of Pediococcus acidilactici IOB701 prepared by fermenting broad beans as fermentation medium; sample 4: postbiotic powder of Pediococcus acidilactici IOB701 prepared by fermenting broad beans treated with hypoxia stress as fermentation medium.

[0095] Colorimetric method for determination of γ-aminobutyric acid content in samples:

[0096] Experimental Materials:

[0097] γ-Aminobutyric acid, analytical grade, Shanghai Yuanye Biotechnology Co., Ltd.;

[0098] L-Glutamic acid, analytical grade, Shanghai Yuanye Biotechnology Co., Ltd.;

[0099] Sodium hypochlorite, analytical grade, obtained from Tianda Chemical Reagent Factory, Dongli District, Tianjin;

[0100] Sodium tetraborate, analytical grade, from BASF Chemical Co., Ltd., Tianjin.

[0101] Drawing of the colorimetric standard curve: Take 400 μL of substrate solution (gradient concentration of γ-aminobutyric acid mixed solution: 0.01 mg / mL, 0.04 mg / mL, 0.10 mg / mL, 0.25 mg / mL, 0.50 mg / mL), add 0.1 mL of 1.0 mol / L sodium carbonate, 0.5 mL of 0.2 mol / L pH10.0 borate buffer, 1.0 mL of phenol solution, mix thoroughly, add 1.0 mL of sodium hypochlorite solution within 5 minutes, mix well and let stand for 5 minutes, then place in a boiling water bath for 10 minutes, and immediately place in an ice bath for 20 minutes. Once the solution turns blue-green, immediately add 2.0 mL of 60% ethanol solution, mix well, react in a 22°C water bath for 30 minutes, then use 10.0 mmol / L L-glutamic acid as a blank group and measure its absorbance at 640 nm. A standard curve was prepared with the concentration of γ-aminobutyric acid as the horizontal axis and the optical density value (OD value) as the vertical axis.

[0102] Sample detection: weigh 5g of sample in a mortar, add 17mL of water, grind into a homogenate, centrifuge and take the supernatant. The reaction steps are the same as those of the standard. After the reaction is complete, measure its absorbance at 640nm. Substitute the absorbance value into the standard curve to calculate the γ-aminobutyric acid content.

[0103] The results are shown in Table 1 and Figure 1 As shown in Table 1 and Figure 1 Indicates the content of γ-aminobutyric acid.

[0104] Table 1 γ-aminobutyric acid content

[0105]

[0106] As shown in Table 1 and Figure 1As shown, the γ-aminobutyric acid content of sample 2 is 8.96 times that of sample 1, the γ-aminobutyric acid content of sample 3 is 12.34 times that of sample 1, and the γ-aminobutyric acid content of sample 4 is 26.53 times that of sample 1. Therefore, both the treatment of cereals or beans with hypoxic stress and the fermentation of Pediococcus acidilactici IOB701 can produce γ-aminobutyric acid, and the two have a synergistic effect and can enrich γ-aminobutyric acid in large quantities.

[0107] Example 2

[0108] Postbiotic powder fermented from Pediococcus acidilactici IOB701 can improve depression in mice induced by chronic unpredictable mild stress model.

[0109] SPF (specific pathogen-free) grade, 5-week-old male C57BL / 6 mice weighing 18±2g were used. The relative humidity of the mice was 55±5% and the temperature was 22±2℃. Before model construction, all mice were weighed and randomly divided into 5 groups, with 10 mice in each group.

[0110] The mice in the model group, positive group, experimental group 1 and experimental group 2 were subjected to chronic unpredictable mild stress to establish the chronic unpredictable mild stress model in mice.

[0111] The specific modeling process is as follows: After 7 days of adaptation, except for the normal group, all other groups were kept in a single cage and randomly given one stimulus every day to construct a chronic stress depression model. The selection of stressors should be random, and the interval between the same stressors should be greater than 7 days. All mice were subjected to chronic unpredictable mild stimulation for 6 weeks. The chronic unpredictable mild stress model was established for a total of 42 days.

[0112] The stressors used in this study to construct the chronic unpredictable mild stress mouse model include:

[0113] Water deprivation for 24 hours; restraint, restraint for 6 hours per day (10:00 AM ~ 16:00 PM). Lining cloth is placed at the bottom of the restraint tube to absorb the animal's excrement; tail hanging for 5 minutes; shaking the mouse cage for 10 minutes; cage tilted 45 degrees, for 24 hours, the mouse cage is placed at a 45-degree angle to the horizontal plane (stimulation after water deprivation, foraging is more difficult); food deprivation for 24 hours; keep the cage moist (200 ml / cage) or wet bedding all night (pour 200 ml of clean water into the mouse cage to moisten the bedding, until the water level overflows the surface of the bedding, maintain the soaking state for 24 hours, and replace the clean bedding after 24 hours); hot water bath 45℃ (swimming), 15 minutes. Odor 12 hours (foreign objects, unfamiliar objects such as plastic cups, toothbrushes, etc. / odors such as mothballs, etc.). Soak in cold water (4°C, 5 / 15 minutes). Place the test animal in water adjusted to 4°C, with the toes of the test animal just touching the bottom of the bucket. Take the animal out after 5 minutes.

[0114] The specific time schedule is shown in Table 2:

[0115] Table 2 Time schedule for establishing the chronic unpredictable mild stress mouse model

[0116]

[0117] All mice were gavaged for two weeks starting from the 7th week.

[0118] Specific mouse grouping and treatment are shown in Table 3:

[0119] Table 3 Grouping and treatment of mice

[0120]

[0121] Behavioral experiments were conducted at the end of the 6th and 8th weeks, including open field tests and forced swimming tests. Mice were killed after the 8th week of behavioral experiments, and the organ index, γ-aminobutyric acid content, tryptophan metabolism-related indicators, hypothalamus-pituitary-adrenal axis (HPA axis)-related biomarker content and intestinal flora changes of each group of mice were measured. The specific implementation methods and results are as follows:

[0122] 1. Behavioral experiment - forced swimming test

[0123] The forced swimming test was used to record the immobility time of the experimental mice while swimming and evaluate the mice's desire to survive. The transparent water cup was filled with about 15 cm of clean water at room temperature. 24 h before the formal experiment, each mouse underwent 10 minutes of adaptive swimming training. During the formal experiment, each mouse underwent a 6-minute swimming test. The video was digitally analyzed using Etho Vision software to calculate the cumulative immobility time of the mice from 2 to 6 minutes (the judgment criteria were immobility of the limbs or only slight movement of the hind limbs).

[0124] Figure 2 For the results of the forced swimming test, Figure 2 As shown, the immobility time of mice induced by chronic unpredictable mild stress increased significantly in both the 6th and 8th weeks, that is, the mice gave up in despair. Two weeks after intragastric administration, that is, the results of the 8th week showed that compared with the model group, intragastric administration of IOB701 postbiotics could significantly reduce the immobility time of mice induced by chronic unpredictable mild stress and reverse the despair giving up behavior of mice induced by chronic unpredictable mild stress, indicating that IOB701 postbiotics can alleviate the depressive symptoms of mice.

[0125] (II) Behavioral experiment - open field experiment

[0126] Through the open field test, the number of upright times, number of grid crossing times, movement trajectory, and time in the center area of ​​the experimental mice were recorded to evaluate the exploration ability of the mice. The mice were placed in an open box (50×50×40 cm). The bottom line was divided into 25 equal-sized squares with a side length of 10 cm. In the open field test, after the animal was placed in the center of the open field, the timing and recording began immediately, and the recording was stopped after 5 minutes of observation. The behavior of each mouse was recorded within 5 minutes, and the number of grids crossed by the animal's forelimbs, the number of times the hind limbs stood, and the time moving in the designated central area of ​​the box (20×20 cm) was recorded. After the experiment of each animal, the urine and feces were cleaned, and the open box was cleaned with 75% ethanol solution to eliminate the influence of animal odor on the next experiment.

[0127] Figure 3 is the result of the open field experiment, such as Figure 3 As shown, in both the 6th and 8th weeks, the mice induced by chronic unpredictable mild stress had reduced movement distance, shortened movement time, and more hiding in a corner without moving. The complexity of the movement trajectory was significantly reduced, which showed depressive-like behavior. Two weeks after intragastric administration, that is, the results of the 8th week showed that compared with the model group, the movement trajectory of the mice induced by chronic unpredictable mild stress was more complex after intragastric administration of IOB701 postbiotics, which improved the depressive-like behavior of the mice induced by chronic unpredictable mild stress, indicating that IOB701 postbiotics can alleviate the depressive symptoms of mice.

[0128] 3. Organ Index

[0129] After the behavioral experiment, blood was quickly drawn from the eyeballs, and then the mice were killed and weighed. The organ index was calculated according to the following formula:

[0130] Organ coefficient = organ weight (mg) / body weight (g)

[0131] Figure 4 is the mouse liver index, such as Figure 4 As shown: Compared with the model group, the organ indexes of chronic unpredictable mild stress mice decreased after oral administration of IOB701 postbiotics, indicating that IOB701 postbiotics can alleviate liver enlargement in mice.

[0132] (IV) Determination of γ-aminobutyric acid content

[0133] Experimental materials: Mouse gamma-aminobutyric acid (GABA) kit, Nanjing Herb Source Biotechnology Co., Ltd.

[0134] The mouse blood was placed in an EP tube, centrifuged at 3000r / min and 4℃ for 15min, and the serum was separated and divided into EP tubes and stored in a -80℃ refrigerator. After the mouse was killed, the head was quickly removed and the brain was placed in a culture dish on ice, and then the hippocampus was quickly removed and stored in a -80℃ refrigerator. The mouse brain hippocampus was taken out from the -80℃ refrigerator, and cold PBS (4℃) was added at a mass volume ratio of 1:10. After being fully homogenized by a homogenizer, it was placed in a centrifuge, set at 6000 r / min, 4℃, and centrifuged for 10min. The supernatant was taken and divided into EP tubes. 50 μL of the supernatant was divided into EP tubes. The samples to be tested were retained, and the rest were frozen at -80℃ for later use. The changes in the content of γ-aminobutyric acid in the hippocampus and serum were detected by ELISA kits. The concentrations of relevant indicators in each sample were calculated according to the instructions of the kit.

[0135] Figure 5 The γ-aminobutyric acid content in mouse serum and hippocampus, such as Figure 5 As shown: Compared with the model group, the γ-aminobutyric acid content in the hippocampus and serum of mice in each experimental group was significantly increased, among which IOB701 postbiotic had the best effect, indicating that IOB701 postbiotic can alleviate the depressive symptoms of mice.

[0136] (V) Detection of tryptophan metabolism related indicators

[0137] Experimental materials: Mouse tryptophan (TRP) kit, Nanjing Herb Source Biotechnology Co., Ltd.;

[0138] ELISA kit was used to detect the changes in the ratio of kynurenine (KYN) to tryptophan (TRP) in serum.

[0139] Figure 6 is the change in the ratio of kynurenine (KYN) to tryptophan (TRP) in mouse serum, such as Figure 6 As shown: Compared with the model group, the γ-aminobutyric acid content in the serum of mice with chronic unpredictable mild stress in each experimental group was significantly reduced, among which IOB701 postbiotic had the best effect, indicating that IOB701 postbiotic can alleviate the depressive symptoms of mice.

[0140] 6. Detection of indicators related to the hypothalamus-pituitary-adrenal axis

[0141] Experimental materials: Corticotropin-releasing hormone (CRH) kit, Nanjing Herb Source Biotechnology Co., Ltd.; adrenocorticotropic hormone (ACTH) kit, Nanjing Herb Source Biotechnology Co., Ltd.; corticosterone (CORT) kit, Nanjing Herb Source Biotechnology Co., Ltd.;

[0142] ELISA kits were used to detect the changes in the levels of HPA axis-related biomarkers, corticotropin-releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and corticosterone (CORT) in the hypothalamus.

[0143] Figure 7 is the change of corticotropin-releasing hormone (CRH) content in the hypothalamus of mice. Figure 8 The changes of adrenocorticotropic hormone (ACTH) content in the hypothalamus of mice; Fig. 9 Changes in hypothalamic corticosterone (CORT) content in mice.

[0144] like Figure 7 , Figure 8 and Fig. 9 As shown: Compared with the model group, the levels of corticotropin-releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and corticosterone (CORT) in the hypothalamus of chronic unpredictable mild stress mice were significantly reduced after oral administration of IOB701 postbiotics, indicating that IOB701 postbiotics can alleviate the depressive symptoms of mice.

[0145] 7. Determination of cytokine levels

[0146] Experimental materials: Mouse interleukin-6 (IL-6) ELISA kit, Nanjing Herb Source Biotechnology Co., Ltd.; Mouse interleukin-10 (IL-10) ELISA kit, Nanjing Herb Source Biotechnology Co., Ltd.;

[0147] ELISA kits were used to detect the levels of IL-1β and IL-10 in mouse serum. The concentrations of the relevant indicators in serum were calculated according to the kit instructions. Fig.10 is the content of inflammatory factor IL-1β in mouse serum, Fig.11 It is the content of inflammatory factor IL-10 in mouse serum.

[0148] like Fig.10 and Fig.11 As shown: Compared with the model group, the pro-inflammatory factor IL-1β in the serum of mice with chronic unpredictable mild stress was significantly reduced and the anti-inflammatory factor IL-10 was significantly increased after oral administration of IOB701 postbiotics, indicating that IOB701 postbiotics can improve the inflammation level of mice.

[0149] 8. High-throughput sequencing of 16S rDNA gene of mouse intestinal flora

[0150] After the mouse behavior study was completed, the mouse feces were collected from the colon and 16S rDNA gene high-throughput sequencing was performed. The final valid data was obtained and diversity analysis and correlation analysis were performed. Fig.12Table 3 shows the changes in the abundance of mouse microbiota (gate level). NC is the blank group, MC is the model group, PC is the positive group, PG is the experimental group 1, and P701 is the experimental group 2. The sample treatments and experimental treatments of each group are shown in Table 3. Fig.13 is the abundance ratio of mouse microbiota (Firmicutes / Bacteroidetes), Fig.14 This is a heat map of the correlation of mouse intestinal flora (gate level).

[0151] Depend on Fig.12 and Fig.13 It can be seen that compared with the model group, the abundance of beneficial bacteria in the intestines of chronic unpredictable mild stress mice increased after oral administration of IOB701 postbiotics, the abundance of harmful bacteria decreased (at the phylum level), and the ratio of Firmicutes / Bacteroidota decreased. Fig.14 It can be seen that Bacteroidota is negatively correlated with corticotropin-releasing hormone (CRH, hypothalamus), and positively correlated with γ-aminobutyric acid (GABA, hippocampus) and IL-10 (serum); Firmicutes is negatively correlated with γ-aminobutyric acid (GABA, hippocampus) and IL-10 (serum) in the hypothalamus, and positively correlated with corticotropin-releasing hormone (CRH, hypothalamus) and adrenocorticotropic hormone (ACTH, hypothalamus). IOB701 postbiotics can improve the depressive behavior of chronic unpredictable mild stress mice through the brain-gut axis.

Claims

1. A method for preparing postbiotic powder after fermentation of Pediococcus acidilactici IOB701, characterized in that: The deposit number of the Pediococcus acidilactici IOB701 is CGMCC No.16077, and the preparation method comprises the following steps: (1) Hypoxia stress and sterilization treatment of broad beans: First, wash the broad beans with distilled water to remove impurities and dust, disinfect with 1% sodium hypochlorite solution by volume for 30 minutes, wash the residual sodium hypochlorite with distilled water, soak in clean water for 6-8 hours, and the soaking temperature is 24-26°C. After the soaking is completed, take out and drain the water, place in an incubator away from light for 48-72 hours, maintain relative humidity above 95%, and ventilation volume 1.0L / min-1.2L / min. After the incubation is completed, sterilize at 121°C for 20 minutes; (2) first activating the lactic acid Pediococcus IOB701 strain to obtain a slant strain, and then preparing a seed solution of the lactic acid Pediococcus IOB701; (3) The seed liquid of Pediococcus acidilactici IOB701 is inoculated on broad beans that have been subjected to hypoxia stress and sterilization for fermentation. The obtained fermentation product is inactivated, dried, and crushed to obtain the fermentation postbiotic powder of Pediococcus acidilactici IOB701.

2. The method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 according to claim 1, characterized in that: The strain activation is to inoculate the lactic acid Pediococcus acidilactici IOB701 in the cryopreservation tube into the slant culture medium, set the temperature to 36-38° C., and activate for 18-22 hours.

3. The method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 according to claim 2, characterized in that: The slant culture medium formula is: peptone 10.0g, beef extract 10.0g, yeast extract 5.0g, glucose 20.0g, Tween 80 1.0mL, dipotassium hydrogen phosphate 2.0g, sodium acetate 5.0g, ammonium citrate 2.0g, magnesium sulfate (7H2O) 0.2g, manganese sulfate (1H2O) 0.05g, agar 15.0g, pH=6.0~6.4, and the amount of water added is 1L.

4. The method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 according to claim 1, characterized in that: The preparation method of the seed liquid of Pediococcus acidilactici IOB701 comprises: taking fresh slant bacteria and inoculating them into the basic culture medium of the seed liquid, maintaining the temperature at 35-39° C., and culturing them in a closed static manner for 18-22 hours.

5. The method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 according to claim 4, characterized in that: The basic culture medium formula of seed liquid is: peptone 10.0g, beef extract 10.0g, yeast extract 5.0g, glucose 20.0g, Tween 801.0mL, dipotassium hydrogen phosphate 2.0g, sodium acetate 5.0g, ammonium citrate 2.0g, magnesium sulfate (7H2O) 0.2g, manganese sulfate (1H2O) 0.05g, pH=6.0~6.4, and the amount of water added is 1L.

6. The method for preparing biotic powder after fermentation of Pediococcus acidilactici IOB701 according to claim 1, characterized in that: In step (3), the inoculation amount is 8-12%, the fermentation temperature is 34-38°C, the culture is kept in a closed state, and the culture time is 22-26 hours. The activity of the fermentation product finally obtained is 1×10 8 CFU / g After the culture was completed, it was inactivated by treating at 115℃ for 30min.

7. Use of the fermentation postbiotic powder of Pediococcus acidilactici IOB701 obtained by the preparation method according to any one of claims 1 to 6 in the preparation of medicines for improving emotional health.

8. Use of the fermented probiotic powder of Pediococcus acidilactici IOB701 obtained by the preparation method according to any one of claims 1 to 6 in preparing health products.

Images