A β-glucosidase mutant for producing rare ginsenoside CK and its application

Abstract

The present invention relates to a β-glucosidase mutant for producing rare ginsenoside CK and its application, belonging to the field of enzyme engineering technology. The present invention provides a β-glucosidase mutant for producing rare ginsenoside CK, the β-glucosidase mutant has at least 90% nucleotide sequence identity with SEQ ID NO.1, and comprises at least one of the following mutations: the mutation site of the β-glucosidase mutant includes at least one of the 229th and 232nd positions of SEQ ID NO.1 or a corresponding position, and one or more amino acid residues are replaced, inserted or deleted at the mutation site. The present invention prepares a β-glucosidase mutant by analyzing the existing β-glucosidase and determining the mutation site of the β-glucosidase SA0236 derived from Flavobacterium saccharophilum, which can significantly improve the efficiency of converting ginsenoside Rb1 and ginsenoside Rd into ginsenoside CK.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, and in particular to a beta-glucosidase mutant for producing rare ginsenoside CK and application thereof. Background Art

[0002] Rare ginsenoside CK exhibits a variety of important biological activities and pharmacological effects in the field of human health. Commonly used methods for transforming rare ginsenosides include physical methods (microwaves, heating, etc.), chemical methods (acid hydrolysis, alkaline hydrolysis, etc.), and biological transformation methods. The physical and chemical methods are simple to operate and suitable for industrial production, but they cannot selectively hydrolyze sugar groups, and the reactions are violent, which can easily cause side reactions and produce many by-products. The biological transformation methods mainly include enzyme-catalyzed reactions and microbial transformations. The enzyme transformation method uses high-content inherent ginsenosides as substrates and uses specific enzymes to hydrolyze monosaccharide residues step by step. It has the advantages of high selectivity, mild reaction conditions, and high conversion rate. The microbial method can transform a variety of substrates under controllable fermentation conditions, with low costs and often produces complex enzyme systems.

[0003] At present, researchers have screened microbial strains with efficient conversion capabilities, such as specific types of bacteria and fungi, and used the enzymes produced during their fermentation process to convert ginsenosides. Many microorganisms have been proven to have the ability to convert ginsenosides into rare ginsenoside CK, and many enzymes with the ability to convert ginsenosides have been successfully isolated, such as α-L-arabinofuranosidase, β-glucosidase, etc. However, in the process of using microbial fermentation to prepare ginsenoside CK, high water quality requirements are required, and it is sensitive to environmental factors such as temperature and pH, and sensitive to toxic substances. The anaerobic reactor has a long startup time, the reaction process is relatively complicated, and various reaction conditions need to be strictly controlled, making it difficult to achieve industrial production. The quality of ginsenoside CK prepared from different batches is unstable. At the same time, some microorganisms also need to be induced by IPTG for expression, and the residue of IPTG may cause harm to the human body. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a β-glucosidase mutant for producing rare ginsenoside CK and its application.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] In the first aspect, the present invention provides a β-glucosidase mutant for producing rare ginsenoside CK, wherein the β-glucosidase mutant has at least 90% nucleotide sequence identity with SEQ ID NO.1 and comprises at least one of the following mutations: the mutation site of the β-glucosidase mutant includes at least one of positions 229 and 232 of SEQ ID NO.1 or corresponding positions, and one or more amino acid residues are substituted, inserted or deleted at the mutation site.

[0007] The present invention differentially analyzes the conserved domains of existing β-glucosidases, and based on reported active centers, determines that the mutation sites of β-glucosidase SA0236 from Flavobacterium saccharophilum are 229 and 232, and prepares a β-glucosidase mutant by site-directed mutagenesis using gene editing technology, which can significantly improve the efficiency of converting ginsenoside Rb1 into ginsenoside CK, and can also convert ginsenoside CK using ginsenoside Rd as a precursor.

[0008] As a preferred embodiment of the β-glucosidase mutant of the present invention, the mutation is a substitution mutation, comprising substitution of at least one of the following amino acid residues:

[0009] Isoleucine at position 229 is substituted for phenylalanine; or valine at position 232 is substituted for glutamic acid.

[0010] As a preferred embodiment of the β-glucosidase mutant of the present invention, the mutation comprises substitution of isoleucine at position 220 for phenylalanine and substitution of valine at position 232 for glutamic acid.

[0011] In a second aspect, the present invention provides a polynucleotide encoding the above-mentioned β-glucosidase mutant.

[0012] In a third aspect, the present invention provides an expression vector comprising the above-mentioned polynucleotide.

[0013] In a fourth aspect, the present invention provides a recombinant cell, comprising the above-mentioned polynucleotide or expression vector.

[0014] As a preferred embodiment of the recombinant cell of the present invention, the recombinant cell comprises Escherichia coli.

[0015] In a fifth aspect, the present invention provides the use of the above-mentioned β-glucosidase mutant in the preparation of rare ginsenoside CK.

[0016] In a sixth aspect, the present invention provides the use of the above-mentioned recombinant cells in the preparation of rare ginsenoside CK. In a seventh aspect, the present invention provides a production process for ginsenoside CK, comprising the following steps: reacting the above-mentioned β-glucosidase mutant with a precursor of ginsenoside CK to obtain ginsenoside CK. As a preferred embodiment of the production process of the present invention, the precursor of ginsenoside CK includes at least one of ginsenoside Rb1, ginsenoside Rd and ginsenoside F2. Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. The present invention differentially analyzes the conserved domains of existing β-glucosidases, and based on the reported active centers, determines that the mutation sites of β-glucosidase SA0236 from Flavobacterium saccharophilum are 229 and 232, and prepares β-glucosidase mutants by site-directed mutagenesis using gene editing technology, which can significantly improve the efficiency of converting ginsenoside Rb1 into ginsenoside CK, and can also convert ginsenoside CK using ginsenoside Rd as a precursor.

[0018] 2. The β-glucosidase mutant prepared by the present invention has a high conversion rate of ginsenoside CK and mild reaction conditions, and is suitable for the industrial production of ginsenoside CK. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of differential analysis of the conserved domain of the SA0236 gene in Example 1 of the present invention;

[0020] Figure 2 is the map of the pET28a(+)-SA0236-F229I-E232V plasmid in Example 1 of the present invention;

[0021] Figure 3 The SDA-PAGE electrophoresis results of the SA0236-F229I-E232V expressing cells obtained in Example 1 of Effect Example 1 of the present invention;

[0022] Figure 4 This is a flow chart of the conversion of ginsenoside CK by the β-glucosidase mutant in Effect Example 1 of the present invention;

[0023] Figure 5 It is a liquid chromatogram of the product after the conversion reaction of ginsenoside CK in Effect Example 1 of the present invention;

[0024] Figure 6 This is the HPLC-MS / MS graph of ginsenoside CK in Effect Example 1 of the present invention. DETAILED DESCRIPTION

[0025] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0026] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments and effect examples can be obtained from commercial sources.

[0027] The cloning or preservation plasmid vector strain used in the following examples and effect examples is Escherichia coli DH5α, and the expression host strain is Escherichia coli BL21 (DE3), both of which were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0028] LB medium (for DH5α and BL21 culture): 5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, sterilized at 121°C for 20min; if prepared as solid medium, add 15-20g / L agar powder. If it is necessary to prepare a medium containing kanamycin, add kanamycin at a final concentration of 30mg / L.

[0029] LBR medium (for large-scale fermentation): 5 g / L yeast powder, 10 g / L peptone, 10 g / L sodium chloride, 1 g / L lactose, sterilized at 121°C for 20 min.

[0030] SOC medium (for DH5α and BL21 transformation): 20 g / L tryptone, 5 g / L yeast extract, 0.5 g / L sodium chloride, 10 mL 250 mM potassium chloride solution, 10 mL 20 mM glucose solution, 10 mL 10 mM magnesium chloride, sterilize at 121°C for 20 min; if prepared as solid culture medium, add 15-20 g / L agar powder.

[0031] High-fidelity PCR mix was purchased from Sangon Biotech (Shanghai) Co., Ltd. with a catalog number of B639300. The PCR amplification system is shown in Table 1 , and the amplification conditions are shown in Table 2 .

[0032] Table 1 PCR amplification system

[0033]

[0034] Table 2 PCR amplification conditions

[0035]

[0036] Plasmid extraction kit, DNA purification kit, and gel recovery kit were purchased from Tiangen Biochemical Technology Co., Ltd.

[0037] In the following examples and effect examples, the culture, storage and competent transformation methods of DH5α and BL21 are as follows:

[0038] 1. Cultivation: Select the strain and streak or spread it on a solid LB plate with corresponding resistance, then invert and culture it in a constant temperature incubator at 37°C for 12-16 hours, perform colony PCR identification or seal it with sealing film and store it inverted in a refrigerator at 4°C;

[0039] Pick a freshly recovered E. coli single clone from the LB solid medium plate, inoculate it into a certain volume of LB liquid medium, add corresponding resistance as needed, and culture it at 37°C and 220rpm for 12-16h;

[0040] 2. Storage: Take 500 μL of fresh overnight culture seed solution, add it to a cryovial containing 500 μL of 50 v / v% sterilized glycerol, and store it in a -80°C ultra-low temperature refrigerator;

[0041] 3. Transformation: Add the transformation system to the BL21 competent medium melted on ice, ice bath for 30 minutes, heat shock at 42℃ for 90 seconds, ice bath again for 2 minutes, then add 900μL of SOC medium preheated at 37℃, and culture at 37℃, 220rpm for 45min; take 100μL of bacterial solution and add it to LB solid medium containing corresponding antibiotics, culture at 37℃ for 12-16h, pick a certain number of clones from the plate for colony PCR identification, and streak them onto the corresponding plates, and culture at 37℃ for 12-16h for use.

[0042] The obtained plasmid was transformed into BL21 competent cells, and cloned PCR amplification and agarose gel electrophoresis were performed using corresponding primers. After positive transformants were identified, they were stored or activated according to the above method for future use;

[0043] 2×Rapid Taq Master Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd. with the catalog number P222-01. The PCR amplification system is shown in Table 4 , and the amplification conditions are shown in Table 5 ;

[0044] Clone PCR identification method: pick a single transformant into the PCR reaction solution and perform PCR reaction; agarose gel electrophoresis is performed according to the operation in "Molecular Biology Experiment".

[0045] Table 3 Homologous recombination ligation system

[0046] Reagents Dosage 5×CE II Buffer 2μL Exnase II 1μL Vector DNA 0.03pmol Fragmented DNA 0.03 / 0.06pmol <![CDATA[ddH2O]]> Make up to 10 μL

[0047] Table 4 Cloning PCR amplification system

[0048] Reagents Dosage 2× Rapid Taq Master Mix 25μL 10 μM upstream primer 2μL 10 μM downstream primer 2μL <![CDATA[ddH2O]]> Make up to 50 μL

[0049] Table 5 Cloning PCR amplification conditions

[0050]

[0051] Ginsenoside Rb1 was purchased from Shaanxi Jinkangtai Biotechnology Co., Ltd.

[0052] Example 1

[0053] An embodiment of the present invention is a β-glucosidase mutant for producing rare ginsenoside CK, wherein the method for constructing the β-glucosidase mutant comprises the following steps:

[0054] Determination of mutation site of β-glucosidase SA0236

[0055] 1.1 Obtain four reported β-glucosidase sequences that can catalyze CK production: BbBgl (GenBank No. CP006715.1), BgpA (GenBank No. GU196785.3), Bgp3 (GenBank No. JN603821.1), and L213A (GenBank No. AAC25555.1) from the public database of NCBI;

[0056] 1.2 Detect conserved domains in the protein sequences of SA0236, BbBgl, BbBgl, Bgp3, and L213A by CD-search in NCBI (http: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi);

[0057] 1.3 Use CLC Genomics Workbench software to align the conserved domains of SA0236, BbBgl, BbBgl, Bgp3, and L213A, and find out the differences between the conserved domains of SA0236 and BbBgl, BbBgl, Bgp3, and L213A. The difference analysis is as follows Figure 1 As shown, based on the reported active center, the mutation site of the SA0236 gene was finally locked, and the phenylalanine (Phe, F) at position 229 was mutated to isoleucine (Ile, I), and the glutamic acid (Glu, E) at position 232 was mutated to valine (Val, V).

[0058] 2 Construction of recombinant cells expressing β-glucosidase mutants

[0059] 2.1 Entrust GenScript Biotech Co., Ltd. to perform codon optimization on β-glucosidase SA0236 from Flavobacterium saccharophilum to obtain plasmid pET28a(+)-SA0236 containing the optimized SA0236 sequence;

[0060] 2.2 Using the pET28a(+)-SA0236 plasmid obtained in step 2.1 as a template, primer pair SA0236-TB-F / R was used for amplification to obtain the SA0236-F229I-E232V fragment. The nucleotide sequence of SA0236-F229I-E232V is shown in SEQ ID NO.2;

[0061] 2.3 The initial template pET28a(+)-SA0236 remaining after PCR amplification in step 2.2 was treated with restriction endonuclease Dpn I, and the mutant pET28a(+)-SA0236-F229I-E232V linearized fragment was obtained by gel recovery;

[0062] 2.4 The linearized pET28a(+)-SA0236-F229I-E232V fragment obtained in step 2.3 was transformed into the DH5α strain. After screening and sequencing, the plasmid was extracted to obtain the pET28a(+)-SA0236-F229I-E232V plasmid. The plasmid map is shown in Figure 2 ;

[0063] 2.5 The pET28a(+)-SA0236-F229I-E232V plasmid obtained in step 2.4 was transformed into BL21, and positive transformants were screened using T7-F / R identification. The positive transformants obtained were the β-glucosidase mutant SA0236-F229I-E232V expression strain;

[0064] 2.6 Activate the SA0236-F229I-E232V expression strain obtained in step 2.5 on LB solid medium and culture at 37°C for 12-16h to obtain an activated strain;

[0065] 2.7 Pick the activated strain obtained in step 2.6 and inoculate it into 10 mL of LB liquid culture medium containing kanamycin, and culture it at 37°C and 180 rpm for 12-16 hours to obtain a bacterial solution;

[0066] 2.8 The bacterial solution obtained in step 2.7 was centrifuged at 4°C and 8000 rpm for 5 min, the bacteria were collected, 1 mL of 100 mM phosphate buffer (pH = 8.0) was added to resuspend the bacteria, and the bacteria were ultrasonically disrupted for 10 min at 160W and 3s, and centrifuged at 12000 rpm for 10 min. The obtained supernatant was the β-glucosidase mutant solution;

[0067] The primer sequences used in the above steps are shown in Table 6.

[0068] Table 6 Primer sequences used to construct the β-glucosidase mutant SA0236-F229I-E232V expression strain

[0069] Primer name Primer sequence (5'-3') SA0236-TB-F cgtacaataagattcgtggtgtatacctgtgtgaaaatg SA0236-TB-R cttattgtacgcacccatgataccg T7-F taatacgactcactatagggg T7-R caaaaaacccctcaagaccc

[0070] Example 2

[0071] An embodiment of the β-glucosidase mutant of the present invention, the construction method of the β-glucosidase mutant is similar to that of Example 1, except that the fragment obtained in step 2.3 is a pET28a(+)-SA0236-E232V linearized fragment, and the other steps and parameter conditions remain unchanged.

[0072] Example 3

[0073] An embodiment of the β-glucosidase mutant of the present invention, the construction method of the β-glucosidase mutant is similar to that of Example 1, except that the fragment obtained in step 2.3 is a pET28a(+)-SA0236-F229I linearized fragment, and the other steps and parameter conditions remain unchanged.

[0074] Effect Example 1

[0075] The β-glucosidase mutant obtained in Example 1 was verified, and the specific scheme is as follows:

[0076] 1. Protein molecular weight verification.

[0077] The supernatant and precipitate obtained in step 2.8 of Example 1 were subjected to SDS-PAGE electrophoresis, and the results are shown in Figure 3 .

[0078] like Figure 3 As shown, the size of the β-glucosidase mutant obtained in Example 1 is in the range of 70-100 kDa, which is close to the expected size (81 kDa), indicating that the supernatant of the cells obtained in Example 1 contains the β-glucosidase mutant.

[0079] 2. Functional verification of β-glucosidase mutant in transforming ginsenoside CK.

[0080] Take 5 mL of the supernatant obtained in step 2.8 of Example 1 and add it to a 15 mL centrifuge tube, add 500 mg of ginsenoside Rb1 extract (the purity of ginsenoside Rb1 is 50%, and it also contains 16% ginsenoside Rd) and react according to Table 7. After the reaction, add 10 mL of 95% ethanol and mix well. Centrifuge at 8000 rpm for 15 min. Take the supernatant and dry it in an oven at 105°C. Collect the dried powder, add 2 mL of methanol and treat it under ultrasonic conditions for 30 min to obtain a reconstituted solution. The reconstituted solution was centrifuged at 12000 rpm for 15 min, and the obtained supernatant was quantified by HPLC and qualitatively analyzed by HPLC-MS. At the same time, β-glucosidase SA0236 without site-directed mutation was used as the control group, and the reaction process was as follows: Figure 4 shown.

[0081] Table 7 β-glucosidase conversion ginsenoside CK reaction system

[0082] Components parameter 100mM ginsenoside Rb1 (purity 50%) 500mg Enzymes 5mL Reaction temperature 40℃ Reaction time 8h

[0083] HPLC parameters were as follows: the chromatograph was Agilent 1260 Infinity II, the detector was a differential detector, the chromatographic column was Aminex HPX-87H (Bio-Rad), the mobile phase was acetonitrile and water containing 0.05 v / v% trifluoroacetic acid, the flow rate was 1 mL / min, the column temperature was 30°C, the injection volume was 10 μL, the elution program was: 20%-100% acetonitrile for 20 min, 100% acetonitrile for 5 min, and the liquid chromatogram was shown in Figure 5 , results in Table 8.

[0084] The HPLC-MS parameters were as follows: Electrospray ionization (ESI) was performed in positive ion mode using an ion trap mass spectrometer coupled to an ESI source using a Thermo U3000-LTQ XL (Thermo Scientific, USA) system.

[0085] HPLC, 10 μL sample was injected into a C18 column (2.1×150 mm; 2.5 μm particle size); the mobile phase for gradient elution was: acetonitrile (0.1 v / v% formic acid) as component A, water (0.1 v / v% formic acid) as component B, and the flow rate was 0.3 mL / min. The gradient elution program started with 5% A, increased A to 100% in the next 15 min, maintained at 100% A for 5 min, and returned to the initial condition (5% A) in the next 5 min;

[0086] MS, ion source is ESI source, sensitivity mode, capillary voltage is (+) 3.0 kv, (-) 2.5 kv, ion source temperature is 100 ° C, cone gas flow rate is 50 L / h, degassing flow rate is 1000 L / h, collision voltage is (low) 6 v, (high) 10-60 v, cone voltage is 30 v.

[0087] The results of HPCL-MS are shown in Figure 6 .

[0088] Table 8 Efficiency of different β-glucosidases in converting ginsenoside CK

[0089]

[0090] like Figure 5As shown in Table 8, 245.47 mg of ginsenoside Rb1 was reacted with the β-glucosidase mutant obtained in Example 1 to obtain 365.72 mg of ginsenoside CK, and the conversion rate of ginsenoside Rb1 to ginsenoside CK was 150%, which was 2.5 times the conversion rate of β-glucosidase SA0236, indicating that the β-glucosidase mutant of the present invention can significantly improve the conversion rate of ginsenoside CK. In addition, the content of ginsenoside Rd after the reaction was much lower than that of β-glucosidase SA0236, indicating that the β-glucosidase mutant of the present invention can effectively improve the conversion efficiency of ginsenoside Rb to ginsenoside CK.

[0091] like Figure 6 As shown, the [M+Na]+ peak of ginsenoside CK obtained by the reaction of the β-glucosidase mutant obtained in Example 1 is shown as: 645.800, that is, the molecular mass is 622.884, which is close to the expected size, indicating that the β-glucosidase mutant of the present invention has the activity of converting ginsenoside Rb1 into ginsenoside CK.

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A β-glucosidase mutant for producing rare ginsenoside CK, characterized in that: The nucleotide sequence of the β-glucosidase mutant is shown in SEQ ID NO.

2.

2. A polynucleotide, characterized in that The polynucleotide encodes the β-glucosidase mutant according to claim 1.

3. An expression vector, characterized in that: The expression vector comprises the polynucleotide according to claim 2.

4. A recombinant cell, characterized in that The recombinant cell comprises the polynucleotide according to claim 2 or the expression vector according to claim 3.

5. The recombinant cell according to claim 4, characterized in that The recombinant cell includes Escherichia coli.

6. Use of the β-glucosidase mutant according to claim 1 in the preparation of rare ginsenoside CK.

7. Use of the recombinant cell according to claim 4 in the preparation of rare ginsenoside CK.

8. A method for producing ginsenoside CK, characterized in that: The method comprises the following steps: reacting the beta-glucosidase mutant according to claim 1 with a precursor of ginsenoside CK to obtain ginsenoside CK.

Images