Application of a targeted inhibitor in the preparation of drugs for treating skin melanoma

Abstract

The present invention discloses the use of a targeted inhibitor in the preparation of a drug for treating skin melanoma. The present invention finds that skin melanoma can be treated by targeted silencing of PIEZO1 protein. Targeted silencing of PIEZO1 can not only inhibit the proliferation, migration and invasion of melanoma cells in vitro, but also inhibit the occurrence and development of melanoma in vivo. At the same time, interfering RNA targeting PIEZO1 ion channel protein is proposed as a melanoma inhibitor. The present invention achieves targeted silencing of PIEZO1 based on gene editing methods, and has good clinical application value for the early treatment of skin melanoma.

Description

Technical field:

[0001] The present invention relates to the field of biomedicine, and in particular to application of a targeted inhibitor in the preparation of a drug for treating skin melanoma. Background technology:

[0002] Cutaneous malignant melanoma (CMM) is a highly malignant tumor originating from melanocytes in the skin. It is the "king of cancers" with the highest malignancy and the worst prognosis among skin tumors. According to statistics from the GLOBOCAN2020 database, there were approximately 325,000 new cases of cutaneous malignant melanoma and 57,000 deaths worldwide in 2020. It is estimated that by 2040, the number of new cases will increase to approximately 510,000 and the number of deaths will increase to 96,000. The global incidence of CMM has increased significantly in the past decade, especially in people with fair skin.

[0003] Faced with this severe medical challenge, surgical resection combined with sentinel lymph node biopsy is still the main treatment for CMM. However, for some patients who are difficult to remove surgically, have poor physical condition or have distant metastasis, molecular targeted therapy, immune checkpoint inhibitors and chemoradiotherapy become the hope for these patients to survive. Unfortunately, although there are molecular targeted drugs BRAF inhibitors and MEK inhibitors for specific gene mutations (such as BRAF mutations), many patients develop drug resistance and off-target effects after 5 to 7 months of treatment, leading to disease progression. Although immunotherapy has made some progress in cutaneous melanoma, not all CMM patients respond to immunotherapy, and immunotherapy may bring certain side effects. Traditional chemotherapy and radiotherapy are often ineffective and have large adverse reactions, and the prognosis of patients is poor.

[0004] The PIEZO family includes two members, PIEZO1 and PIEZO2. Unlike PIEZO2, which is mainly located in sensory neurons, PIEZO1 is mainly present in non-neural tissues, such as the skin, lungs, bladder, gastrointestinal tract, etc. As a mechanical signal receptor, PIEZO1 plays an important role in regulating skin physiological processes and the occurrence and development of various skin diseases. At the same time, PIEZO1 mediates mechanical signals to affect tumor invasion and metastasis, plays a pro-cancer role in various tumors (colon cancer, gastric cancer, osteosarcoma, etc.), and affects cell migration. Relevant literature has confirmed that the migration speed of melanoma cells knocked out by PIEZO1 is reduced. Therefore, PIEZO1 protein is a key ion channel protein that mediates the progression of melanoma lesions under mechanical stimulation. Based on the complexity of skin melanoma and the difficulties encountered in current clinical treatment, it is urgent to conduct in-depth research on the key pathogenic factors of skin melanoma, find potential effective therapeutic targets, and provide more theoretical basis and methodological support for solving the treatment dilemma of CMM. Summary of the invention:

[0005] 1. Technical issues to be solved

[0006] In view of the defects in the current melanoma treatment technology, the present invention provides an application of a targeted inhibitor in the preparation of a drug for treating skin melanoma. By studying the key pathogenic factors of skin melanoma, it is found that inhibiting the expression of PIEZO1 protein can effectively inhibit the occurrence and development of melanoma, proving that PIEZO1 ion channel protein is a potential effective therapeutic target for melanoma, and provides a targeted inhibitor that effectively inhibits melanoma, solving the problem that the existing technology lacks effective targeted drugs for the treatment of melanoma.

[0007] (II) Technical solution

[0008] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0009] A use of a targeted inhibitor in the preparation of a drug for treating skin melanoma, wherein the targeted inhibitor is an inhibitor that inhibits the expression of PIEZO1 protein.

[0010] Furthermore, the inhibitor includes interfering RNA of PIEZO1 ion channel protein, and the interfering RNA includes small interfering RNA, i.e., siRNA; and short hairpin RNA, i.e., shRNA. There are three types of siRNA, i.e., siRNA-1, siRNA-2 and siRNA-3:

[0011] The siRNA-1 sequence is shown in SEQ ID NO.1 in the sequence table,

[0012] Specifically: GGGACTGCCTCATTCTGTA;

[0013] The siRNA-2 sequence is shown in SEQ ID NO.2 in the sequence table.

[0014] Specifically: GGCAGCGCATGAACTTTCT;

[0015] The siRNA-3 sequence is shown in SEQ ID NO.3 in the sequence table.

[0016] Specifically: GCAGCATGACAGACGACAT;

[0017] The nucleotide sequence of the shRNA is shown in SEQ ID NO.4 in the sequence list, specifically:

[0018] CGGATAAAACTAAGATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGTTAATTAATCGAGCGGCCGCCCCTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATT GGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGGGCAGCAT GACAGACGACATCTCGAGATGTCGTCTGTCATGCTGCTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGGATCCTAACCCGTGTCGGCTCCAACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT ACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCTCCCCACCCCCAATTTTGTATTTATTTTTTAATTATTTTGTGCAGCGATGGGC.

[0019] Among them, the underlined sequence in the above sequence is:

[0020] CCGGGCAGCATGACAGACGACATCTCGAGATGTCGTCTGTCATGCT GCTTTTT is the insertion sequence, and the rest are vector sequences.

[0021] Furthermore, the interfering RNA of the PIEZO1 protein also includes a PIEZO1 inhibitory lentivirus, in which the interfering RNA of the PIEZO1 protein is recombinant.

[0022] Furthermore, the present invention also provides the use of an inhibitor of PIEZO1 protein expression in the preparation of a drug for inhibiting the proliferation, migration and invasion of melanoma cells.

[0023] Furthermore, the present invention also provides the use of an inhibitor of PIEZO1 protein expression in the preparation of a drug for inhibiting melanoma tumor growth in vivo.

[0024] After the present invention targeted and silenced the PIEZO1 protein through RNA interference technology, the proliferation, migration and invasion ability of melanoma cells were significantly reduced. In vivo experiments on tumor-bearing nude mice found that the weight and size of the tumors of nude mice with targeted silencing of PIEZO1 were significantly reduced. Therefore, targeting the PIEZO1 ion channel protein in tumor cells can be used as a potential target for skin melanoma and for the treatment of skin melanoma.

[0025] The following three experimental methods were used:

[0026] (1) RNA interference technology (RNAi)

[0027] (2) Cell proliferation, migration and invasion detection technology

[0028] (3) In vivo detection technology in tumor-bearing nude mice

[0029] (III) Beneficial effects

[0030] The beneficial effects produced by the present invention are:

[0031] The present invention finds that skin melanoma can be treated by targeted silencing of PIEZO1 protein. Targeted silencing of PIEZO1 can not only inhibit the proliferation, migration and invasion of melanoma cells in vitro, but also inhibit the occurrence and development of melanoma in vivo. At the same time, interfering RNA targeting PIEZO1 ion channel protein is proposed as a melanoma inhibitor. The present invention achieves targeted silencing of PIEZO1 based on gene editing methods, and has good clinical application value for the early treatment of skin melanoma. Description of the drawings:

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below.

[0033] Figure 1 Diagram of the structure of the lentiviral vector for targeted silencing of PIEZO1.

[0034] Figure 2 The figures are validation diagrams of the effect of siRNA silencing PIEZO1; A is the silencing effect of siRNA at the mRNA level detected by RT-qPCR; B is the silencing effect of siRNA at the protein level detected by WB.

[0035] (****P<0.001)

[0036] Figure 3 This is a diagram showing the morphological changes in skin melanoma A2058 cells before and after shRNA silencing of PIEZO1.

[0037] Figure 4 The expression of PIEZO1 was silenced by shRNA; A was detected by RT-qPCR to detect the silencing effect of shRNA at the mRNA level; B was detected by WB to detect the silencing effect of shRNA at the protein level. (*P<0.05; ****P<0.001)

[0038] Figure 5The effect of silencing / activating PIEZO1 on the proliferation of melanoma cells A2058; A is the CCK8 method to detect cell proliferation activity; B is the EdU method to detect cell proliferation activity; C is the statistical analysis of EdU positive cells. (*P<0.05; **P<0.01; ***P<0.005)

[0039] Figure 6 The effect of silencing / activating PIEZO1 on the clone-forming ability of melanoma cells A2058; A is the plate cloning experiment to detect the clone-forming ability of cells; B is the statistical analysis of clone counting.

[0040] (**P<0.01)

[0041] Figure 7 The effect of silencing / activating PIEZO1 on the migration ability of melanoma cells A2058.

[0042] (****P<0.001)

[0043] Figure 8 The effect of silencing / activating PIEZO1 on the invasion ability of melanoma cells A2058.

[0044] (****P<0.001)

[0045] Fig. 9 These are images of the in situ and metastatic tumors in the feet of tumor-bearing mice using an in vivo imaging device.

[0046] Fig.10 This is the analysis of the fluorescence imaging results of in situ melanoma tumors in tumor-bearing mice. A is the analysis of the size of the in situ tumor base; B is the analysis of the fluorescence intensity of the in situ tumor. (**P<0.01)

[0047] Fig.11 This is a gross specimen of a melanoma tumor in the foot of a tumor-bearing mouse.

[0048] Fig.12 The weight analysis and tumor weight analysis of tumor-bearing nude mice between groups; A is the baseline weight chart of tumor-bearing nude mice; B is the tumor weight analysis between groups. (***P<0.005; ****P<0.001) Specific implementation method:

[0049] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0050] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0051] In the following examples, the main reagent information is detailed in Table 1, the main instrument and equipment information is detailed in Table 2, and the main antibody information is detailed in Table 3.

[0052] Table 1

[0053] Reagent name Reagent Manufacturers Production location DMEM high glucose medium Thermo Fisher Scientific Gibco USA MEM medium Thermo Fisher Scientific Gibco USA Modified RPMI-1640 medium Thermo Fisher Scientific Hydrone USA DMEM low glucose medium Thermo Fisher Scientific Gibco USA Fetal bovine serum Thermo Fisher Scientific Gibco USA 0.25% Trypsin-EDTA digestion solution Solebow Biotechnology Co., Ltd. China 100× Penicillin-Streptomycin Solution BioSky Biotech China Transfection reagent (Lipo8000) BioSky Biotech China PIEZO1 siRNA RiboBio Co., Ltd. China PIEZO1 shRNA lentivirus Jikai Gene Chemical Technology Co., Ltd. China

[0054] Table 2

[0055] Instrument Name Instrument Model Instrument Manufacturer Laser confocal microscopy A1 Nikon Instruments Co., Ltd. (Japan) Small Animal In Vivo Imager Bruker Germany

[0056] Table 3

[0057] Antibody Name Antibody Manufacturers Origin PIEZO1 (rabbit source) Mitaka Proteintech China

[0058] In the present invention, the inhibitor preferably includes interfering RNA targeting silencing PIEZO1. The nucleotide sequence of the interfering RNA targeting silencing PIEZO1 is screened from three groups of siRNAs, and the sequence information of the three groups of siRNA primers is shown in Table 4.

[0059] The three groups of siRNA are siRNA-1, siRNA-2 and siRNA-3:

[0060] The siRNA-1 sequence is shown in SEQ ID NO.1 in the sequence list.

[0061] SEQ ID NO.1: GGGACTGCCTCATTCTGTA;

[0062] The sequence of siRNA-2 is shown in SEQ ID NO.2 in the sequence list.

[0063] SEQ ID NO.2: GGCAGCGCATGAACTTTCT;

[0064] The siRNA-3 sequence is shown in SEQ ID NO.3 in the sequence list.

[0065] SEQ ID NO.3: GCAGCATGACAGACGACAT;

[0066] In this example, after verifying the silencing effects of the above three groups of siRNAs by RT-qPCR and WB, siRNA-3 with the best silencing effect of PIEZO1 was screened for subsequent shRNA preparation.

[0067] In this example, the shRNA lentiviral synthetic sequence of the PIEZO1 gene adopts the above-mentioned siRNA-3, and the sequence is GCAGCATGACAGACGACAT.

[0068] The nucleotide sequence of the shRNA is shown in SEQ ID NO.4 in the sequence list, specifically:

[0069] CGGATAAAACTAAGATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGTTAATTAATCGAGCGGCCGCCCCTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATT GGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGGGCAGCAT GACAGACGACATCTCGAGATGTCGTCTGTCATGCTGCTTTTT GAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGGATCCTAACCCGTGTCGGCTCCAACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGG TGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGC.

[0070] Among them, the underlined sequence in the above sequence is:

[0071] CCGGGCAGCATGACAGACGACATCTCGAGATGTCGTCTGTCATGCT GCTTTTT is the insertion sequence, and the rest are vector sequences.

[0072] In the present invention, the inhibitor preferably also includes a PIEZO1 inhibitory lentivirus, and the PIEZO1 inhibitory lentivirus preferably contains an interfering RNA recombinant with the PIEZO1 gene, such as Figure 1 As shown; In the present invention, the PIEZO1 inhibition lentivirus includes an initial lentiviral vector,

[0073] The initial lentiviral vector element sequence is preferably hU6-MCS-CBh-gcGFP-IRES-puromycin;

[0074] More preferably, the interfering RNA of the PIEZO1 protein is recombined between the AgeI and EcoRI restriction sites of the initial lentiviral vector, such as Figure 1 In the present invention, after the interfering RNA or PIEZO1 inhibition lentivirus targeting silencing PIEZO1 is transferred into cells, the expression of PIEZO1 gene and protein level can be reduced, thereby achieving the treatment of skin melanoma.

[0075] The present invention also provides the use of an inhibitor of PIEZO1 protein expression in the preparation of a drug for inhibiting the proliferation, migration and invasion of skin melanoma cells. The present invention has no special limitation on the inhibitor of PIEZO1 protein expression, as long as it can inhibit the expression of PIEZO1 protein; the present invention introduces the inhibitor of PIEZO1 protein expression into skin melanoma cells, and inhibits the proliferation, migration and invasion of skin melanoma cells by reducing the expression of PIEZO1 gene and protein level in the skin melanoma cells, thereby achieving the treatment of skin melanoma.

[0076] The present invention also provides the use of inhibitors of PIEZO1 gene and protein expression levels in the preparation of drugs for inhibiting the growth of tumors in vivo. The present invention uses an animal in vivo tumor-bearing test for detection, and the results show that targeted silencing of PIEZO1 can significantly inhibit the growth of tumors in vivo, especially under external mechanical pressure stimulation. This inhibitory effect is more obvious.

[0077] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0078] Example 1: RNA interference technology targeted silencing PIEZO1

[0079] 1. Design of interfering RNA screening for PIEZO1 gene and preparation of PIEZO1 silencing lentivirus

[0080] (1) The PIEZO1 gene siRNA intervention fragment plasmid was purchased from Ruibo Biotechnology Co., Ltd. (Guangzhou) and used after being verified to be effective. The details are as follows:

[0081] Table 4 siRNA primer sequence information

[0082]

[0083] (2) Transient transfection of cells with siRNA plasmid

[0084] ① Select A2058 and A375 cells in the logarithmic growth phase for related experiments, perform routine digestion, centrifugation, and counting, and adjust the cell suspension density to 1.25×10 5 cells / ml, add 2 ml of the above density cell suspension to each well of a 6-well plate, and place the 6-well plate in a 37°C constant temperature CO2 incubator for culture;

[0085] 2Y was performed according to the reference dosage table of the Bio-Tech lipo8000 transfection siRNA product. This experiment used a 6-well plate for transfection, and the detailed transfection reagent ratio is as follows:

[0086] Reagents volume Serum-free high-glucose DMEM culture medium 125μl siRNA 100 pmol <![CDATA[Lipo8000 TM Transfection Reagents]]> 4μl Amount of mixture added to each well 125μl

[0087] ③ After the cells grow to 70% density and ensure that the cells are in good condition and the density is appropriate, carry out the following related experiments;

[0088] ④ Prepare 6 sterile 1.5ml EP tubes in advance, draw high-glucose DMEM medium and corresponding siRNA according to the above ratio, and mix them gently; this group of experiments has 3 siRNAs and corresponding negative and positive controls;

[0089] ⑤ Add lipo8000 solution to the EP tubes containing siRNA plasmids, mix gently, and incubate at room temperature in a clean bench for 20 minutes;

[0090] ⑥ Aspirate and discard the old culture medium in the wells of the six-well plate, and add 2 ml of high-glucose DMEM complete culture medium containing 10% serum into each well;

[0091] ⑦ Gently drop the transfection mixture into each well, 125 μl / well, shake gently in a cross-section method to fully mix the mixture with the culture medium, and place in an incubator for culture without changing the culture medium;

[0092] ⑧ Collect the corresponding cell RNA (after 24 hours of incubation) and protein (after 48 hours of incubation) for subsequent transfection efficiency detection.

[0093] (3) PIEZO1 gene shRNA interference target information and primer synthesis

[0094] After RT-qPCR and WB verification, siRNA-3 with the best silencing effect was screened for subsequent shRNA preparation.

[0095] The synthetic sequence of PIEZO1 lentivirus is GCAGCATGACAGACGACAT.

[0096] The NC control synthetic sequence is TTCTCCGAACGTGTCACGT.

[0097] The nucleotide sequence of the PIEZO1 silencing lentiviral shRNA is:

[0098] CGGATAAAACTAAGATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGTTAATTAATCGAGCGGCCGCCCCTCACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATT GGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGGGCAGCATGACAG ACGACATCTCGAGATGTCGTCTGTCATGCTGCTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACGGATCCTAACCCGTGTCGGCTCCAACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT ACGCCCCCTATTGACGTCCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCTCCCCACCCCCAATTTTGTATTTATTTTTTAATTATTTTGTGCAGCGATGGGC

[0099] Among them, the underlined sequence in the above sequence is:

[0100] CCGGGCAGCATGACAGACGACATCTCGAGATGTCGTCTGTCATGCT GCTTTTT is the insertion sequence, and the rest are vector sequences.

[0101] (4)PIEZO1 shRNA silencing plasmid (GV493) was purchased from GeneCare Company.

[0102] Lentiviral vector structure diagram Figure 1 shown.

[0103] 2. Construction of PIEZO1 gene silencing cell line

[0104] (1) RT-qPCR validation of five skin melanoma cells (A2058, A375, Sk-mel-2, Sk-mel-28, MUM-2B) revealed that PIEZO1 protein was expressed at a relatively high level in A2058 and A375 cells, and the expression of PIEZO1 protein was inhibited in these two cell types. The PIEZO1 silencing shRNA lentivirus constructed earlier was used to transfect the two cell types, and a stable protein expression-inhibited cell line was prepared.

[0105] (2) The specific steps of transfection are as follows:

[0106] ① Preparation: Wear protective clothing, masks, hats and gloves during the operation, and perform the operation in a sterile biosafety cabinet qualified for lentiviral transfection;

[0107] ② Pre-infection experiment of adherent cells: To determine the multiplicity of infection index (MOI) and optimal infection conditions of lentivirus to cells, improvements were made according to the operation manual of GeneCare lentivirus. Groups were set up: M group was a conventional culture medium group, A group was a conventional culture medium + HiTransGA group, P group was a conventional culture medium + HiTransG P group, and Control group. Use complete culture medium to prepare 2 ml of 5x10 4 Take 100 μl / well of the cell suspension of 100 μg / ml and add it to 96-well plates, a total of 12 wells, 3 replicates per group, and culture at 37°C for 24 h until the cell confluence reaches 30%. Take out the virus and thaw it on ice, and dilute the virus to 2×10 7 TU / ml, 1×10 7 TU / ml, 5×10 6 TU / ml, 50μl each. Wash out the culture medium in each group of wells, replace the culture medium according to the table, add the corresponding virus and infection enhancement solution, mix well and continue to culture and observe. Determine the infection results under a fluorescence microscope 72 hours after infection.

[0108]

[0109] ③Formal cell infection: 3 groups were set up: Control group, shPIEZO1 group, and shNC group. A2058 and A375 cells were routinely digested 24 hours before transfection, and the cell density was adjusted to about 5×10 using complete culture medium. 4 cells / ml, re-inoculated into a 6-well plate and placed in a 37°C constant temperature CO2 incubator for overnight culture; the next day, the inoculated cells were observed under a microscope to be in good growth condition, and the cell density was observed to be around 30% for subsequent lentiviral transfection.

[0110] ④ The optimal infection conditions were found to be:

[0111]

[0112] ⑤ Puromycin screening: Culture at 37℃ for 12h, replace with complete medium, and continue to culture. Observe the infection efficiency 72 hours after infection. When the cell confluence reaches 80%, give complete medium containing 5ug / ml puromycin to continue stable strain screening. Replace the complete medium containing puromycin every 3-4 days until the cells of the Control group that are not infected with the virus are killed by puromycin, and no cells in the shPIEZO1 group and shNC group infected with the virus die. Observe the GFP fluorescent marker carried by the virus vector under a fluorescence microscope. When the fluorescence efficiency reaches 100%, the subsequent screening of mixed clone stable strains can be carried out. Reduce the puromycin concentration to the maintenance concentration (2ug / ml), continue to screen and amplify the infected cells, and collect the cells for qPCR or Western Blot identification, and freeze the cells with normal identification results for seed preservation for subsequent experiments.

[0113] 3. Verification of the efficiency of siRNA and shRNA silencing PIEZO1 expression in two cell lines.

[0114] PIEZO1 was transiently silenced by siRNA plasmid transfection technology. RT-qPCR and WB detection technology were used to verify the siRNA silencing effect. The results are as follows Figure 2 As shown in AB: The three pairs of siRNAs all had significant silencing effects on PIEZO1 at the mRNA and protein levels.

[0115] siRNA3 with the best silencing effect was selected from the three pairs of siRNAs as the primer sequence for the subsequent shRNA. The stable cell line (shPIEZO1) with stable knockdown of PIEZO1 and the negative control stable cell line (shNC) were constructed by shRNA lentiviral transfection technology (see Figure 3 ). In terms of cell morphology, compared with the control WT cells, the morphology of A2058 cells with silenced PIEZO1 was reduced and appeared small spindle-shaped.

[0116] The silencing effect of shPIEZO1-A2058 was verified by qRT-PCR and western blot. The results showed that the shRNA could effectively silence the expression of PIEZO1 at the mRNA and protein levels (see Figure 4 ).

[0117] Example 2: Effects of targeted silencing of PIEZO1 on proliferation, migration and invasion of melanoma cells

[0118] (1) Targeted silencing of PIEZO1 can significantly inhibit the proliferation of skin melanoma cells

[0119] Through CCK8 experiments, it was found that (such as Figure 5A), when PIEZO1 was silenced, the cell proliferation activity was significantly lower than that of the NC group (*p<0.05). After Yoda1 was given to activate PIEZO1 on the basis of silenced cells, the cell proliferation activity was slightly restored compared with the silenced group (##p<0.01).

[0120] EdU cell proliferation assay (eg Figure 5 BC) The results showed that when PIEZO1 was silenced, the cell proliferation activity was significantly lower than that of the NC group. After Yoda1 was given to activate PIEZO1 on the basis of silenced cells, the cell proliferation activity was significantly restored compared with the silenced group (***p<0.005).

[0121] (2) Targeted silencing of PIEZO1 inhibits the clonal formation ability of skin melanoma cells

[0122] Through clone formation experiments (such as Figure 6 ) The results showed that when PIEZO1 was silenced, the cell clone formation ability was significantly lower than that of the NC group (**p<0.01); after different concentrations of Yoda1 were given to activate PIEZO1, it was found that the cell clone formation ability of the Yoda1-1μM group was slightly higher than that of the DMSO group, while the cell clone formation ability of the Yoda1-10μM group was significantly lower than that of the DMSO group.

[0123] (3) Targeted silencing of PIEZO1 can significantly inhibit the migration ability of skin melanoma

[0124] Transwell cell migration assay (eg Figure 7 ) The results showed that when PIEZO1 was silenced, the cell migration ability was significantly lower than that of the NC group (****p<0.001); after Yoda1-1μM was given to activate PIEZO1, it was found that the cell migration ability was significantly increased compared with the silencing group (****p<0.001).

[0125] (4) Knockdown of PIEZO1 protein can significantly inhibit the invasion of skin melanoma

[0126] Transwell cell invasion assay (eg Figure 8 ) The results showed that when PIEZO1 was silenced, the cell invasion ability was significantly lower than that of the NC group (****p<0.001); after Yoda1-1μM was given to activate PIEZO1, it was found that the cell invasion ability was significantly increased compared with the silencing group (****p<0.001).

[0127] Example 3: Effect of targeted silencing of PIEZO1 on tumor growth in tumor-bearing nude mice

[0128] Targeted silencing of PIEZO1 inhibits in situ proliferation of cutaneous melanoma

[0129] Healthy male BALb / c nu nude mice aged 5 weeks were purchased from Hubei Baient Biotechnology Co., Ltd., and 50 μL of A2058 shNC and A2058 shPIEZO1 melanoma cell suspensions were subcutaneously injected into the left foot of the nude mice. The experimental design was to observe the subcutaneous tumor formation and growth status of the nude mice every 5 days. After the visible mass appeared in the tumor-bearing site, the length and width of the mass were measured with a ruler and recorded; the experiment was terminated when the maximum long diameter of most tumors was greater than 1.0 cm; the weight of the mice and the proliferation rate of the tumor were statistically analyzed.

[0130] In addition, the foot mechanical compression stimulation model uses magnet suction compression modeling, using a pair of Haolixing round magnets (diameter 12mm × thickness 5mm) and a standard 1kg (i.e., 10N) magnetic sheet as a backup; after sedation and hypnosis by intraperitoneal injection of 1% pentobarbital, the tumor-bearing foot of the nude mouse was fixed in the center of two standard magnetic sheets and given magnetic suction mechanical compression stimulation for 5 minutes, once a week for 3 consecutive times.

[0131] Animal in vivo experiments have shown that in vivo imaging of tumor-bearing nude mice (see Fig. 9 The results showed that the number of nude mouse tumors after shRNA silencing PIEZO1 was significantly reduced compared with the shNC group.

[0132] Further statistical analysis of the detection results of in situ tumors in nude mice in vivo revealed that compared with the shNC group, the base area and fluorescence intensity (both of which replaced the tumor size to varying degrees) of the in situ tumors in nude mice after shRNA silencing of PIEZO1 were significantly reduced (see Fig.10 ). This result confirmed that targeted silencing of PIEZO1 had a significant inhibitory effect on the in situ proliferation of skin melanoma cells in vivo, and its phenotype was consistent with the cell proliferation function test.

[0133] At the same time, the nude mice in situ and metastatic tumors were dissected (see Fig.11 ), the results showed that the size and number of tumors in nude mice after shRNA targeted silencing of PIEZO1 were significantly reduced compared with those in the shNC group, especially in the mechanical compression group.

[0134] Further statistical analysis found that there was no difference in the baseline body weight of nude mice between the groups (see Fig.12 A), the tumor weight of nude mice after shRNA targeted silencing of PIEZO1 was significantly reduced compared with the shNC group (see Fig.12 B).

[0135] In summary, the present invention provides an application of a targeted inhibitor in the preparation of a drug for treating skin melanoma. By studying the key pathogenic factors of skin melanoma, it is found that inhibiting the expression of PIEZO1 protein can effectively inhibit the occurrence and development of melanoma, proving that PIEZO1 ion channel protein is a potential effective therapeutic target for melanoma, and provides a targeted inhibitor that effectively inhibits melanoma, solving the problem that the prior art lacks effective targeted drugs for the treatment of melanoma.

[0136] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and are not intended to limit the protection scope of the present invention. In addition, after reading the technical content of the present invention, those skilled in the art may make various changes, modifications or variations to the present invention, and all of these equivalent forms also fall within the protection scope defined by the present application.

Claims

1. Use of a targeted inhibitor in the preparation of a drug for treating skin melanoma, characterized in that: The targeted inhibitor is an inhibitor that inhibits the expression of PIEZO1 protein, the inhibitor is selected from the interfering RNA of PIEZO1 protein, the interfering RNA is selected from siRNA or shRNA, and the siRNA is selected from one of siRNA-1, siRNA-2 or siRNA-3; The nucleotide sequence of the siRNA-1 is: GGGACTGCCTCATTCTGTA; The nucleotide sequence of the siRNA-2 is: GGCAGCGCATGAACTTTCT; The nucleotide sequence of the siRNA-3 is: GCAGCATGACAGACGACAT; The nucleotide sequence of the shRNA is: CCGGGCAGCATGACAGACGACATCTCGAGATGTCGTCTGTCATGCTG CTTTTT.

2. The use according to claim 1, characterized in that: The interfering RNA of the PIEZO1 protein also includes a PIEZO1 inhibitory lentivirus, in which the interfering RNA of the PIEZO1 protein is recombined.

3. Use of the inhibitor of PIEZO1 protein expression as claimed in claim 1 in the preparation of a drug for inhibiting proliferation, migration and invasion of melanoma cells.

4. Use of the inhibitor of PIEZO1 protein expression as claimed in claim 1 in the preparation of a drug for inhibiting melanoma tumor growth in vivo.

Images