Use of lncrna00_178, miR-466b-3p and gucy1b1 as biomarkers or drug targets for acute lung injury
By using LncRNA00_178 as a diagnostic biomarker, miR-466b-3p downregulator, and Gucy1b1 as drug targets, the lack of effective diagnosis and treatment in acute lung injury has been addressed, providing new treatment ideas and targets with broad application potential.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANHUI MEDICAL UNIV
- Filing Date
- 2024-08-14
- Publication Date
- 2026-04-14
AI Technical Summary
The lack of research on the mechanisms of action of LncRNA00_178, miR-466b-3p and Gucy1b1 in acute lung injury in the current technology has resulted in a lack of effective diagnostic biomarkers and therapeutic targets.
LncRNA00_178 is proposed as a screening or diagnostic biomarker for acute lung injury, miR-466b-3p downregulators are used to prepare drugs for the prevention and treatment of acute lung injury, and Gucy1b1 is proposed as a drug target for the prevention and/or treatment of acute lung injury.
This provides new insights into the treatment mechanism of acute lung injury, identifies new specific targets, offers new ideas for drug development, and has broad application prospects.
Smart Images

Figure CN118895354B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomarker and drug target technology, specifically involving the use of LncRNA00_178, miR-466b-3p and Gucy1b1 as biomarkers or drug targets for acute lung injury. Background Technology
[0002] Acute lung injury (ALI) is a serious disease characterized by rapid onset, rapid progression, and high mortality. In severe cases, it can develop into acute respiratory distress syndrome (ARDS). Research on its pathogenesis often focuses on uncontrolled inflammatory responses, while some studies have shown that widespread apoptosis of alveolar epithelial cells is one of the initiating factors of acute lung injury.
[0003] LncRNAs (long non-coding RNAs) are long non-coding RNAs with multiple modes of action, the most classic being their sponge-like binding of miRNAs (microRNAs), blocking the inhibitory effects of miRNAs on their downstream target genes. The functional diversity and complexity of lncRNAs result in a wide range of mechanisms of action in organisms, implying their potential value in disease diagnosis and treatment. However, the role of lncRNAs in the occurrence and development of ALI (Alternative Inflammatory Disease) remains poorly understood. LncRNA ID: ENSRNOT00000086178 (hereinafter referred to as LncRNA00_178) is an lncRNA located on chromosome 11, and its function has not yet been studied.
[0004] MicroRNAs (miRNAs) are another type of non-coding RNA that can regulate a range of pathological processes in tissues and organs by modulating downstream target messenger RNAs. In recent years, miRNAs have been shown to play a regulatory role in the inflammatory processes of multiple organs, including the lungs, liver, and heart. miR-466b-3p targets multiple cancer-related genes and is closely related to inflammatory responses and apoptosis. However, the role of miR-466b-3p in acute lung injury remains poorly understood.
[0005] Gucy1b1, also known as GC-S-beta-1, encodes the β1 subunit of soluble guanylate cyclase (sGC), which is involved in regulating the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate) during metabolism. However, the role of Gucy1b1 in acute lung injury remains poorly understood.
[0006] Chinese patent application CN104436195A discloses the use of miR-155 in the preparation of drugs for the prevention and treatment of acute lung injury. This patent is the first to reveal a close correlation between miR-155 and acute lung injury, suggesting that miR-155 promotes its occurrence. Therefore, downregulators of miR-155 can be used to prevent, alleviate, or treat acute lung injury, particularly acute pulmonary hemorrhage. However, this patent does not disclose the mechanism of action of LncRNA00_178, miR-466b-3p, and Gucy1b1 in acute lung injury. Summary of the Invention
[0007] The technical problem to be solved by this invention is how to provide a diagnostic biomarker, therapeutic agent, and drug target for acute lung injury.
[0008] The present invention solves the above-mentioned technical problems through the following technical means:
[0009] The first aspect of the present invention proposes the use of LncRNA00_178 as a biomarker for screening or diagnosis of acute lung injury, the sequence of which is shown in SEQ ID No.1.
[0010] A second aspect of the present invention proposes the application of the above-mentioned LncRNA00_178 in the preparation of acute lung injury diagnostic products, wherein a specific detection reagent is designed and synthesized based on the sequence of the LncRNA00_178 for use in the preparation of acute lung injury diagnostic products.
[0011] Preferably, the acute lung injury diagnostic product is a formulation, chip, or reagent kit.
[0012] A third aspect of the present invention provides the use of a miR-466b-3p downregulator in the preparation of a pharmaceutical composition for the prevention and treatment of acute lung injury, wherein the sequence of miR-466b-3p is: AUACAUACACACACACAUACAC (SEQ ID No. 2).
[0013] Preferably, the miR-466b-3p downregulator is a substance that inhibits miR-466b-3p expression or prevents miR-466b-3p from binding to its target gene site (e.g., miR-466b-3p interference plasmid).
[0014] Preferably, the miR-466b-3p downregulator includes an inhibitor of miR-466b-3p, an antagonist of miR-466b-3p (Antagomir), an antisense nucleic acid of miR-466b-3p, a locked nucleic acid or antisense nucleic acid of miR-466b-3p; or a construct carrying or expressing an antisense nucleic acid of miR-466b-3p or a locked nucleic acid or antisense nucleic acid of miR-466b-3p.
[0015] A fourth aspect of the invention proposes the use of Gucy1b1 as a drug target in the preparation of medicaments for the prevention and / or treatment of acute lung injury.
[0016] Preferably, the Gucy1b1 includes the Gucy1b1 gene and the Gucy1b1 protein; the coding region sequence of the Gucy1b1 gene is shown in SEQ ID No. 3.
[0017] Preferably, the drug includes a Gucy1b1 overexpression agent or an agent that promotes Gucy1b1 overexpression.
[0018] A fifth aspect of the present invention provides a pharmaceutical composition for the prevention and / or treatment of acute lung injury, comprising the above-mentioned miR-466b-3p downregulator or Gucy1b1 overexpression agent.
[0019] The advantages of this invention are:
[0020] This invention proposes a targeted binding relationship between LncRNA00_178 and miR-466b-3p, and between miR-466b-3p and Gucy1b1. LncRNA00_178 can serve as a biomarker for screening or diagnosis of acute lung injury (ALI), silencing miR-466b-3p inhibits LPS-induced alveolar epithelial cell apoptosis, and Gucy1b1 can serve as a drug target in the preparation of drugs for the prevention and / or treatment of ALI. This provides new insights into the therapeutic mechanisms and specific target identification of ALI, and offers new ideas for the development of new drugs for ALI, demonstrating broad application prospects. Attached Figure Description
[0021] Figure 1 This is a schematic diagram illustrating the mechanism of action of LncRNA00_178, miR-466b-3p, and Gucy1b1 on acute lung injury according to the present invention.
[0022] Figure 2 This is an analysis of the protective effect of specific blocking of ASIC1a against LPS-induced ALI in Example 1 of the present invention. In this figure, A is a comparison of HE staining and Masson staining of rat lung tissue, with a scale bar of 50 μm; B is a TUNEL staining of rat lung tissue, with a scale bar of 50 μm.
[0023] Figure 3 This is a screening diagram of significantly differentially expressed LncRNAs in rat lung tissue in Example 1 of the present invention, where A is a volcano plot and scatter plot of differentially expressed LncRNAs; B is a Venn plot of differentially expressed LncRNAs in each group; and C is a qRT-PCR verification diagram of differentially expressed LncRNAs in rat lung tissue (n=5).
[0024] Figure 4 This is a screening and verification diagram of LncRNA00_178 targeting miRNA in Example 1 of the present invention; where Ai is a qRT-PCR detection diagram of miR-466b-3p expression in lung tissue (n=6); A-ii is a qRT-PCR detection diagram of miR-466b-3p expression in alveolar epithelial cells (n=3); * P<0.05, ** P<0.01 vs. Control group; # P<0.05, ## P<0.01 vs. LPS group); B is a diagram of the binding sites of LncRNA00_178 and miR-466b-3p; C is a diagram of the relationship between LncRNA00_178 and miR-466b-3p detected by luciferase reporter gene assay; D is a diagram of miR-466b-3p expression in alveolar epithelial cells after silencing LncRNA00_178 detected by qRT-PCR. ** P<0.01 vs. Control group; ## P<0.01 vs. sh-NC+LPS group);
[0025] Figure 5 This diagram illustrates how silencing miR-466b-3p alleviates LPS-induced apoptosis in Example 1 of this invention. A shows the expression of miR-466b-3p in cells after silencing, detected by qRT-PCR (n=3); B shows the effect of miR-466b-3p silencing on LPS-induced apoptosis proteins (n=3); C shows the effect of miR-466b-3p silencing on LPS-induced apoptosis-related mRNAs (n=4); and D shows the effect of miR-466b-3p silencing on apoptosis detected by flow cytometry (n=4).
[0026] Figure 6This is a diagram verifying the screening of target genes targeted by miR-466b-3p in Example 1 of the present invention; where A represents the target genes of miRNAs screened by high-throughput sequencing; B represents the sequence of miR-466b-3p targeting Gucy1b1 as predicted by miRDB; C represents the relationship between miR-466b-3p and Gucy1b1 detected by luciferase reporter gene assay; and D represents the expression of Gucy1b1 protein in LPS-treated alveolar epithelial cells after transfection with miR-466b-3p inhibitor by Western blot (n=3).
[0027] Figure 7 This is an experimental diagram illustrating how silencing Gucy1b1 promotes LPS-induced apoptosis in Example 1 of this invention; where A is a Western blot diagram showing changes in Gucy1b1 protein in alveolar epithelial cells. * P<0.05 vs. Control group; ## P<0.01 (vs. LPS group); B is a graph showing the expression of Gucy1b1 in cells after silencing Gucy1b1 by qRT-PCR (n=3); C is a graph showing the effect of inhibiting Gucy1b1 on the expression of LPS-induced apoptosis-related proteins; D is a graph showing the effect of silencing Gucy1b1 on apoptosis by flow cytometry (n=4). Detailed Implementation
[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0029] Unless otherwise specified, all test materials and reagents used in the following examples are commercially available.
[0030] Unless otherwise specified in the embodiments, the techniques or conditions described in the literature in this field or in accordance with the product manual may be followed.
[0031] Example 1:
[0032] 1. Experimental Materials
[0033] 1.1 Laboratory Animals
[0034] Male SD rats (6 weeks old) were purchased from Liaoning Changsheng Biotechnology Co., Ltd., license number: SCXK(Liaoning)2020-0001. After one week of acclimatization under room temperature of 20-25℃ and humidity of 50%-70%, they were used for subsequent experiments.
[0035] 1.2 Cell lines
[0036] The RLE-6TN cell line was purchased from Beijing Beina Chuanglian Biotechnology Co., Ltd.
[0037] 2. Experimental Methods
[0038] 2.1 Rat model of acute lung injury
[0039] Twenty-four male SD rats (weighing 180-200g, 6 weeks old) were randomly divided into three groups (n=8): a blank control group (Control group), an acute lung injury model group (LPS group), and an ASIC1a inhibitor pretreatment group (LPS+PcTx-1 group). LPS and PcTx-1 were diluted with ddH2O to concentrations of 5 mg / kg and 25 μg / kg, respectively. The pretreatment group received a tail vein injection of the ASIC1a inhibitor PcTx-1 24 hours before the establishment of the acute lung injury model. The LPS and LPS+PcTx-1 groups were induced with acute lung injury via intratracheal infusion of LPS. The Control group received an equal volume of ddH2O via intratracheal infusion. Twenty-four hours after intratracheal infusion, the rats were anesthetized, and fresh lung tissue was harvested. The tissue surface was rinsed with PBS to remove blood and impurities. The upper lobe of the right lung was excised and completely immersed in a tissue fixative containing 4% PFA. After 24 hours of complete fixation, the tissue was embedded in paraffin. The remaining lung tissue was frozen at -80°C for subsequent measurement of indicators.
[0040] 2.1.1 HE staining
[0041] Lung tissue paraffin blocks were prepared into 5 μm thick sections using a cryostat. These sections were then alternately immersed in xylene and alcohol of varying concentrations to remove the wax. After rinsing with running water, the sections were further immersed in hematoxylin staining solution for 3 minutes, removed, and slowly washed away with tap water to remove any excess stain. The sections were then placed in differentiation solution for a few seconds, quickly removed, and rinsed with running water. Next, they were immersed in a blueing solution; after observing the blueing phenomenon, they were rinsed with distilled water. Finally, the sections were immersed in eosin dye for 3 minutes, dehydrated in ethanol of varying concentrations in sequence, and cleared in xylene. Neutral resin was added, and the sections were mounted with coverslips. Images were acquired under a microscope to observe the pathological changes in rat lung tissue.
[0042] 2.1.2 Masson staining
[0043] After dewaxing and dehydration, paraffin sections were stained in hematoxylin for 8 minutes. Differentiation and blue reversion were then performed, followed by rinsing with distilled water to remove excess stain. Masson's Ponceau S was then stained for 3 minutes. Next, the sections were alternately immersed in a weak acid working solution and phosphomolybdic acid solution for 1 minute each, followed by rinsing in a weak acid solution for 1 minute. After removal, the sections were directly transferred to aniline blue staining for 2 minutes. They were then removed and rinsed again in a weak acid solution. Finally, the sections were dehydrated in ethanol of different concentrations in sequence, and then cleared in xylene. Neutral resin was added for mounting, and the tissue inflammatory response and fibrotic changes were observed.
[0044] HE and Masson staining analysis of lung tissue showed that:
[0045] In the negative control group, the alveolar walls remained intact, the alveolar cavity morphology was unchanged, and no inflammatory exudate was observed in the pulmonary interstitium. Compared with the negative control group, LPS administration significantly aggravated lung injury, with thickening of elastic fibers in the alveolar cavities, alveolar wall collapse, and increased acute inflammatory exudate in the pulmonary interstitium. Psalmotoxin 1 (PcTx-1), as an acid-sensitive channel blocker, specifically binds to ASIC1a at subunit-subunit sites, exerting an inhibitory effect on ASIC1a. Its administration significantly reduced the infiltration of inflammatory exudate in the pulmonary interstitium and restored the structural integrity of the alveolar walls (e.g., Figure 2 (As shown in A).
[0046] Next, TUNEL staining results were observed using a slide scanner. In situ staining of apoptotic cells with DNA double-strand or single-strand breaks revealed weak fluorescence expression in the Control group, a significant increase in apoptotic fluorescence intensity in the LPS group, and inhibition of apoptotic fluorescence signal in the LPS+PcTx-1 group. This indicates that LPS increases the apoptosis rate, and this effect is inhibited by PcTx-1, suggesting that PcTx-1 plays a role in ALI. Therefore, inhibiting ASIC1a can alleviate lung injury symptoms (such as...). Figure 2 (as shown in B).
[0047] High-throughput sequencing for screening differentially expressed lncRNAs
[0048] To further investigate the mechanism of ASIC1a’s apoptosis effect on ALI, high-throughput sequencing was used to screen for LncRNAs in the lung tissues of rats in the normal group, LPS-induced ALI group, and PcTx-1 pretreated group.
[0049] 2.2 High-throughput sequencing of rat lung tissue
[0050] Fresh rat lung tissue was provided, with three samples submitted for each group. Shanghai Meiji Company was commissioned to perform whole transcriptome sequencing to quantitatively analyze LncRNA, miRNA, and mRNA in the rat lung tissue and to construct a database to screen for differentially expressed RNA.
[0051] Plot the volcano plot and scatter plot of significantly differentially expressed LncRNAs between response groups (e.g.) Figure 3 A) and Venn plot showing the proportion of differentially expressed LncRNAs between response groups (as shown in Figure A). Figure 3 (as shown in B).
[0052] The results showed that a total of 274 lncRNAs were significantly differentially expressed in ALI compared with the normal group, of which 100 lncRNAs were upregulated and 174 were downregulated. Meanwhile, 44 lncRNAs were significantly differentially expressed in the PcTx-1 pretreated group compared with the ALI group, of which 22 lncRNAs were upregulated and 22 were downregulated. qRT-PCR validation of three lncRNAs with high differential expression levels between groups in the database showed expression trends consistent with the screening results. Among them, a novel lncRNA, ENSRNOT00000086178 (abbreviated as lncRNA00_178, its sequence is shown in SEQ ID No. 1), attracted our attention due to its small intra-group data dispersion and significant inter-group differences. LncRNA00_178 was downregulated in ALI, and the downregulation effect was inhibited after PcTx-1 pretreatment (e.g., Figure 3 (as shown in C).
[0053] LncRNA00_178 targets and binds to miR-466b-3p
[0054] The results above show that LncRNA00_178 is involved in LPS-induced apoptosis of alveolar epithelial cells. So how does LncRNA00_178 regulate apoptosis?
[0055] To identify miRNAs with the LncRNA00_178 binding site that are highly expressed in ALI lung tissue and LPS-induced RLE-6TN and whose expression is inhibited by PcTx-1, potential target miRNAs were screened based on sequencing results and the bioinformatics database Bibiserv (https: / / Bibiserv.cebitec.uni-bilefeld.de / ). qRT-PCR analysis identified rno-miR-466b-3p (its sequence is shown in SEQ ID No. 2) as the only miRNA meeting the criteria. Figure 4 (As shown in A). The binding sites of LncRNA00_178 and miR-466b-3p are as follows: Figure 4 As shown in B.
[0056] To verify the targeting relationship between LncRNA00_178 and miR-466b-3p, Shanghai Jima was commissioned to synthesize miR-466b-3p mimic / inhibitor, and Anhui General Biotechnology constructed wild-type (WT) and mutant (MUT) luciferase plasmids for LncRNA00_178. Compared with NC mimic+WT-LncRNA00_178, co-transfection with miR-466b-3p mimic and wild-type WT-LncRNA00_178 significantly reduced luciferase activity; conversely, compared with the inhibitor NC+WT-LncRNA00_178, co-transfection with miR-466b-3p inhibitor and WT-LncRNA00_178 significantly increased luciferase activity, while after LncRNA00_178 mutation, there was no significant difference in luciferase activity among the groups (e.g., ...). Figure 4 (as shown in C).
[0057] We further altered the expression of LncRNA00_178 and found that the expression of miR-466b-3p was negatively correlated with the level of LncRNA00_178 (e.g., Figure 4 (As shown in D). The above experimental results indicate that LncRNA00_178 interacts with miR-466b-3p through a specific binding site.
[0058] Silencing miR-466b-3p inhibits LPS-induced apoptosis in alveolar epithelial cells:
[0059] The miR-466b-3p interference plasmid was constructed and transfected into alveolar epithelial cells. In the miR-466b-3p inhibitor group, the expression level of miR-466b-3p was significantly downregulated compared with that in the sh-NC group (e.g., ...). Figure 5 As shown in A). Western blot (as shown in Figure A). Figure 5 As shown in B), RT-qPCR (as shown in B) Figure 5 As shown in Figure C, the assays indicated that reduced miR-466b-3p expression (silencing miR-466b-3p) significantly inhibited the expression of pro-apoptotic genes Bax and Cleaved caspase 3, and promoted the expression of the anti-apoptotic gene Bcl-2. Flow cytometry results showed that, compared with the empty plasmid transfection group, silencing miR-466b-3p significantly inhibited the combined proportion of early and late apoptotic cells. This reversed the pro-apoptotic effect of LPS (e.g., Figure 5 (as shown in D).
[0060] miR-466b-3p targets and binds to Gucy1b1:
[0061] In the previous experiment, we demonstrated that miR-466b-3p is involved in LPS-induced apoptosis, but how it acts on downstream mechanisms of apoptosis remains unclear. To identify targets that are highly expressed in the lungs and play a protective role in lung injury, we screened sequencing results and, based on the miRDB database (https: / / mirdb.org / mirdb / expression.html), identified potential target genes of miR-466b-3p, such as Gucy1b1 (e.g.,...). Figure 6 As shown in A; Gucy1b1's Gene ID on NCBI is 25202, and the coding region sequence of Gucy1b1 is shown in SEQ ID No. 3. The potential binding sites of miR-466b-3p and Gucy1b1 are shown in... Figure 6 As shown in B.
[0062] Gucy1b1 wild-type and mutant luciferase plasmids were provided by Anhui General Biotechnology. Dual-luciferase reporter gene assays showed that, compared with the NC mimic and wild-type Gucy1b1 groups, the co-transfection group with miR-466b-3p mimic and wild-type Gucy1b1 exhibited significantly reduced luciferase activity (e.g., ...). Figure 6 (As shown in C). This indicates that miR-466b-3p has a targeted binding effect on Gucy1b1. Next, we transfected alveolar epithelial cells with miR-466b-3p inhibitor and sh-NC, and found that LPS-induced Gucy1b1 expression was downregulated, while Gucy1b1 expression was upregulated in the miR-466b-3p inhibitor group compared to the sh-NC group (as shown in C). Figure 6 (as shown in D).
[0063] Silencing of Gucy1b1 promotes LPS-induced apoptosis in alveolar epithelial cells:
[0064] The previous experimental results suggested that miR-466b-3p may target Gucy1b1 to promote alveolar epithelial cell apoptosis. Further investigation was conducted using a rat ALI whole-body model and an alveolar epithelial cell model to explore the role of Gucy1b1 in tissue and cell apoptosis. Western blot analysis of Gucy1b1 expression levels in lung tissues of different groups of rats in the whole-body model showed that LPS induction significantly downregulated Gucy1b1 protein expression in lung tissues, while PcTx-1 pretreatment significantly upregulated Gucy1b1 protein expression compared to the LPS group (Figure 10A). A Gucy1b1 interference plasmid was constructed and transfected into alveolar epithelial cells. In the sh-Gucy1b1 group, Gucy1b1 expression levels were significantly lower than in the sh-NC group (Figure 10B). Western blot analysis (Figure 10C) detected apoptosis-related proteins in cells transfected with sh-NC or sh-Gucy1b1 and then treated with LPS. Compared with the sh-NC+LPS group, the expression levels of pro-apoptotic proteins Bax and Cleaved caspase 3 were significantly increased in the sh-Gucy1b1+LPS group, while the expression of Gucy1b1 and the anti-apoptotic protein Bcl-2 was significantly downregulated. The results indicated that the reduction in Gucy1b1 expression significantly promoted apoptosis. Flow cytometry (Figure 10D) showed no significant difference in the sum of apoptosis rates in the UR and LR quadrants between the sh-NC+LPS group and the LPS group; however, the apoptosis rate was significantly increased in the sh-Gucy1b1+LPS group compared to the sh-NC+LPS group. (A schematic diagram illustrating the mechanism of action of LncRNA00_178, miR-466b-3p, and Gucy1b1 on acute lung injury is shown below.) Figure 1 As shown.
[0065] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of LncRNA00_178 in the preparation of screening or diagnostic products for acute lung injury in rats, characterized in that, The sequence of LncRNA00_178 is shown in SEQ ID No. 1; specific screening or diagnostic reagents are designed and synthesized based on the sequence of LncRNA00_178 for the preparation of rat acute lung injury screening or diagnostic products.
2. The application according to claim 1, characterized in that, The acute lung injury screening or diagnostic product is a formulation, chip, or reagent kit.
3. The application according to claim 2, characterized in that, The acute lung injury screening or diagnostic product is a formulation.
4. The application according to claim 2, characterized in that, The acute lung injury screening or diagnostic product is a chip.
5. The application according to claim 2, characterized in that, The acute lung injury screening or diagnostic product is a reagent kit.
6. The application according to claim 1, characterized in that, The acute lung injury mentioned is LPS-induced acute lung injury.
7. The application according to claim 1, characterized in that, The rats in question were male SD rats.
Citation Information
Patent Citations
Use of miR-155 in preparation of acute lung injury prevention and treatment drugs
CN104436195A