Kit for detecting brca1 / 2 gene sequence of pre-implantation embryo and application thereof

Abstract

The application provides a kit for detecting BRCA1 / 2 genes of preimplantation embryos and application thereof. The method is based on transcriptome detection, reduces the possibility of tripping, and improves the accuracy and success rate of BRCA1 / 2 gene detection in preimplantation embryo cells.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to Chinese Patent Application No. 202311166861.2, filed on September 12, 2023, which is incorporated herein by reference. Technical Field

[0003] This invention relates to the field of biomedicine, specifically to a method for treating preimplantation embryos. BRCA1 / 2 Gene sequencing kits and their applications. Background Technology

[0004] Breast cancer is one of the most common malignant tumors among women in most countries, currently accounting for 23% of all cancer types in developing countries. The World Health Organization reports that the incidence of breast cancer is increasing at a rate of 2% per year. A 2015 survey indicated that approximately 260,000 new cases of breast cancer are diagnosed annually, resulting in about 70,000 deaths each year. Research has found that 10-15% of breast cancers are caused by genetic mutations, a phenomenon that was already being addressed in the 1990s. BRCA1, BRCA2 The breast cancer susceptibility gene has been confirmed as a pathogenic gene for hereditary breast and ovarian cancer (HBOC).

[0005] BRCA1 Located on chromosome 17, BRCA1 is a 220kD breast cancer susceptibility protein composed of 22 exons and consists of 1863 amino acids. BRCA1 is mainly involved in cellular activities such as cell cycle regulation, DNA damage repair, gene transcription activation, and tumor growth inhibition. BRCA2 Located on chromosome 13, the gene is larger than BRCA1 It has a 10.3kB open reading frame consisting of 27 exons that encodes the BRCA2 protein, which is composed of 3418 amino acids and has been shown to play an important role in DNA damage repair.

[0006] The lifetime risk of a normal woman developing breast cancer is approximately 13%, and the risk of developing ovarian cancer is approximately 1.2%. However, in comparison, genetics plays a significant role. BRCA1 / 2 Women with harmful mutations have a 55%–72% increased risk of breast cancer and a 39%–44% increased risk of ovarian cancer. Furthermore, BRCA1 and BRCA2 Harmful mutations can increase the risk of several other cancers, such as fallopian tube cancer and primary peritoneal cancer. For men, carrying these mutations increases the risk of... BRCA1 / 2Men with harmful gene mutations also have an increased risk of developing breast and prostate cancer. Breast and ovarian cancers are highly malignant, surgery is expensive, and subsequent treatment is lengthy, placing a significant economic burden and emotional distress on society and individuals, and posing a major challenge to human health.

[0007] The American Society of Clinical Oncology currently has... BRCA1 / 2 The relevant HBOC recommendation states that all women diagnosed with epithelial ovarian cancer or those with a family history of breast cancer should undergo [treatment / treatment]. BRCA1, BRCA2 Genetic testing for other tumor susceptibility gene variants, using next-generation sequencing and Sanger sequencing, can diagnose the mutation type in most patients. However, currently, this method can only test surviving family members for preventative surgery and cannot fundamentally address the issue. BRCA1 / 2 The impact of gene mutations on offspring.

[0008] Preimplantation genetic testing for monogenic defects (PGT-M) can effectively prevent the occurrence of single-gene diseases in embryos. BRCA1 / 2 Harmful genetic mutations can be passed on to offspring. By selecting embryos based on their genotype, it's possible to choose embryos that do not carry these harmful mutations, allowing families with affected genes to have healthy offspring and reducing the risk of disease transmission. BRCA1 / 2 The impact of gene mutations on society and families. Currently, PGT-M mainly involves obtaining trace amounts of genetic analysis material through biopsy at the blastocyst stage. After whole-genome amplification (WGA), subsequent diagnostic analysis is performed. Compared to traditional prenatal genetic diagnosis (PND), PGT-M tests preimplantation embryos, avoiding the physical and psychological harm to women caused by induced abortion of fetuses carrying mutations.

[0009] However, adult genetic testing uses peripheral blood samples, which yield micrograms of genomic DNA after extraction. Subsequently, Sanger sequencing or next-generation sequencing technology is used to detect mutation sites. In contrast, preimplantation embryo genetic testing samples come from cells (about 5 cells) obtained from trophectoderm (TE) biopsies of blastocysts. The amount of genomic DNA in these samples is in the picogram range, which is significantly different from the genomic DNA obtained from peripheral blood in adults.

[0010] because BRCA1 / 2Gene sequences are relatively long, with diverse variations. Mutation sites are scattered across the entire length of both genes. Currently, WGA coverage is approximately 80-85%, and direct site detection after WGA carries a 20% risk of allele drop-out (ADO). Furthermore, not all... BRCA1 / 2 Gene mutations can impair protein function. For patients with newly diagnosed germline mutations, family linkage analysis based on single nucleotide polymorphisms (SNPs) or short tandem repeats (STRs) cannot accurately diagnose the embryo. Therefore, current routine testing methods may have loopholes and errors. Summary of the Invention

[0011] To address the aforementioned problems, this invention provides a transcriptome-based method for preimplantation embryos. BRCA1 and / or BRCA2 Gene sequencing kits and their applications.

[0012] In a first aspect, the present invention provides a needle for use in preimplantation embryo implantation. BRCA1 A kit for gene sequence detection, characterized in that the kit contains at least one of the following primer pairs:

[0013] Primer pair 1

[0014] cover BRCA1 The amplified fragment, consisting of exons 1-8, is 903 bp in length.

[0015] First upstream primer: CCTCTGCTCTGGGTAAAGT (SEQ ID No: 1)

[0016] First downstream primer: CTGCTGTTCTCATGCTGTAATG (SEQ ID No: 2);

[0017] Primer pair 2

[0018] cover BRCA1 Exon 9 of the gene, amplified fragment length 3706 bp

[0019] Second upstream primer: CAGTGTGGGAGATCAAGAATTG (SEQ ID No: 3)

[0020] Second downstream primer: GATGAGAAGGGTAGCTGTTAGA (SEQ ID No: 4);

[0021] Primer pair 3

[0022] cover BRCA1 Gene exons 10-22, amplified fragment length 1704 bp

[0023] Third upstream primer: GTTGGTCTGAGTGACAAGGAA (SEQ ID No: 5)

[0024] Third downstream primer: AGCAGTAGAAGGACTGAAGA (SEQ ID No: 6).

[0025] In a second aspect, the present invention provides a kit for preimplantation embryo BRCA2 gene sequence detection, characterized in that the kit contains at least one of the following primer pairs:

[0026] Primer pair 4

[0027] cover BRCA2 The amplified fragment length of exons 1-9 is 2461 bp.

[0028] Upstream primer: AAAGAACTGCACCTCTGGA (SEQ ID No: 7)

[0029] Downstream primer: CCTTTGAGCTTGTCTGACATTT (SEQ ID No: 8);

[0030] Primer pair 5

[0031] cover BRCA2 Exon 10 of the gene, amplified fragment length 5397 bp

[0032] Upstream primer: CCTCTGAAAGTGGACTGGAAATA (SEQ ID No: 9)

[0033] Downstream primer: GTACACAGGTAATCGGCTCTAAA (SEQ ID No: 10);

[0034] Primer pair 6

[0035] cover BRCA2 Gene exons 11-27, amplified fragment length 3665 bp

[0036] Upstream primer: AGTCATGCCACACATTCTCTT (SEQ ID No: 11)

[0037] Downstream primer: CGATACACAAACGCTGAGGTA (SEQ ID No: 12).

[0038] Thirdly, the present invention provides a method for preimplantation embryo BRCA1 and / or BRCA2 A kit for gene sequence detection, characterized in that it includes the kit described in the first aspect and the kit described in the second aspect.

[0039] Fourthly, the present invention provides a method for preimplantation embryo implantation. BRCA1 and / or BRCA2 Systems for gene sequencing include:

[0040] A sample pretreatment device for obtaining nucleic acid samples from exotrophic cells;

[0041] A specific nucleic acid sequence amplification device, wherein the specific nucleic acid sequence amplification device is connected to the sample pretreatment device, and is used to amplify the target gene using the kit according to claim 3;

[0042] A sequencing device, which is connected to the specific nucleic acid sequence amplification device, so as to perform sequencing analysis on the amplified product.

[0043] Furthermore, in some embodiments, the sample preprocessing apparatus includes:

[0044] A cell lysis unit, wherein the outer trophoblast cells are fully lysed to expose their mRNA;

[0045] A reverse transcription unit, obtained by adding a reverse transcription reagent to the cell lysis unit, is used to reverse transcribe the mRNA to obtain cDNA.

[0046] A nucleic acid amplification unit, wherein the cDNA is amplified using upstream and downstream primers with fixed sequences to obtain the nucleic acid sample.

[0047] Optionally, the exotrophic cells are exotrophic cells at the blastocyst stage.

[0048] Optionally, cell lysis in the cell lysis unit is performed as follows:

[0049] The outer trophoblast cells were placed in a lysis buffer, shaken thoroughly for 30-60 seconds, and then incubated at 72°C to allow for complete cell lysis. The lysis buffer contained RNase inhibitors, dNTPs, Triton X-100, and nuclease-free water.

[0050] Optionally, the sample pretreatment device further includes a purification unit, in which magnetic beads are used to purify the product obtained from the nucleic acid amplification unit before obtaining the nucleic acid sample.

[0051] Optionally, the preparation of the cDNA template is performed as follows: the lysed exotrophic cells are added to a reverse transcription system to synthesize complementary cDNA strands. The reverse transcription system includes an RNase inhibitor, dNTPs, polyT primers, Triton X-100, SuperScript II reverse transcriptase, 0.1M DTT, betaine (5M), MgCl2 (1M), Superscript II first-strand buffer (5×), nuclease-free water, and a fixed end sequence. More preferably, the reverse transcription program is: 25°C for 5 minutes; 42°C for 60 minutes; 50°C for 30 minutes; 70°C for 10 minutes; and 4°C for maintenance.

[0052] Optionally, the PCR amplification of the cDNA template is performed as follows: an amplification mixture is added to the cDNA template, the amplification mixture comprising Taq DNA synthase, a fixed-sequence upstream primer, a fixed-sequence downstream primer, and nuclease-free water; more preferably, the amplification program is: 95°C for 3 minutes; 14 to 18 cycles: 98°C for 20 seconds, 66°C for 15 seconds, 72°C for 5 minutes; 72°C for 5 minutes; hold at 4°C.

[0053] Optionally, the purification of the amplified cDNA template is performed as follows: the product obtained after amplification is purified using 0.8× magnetic beads (Beckman) to remove primer sequences from the reverse transcription and amplification process, as well as small fragment sequences less than 200 bp.

[0054] Optionally, the PCR system is as follows: 20 μL of PCR amplification reagent (containing dNTPs, DNA polymerase, magnesium ions, etc.) mixed evenly; 1 μL each of upstream and downstream primers; 2 μL of cDNA template; 17 μL of ddH2O; a further preferred PCR program is: 94°C for 5 minutes; 35-38 cycles: 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 4 minutes; 72°C for 10 minutes; hold at 4°C.

[0055] Fifthly, this invention provides a method for detecting BRCA1 / 2 gene sequences in preimplantation embryos based on gene expression in extratrophoblast cells. This method is not used for disease diagnosis or treatment and includes the following steps:

[0056] S1: Reverse transcription of mRNA from embryonic extratrophoblast cells was performed to obtain cDNA;

[0057] S2: The cDNA is amplified and purified to obtain a nucleic acid sample;

[0058] S3: Amplify the nucleic acid sample using the kit described in claim 1 or 2;

[0059] S4: Perform Sanger sequencing on the amplification products of S3 and align them with the reference genome sequence.

[0060] Furthermore, in step S4, the sequencing results are compared with the reference genome. If they match, the genome does not carry pathogenic variants; if the site is heterozygous and pathogenic variant alleles are observed, the genome carries pathogenic variants.

[0061] In a seventh aspect, the present invention provides the application of the kits described in the first and second aspects for BRCA1 / 2 gene sequence detection in preimplantation embryos.

[0062] The advantages of this invention include at least the following:

[0063] 1. Detection of the genome at the single-cell level of embryos BRCA1 / 2, because With only two copies, detection becomes difficult after whole-genome amplification, posing a risk of detection failure and misappropriation; the applicant discovered through analysis that... BRCA1 / 2 The gene is highly expressed in extrablastotrophic cells during early embryonic development, and the number of mRNA copies produced by cellular transcription is significantly higher than the two copies of the genome. During reverse transcription and amplification of the transcriptome, this reduces the possibility of unlinking and increases the likelihood of implantation in preimplantation embryonic cells. BRCA1 / 2 The accuracy of genetic testing.

[0064] 2. A method for performing pre-implantation embryonic implantation... BRCA1 / 2 The gene sequencing kit does not require peripheral blood samples from core family members of both partners to construct chromosomal haplotype information, and does not rely on family linkage analysis for dual testing. It can directly target the variant sites in the embryo, reducing the difficulty of amplification and increasing the success rate of detection. This provides a new method for family testing of embryos where linkage analysis is difficult.

[0065] 3. Universal primer design can detect all mutations within a gene, with a wide detection range and good versatility, eliminating the need for individual primer design. Attached Figure Description

[0066] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0067] Figure 1 BRCA1 primer PCR products were subjected to agarose gel electrophoresis.

[0068] Figure 2 BRCA2 primer PCR products were subjected to agarose gel electrophoresis.

[0069] Figure 3Sanger sequencing results of the PCR product amplified by primer 1, covering exons 1-8 of BRCA1, with an amplified fragment length of 903 bp. The start region of exon 1 of the BRCA1 gene is shown in red dashed box as the ATG start codon.

[0070] Figure 4 The Sanger sequencing results of the PCR product amplified by primer 1 cover exons 1-8 of BRCA1. The amplified fragment is 903 bp in length. The red dashed box shows the terminal region of exon 8 of the BRCA1 gene, and the right side shows the start region of exon 9.

[0071] Figure 5 Sanger sequencing results of the PCR product amplified by primer 2 (covering BRCA1 exon 9, amplified fragment length 3706bp). The red dashed box shows the start region of exon 9 of the BRCA1 gene, and the left side shows the end region of exon 8.

[0072] Figure 6 Sanger sequencing results of the PCR product amplified by primer 2 (covering BRCA1 exon 9, amplified fragment length 3706bp). The red dashed box shows the terminal region of exon 9 of the BRCA1 gene, and the right side shows the start region of exon 10.

[0073] Figure 7 Sanger sequencing results of the PCR product amplified by primer 3 (covering exons 10-22 of BRCA1, amplified fragment length 1704 bp). The red dashed box shows the start region of exon 10 of the BRCA1 gene, and the left side shows the end region of exon 9.

[0074] Figure 8 Sanger sequencing results of the PCR product amplified by primer 3 (covering exons 10-22 of BRCA1, amplified fragment length 1704 bp), the red dashed box shows the terminal region of exon 22 of the BRCA1 gene (containing the TGA stop codon).

[0075] Figure 9 Sanger sequencing results of the PCR product amplified by primer 4 (covering exons 1-9 of BRCA2, amplified fragment length 2461 bp), the red dashed box shows the start region of exon 1 of the BRCA2 gene (containing the ATG start codon).

[0076] Figure 10 Sanger sequencing results of the PCR product amplified by primer 4 (covering exons 1-9 of BRCA2, amplified fragment length 2461 bp). The red dashed box shows the terminal region of exon 9 of the BRCA2 gene, and the right side shows the start region of exon 10.

[0077] Figure 11 Sanger sequencing results of the PCR product amplified by primer 5 (covering BRCA2 exon 10, amplified fragment length 5397bp). The red dashed box shows the start region of exon 10 of the BRCA2 gene, and the left side shows the end region of exon 9.

[0078] Figure 12 Sanger sequencing results of the PCR product amplified by primer 5 (covering BRCA2 exon 10, amplified fragment length 5397bp). The red dashed box shows the terminal region of exon 10 of the BRCA2 gene, and the right side shows the start region of exon 11.

[0079] Figure 13 Sanger sequencing results of the PCR product amplified by primer 6 (covering exons 11-27 of BRCA2, amplified fragment length 3665bp). The red dashed box shows the start region of exon 11 of the BRCA2 gene, and the left side shows the end region of exon 10.

[0080] Figure 14 Sanger sequencing results of the PCR product amplified by primer 6 (covering BRCA2 exons 11-27, amplified fragment length 3665bp), the red dashed box shows the terminal region of exon 27 of the BRCA2 gene (containing the TAA stop codon).

[0081] Figure 15 Example 1: E1 Sanger sequencing peak diagram of a family;

[0082] Figure 16 Example 1: E2 Sanger sequencing peak diagram of a family;

[0083] Figure 17 Example 1: E3 Sanger sequencing peak diagram of a family;

[0084] Figure 18 Example 2: E1 Sanger sequencing peak diagram of the family;

[0085] Figure 19 Example 2: E2 Sanger sequencing peak diagram of the family. Detailed Implementation

[0086] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0087] Example 1

[0088] A kit for BRCA1 gene sequencing of preimplantation embryos, containing the following primer pairs:

[0089] Primer pair 1

[0090] cover BRCA1 The amplified fragment, consisting of exons 1-8, is 903 bp in length.

[0091] First upstream primer: CCTCTGCTCTGGGTAAAGT (SEQ ID No: 1)

[0092] First downstream primer: CTGCTGTTCTCATGCTGTAATG (SEQ ID No: 2);

[0093] Primer pair 2

[0094] cover BRCA1 Exon 9 of the gene, amplified fragment length 3706 bp

[0095] Second upstream primer: CAGTGTGGGAGATCAAGAATTG (SEQ ID No: 3)

[0096] Second downstream primer: GATGAGAAGGGTAGCTGTTAGA (SEQ ID No: 4);

[0097] Primer pair 3

[0098] cover BRCA1 Gene exons 10-22, amplified fragment length 1704 bp

[0099] Third upstream primer: GTTGGTCTGAGTGACAAGGAA (SEQ ID No: 5)

[0100] Third downstream primer: AGCAGTAGAAGGACTGAAGA (SEQ ID No: 6).

[0101] PCR and sequencing were performed using three primer pairs for the BRCA1 gene and human cell cDNA. Results are shown in [link to results]. Figure 1 and Figure 3-8 The results indicate that the primers are available and the sequence is correct.

[0102] Example 2

[0103] A kit for preimplantation embryo BRCA12 gene sequencing contains the following primer pairs:

[0104] Primer pair 4

[0105] cover BRCA2The amplified fragment length of exons 1-9 is 2461 bp.

[0106] Upstream primer: AAAGAACTGCACCTCTGGA (SEQ ID No: 7)

[0107] Downstream primer: CCTTTGAGCTTGTCTGACATTT (SEQ ID No: 8);

[0108] Primer pair 5

[0109] cover BRCA2 Exon 10 of the gene, amplified fragment length 5397 bp

[0110] Upstream primer: CCTCTGAAAGTGGACTGGAAATA (SEQ ID No: 9)

[0111] Downstream primer: GTACACAGGTAATCGGCTCTAAA (SEQ ID No: 10);

[0112] Primer pair 6

[0113] cover BRCA2 Gene exons 11-27, amplified fragment length 3665 bp

[0114] Upstream primer: AGTCATGCCACACATTCTCTT (SEQ ID No: 11)

[0115] Downstream primer: CGATACACAAACGCTGAGGTA (SEQ ID No: 12).

[0116] PCR and sequencing were performed using three primer pairs for the BRCA2 gene and human cell cDNA, respectively. Results are shown in [link to results]. Figure 2 and Figure 9-14 The results indicate that the primers are available and the sequence is correct.

[0117] Example 3

[0118] A kit for detecting BRCA1 / 2 gene sequences in preimplantation embryos, comprising the kits of Examples 1 and 2, and may further comprise reagents one through four as described below.

[0119] Reagent 1 (Cell Sample Lysis Buffer): Triton X-100, RNase inhibitor, nuclease-free water, dNTPs

[0120] Reagent 2 (Reverse Transcription Mixture): SuperScript II reverse transcriptase, SuperScript II first-strand synthesis buffer (5×), random primers or fixed terminal sequences (100 μM), polyT primers, RNase inhibitor, DTT (0.1 M), betaine (5 M), dNTPs, MgCl2 (1 M), nuclease-free water

[0121] Reagent 3 (cDNA amplification mixture): random primers or fixed-sequence upstream primers, random primers or fixed-sequence downstream primers, Taq DNA polymerase, nuclease-free water.

[0122] Reagent 4 (Target Fragment Amplification Mixture): dNTPs, nuclease-free water, high-fidelity DNA polymerase, Mg2+, etc.

[0123] Application steps of the reagent kit:

[0124] S1: Reverse transcription of mRNA from embryonic extratrophoblast cells was performed to obtain cDNA amplification product and then purified.

[0125] S2: Amplify and purify most of the cDNA to obtain nucleic acid samples;

[0126] S3: Amplify the nucleic acid sample using at least one of the kits from Examples 1 and 2;

[0127] S4: Perform Sanger sequencing on the amplification products of S3 and align them with the reference genome sequence.

[0128] Furthermore, in step S4, the sequencing results are compared with the reference genome. If they match, the genome does not carry pathogenic variants; if the site is heterozygous and pathogenic variant alleles are observed, the genome carries pathogenic variants.

[0129] Furthermore,

[0130] Step S1 specifically includes the following steps:

[0131] S1-1: Obtaining and storing embryonic cell samples: Fertilized eggs are obtained through intracytoplasmic sperm injection (ICSI), cultured to the blastocyst stage, and subjected to exotrophic cell biopsy of the blastocysts, yielding approximately 3 cells per sample. The obtained cell samples are collected in Reagent 1 and can be stored short-term at -80°C.

[0132] S1-2: Cell lysis: Shake well for 30-60 seconds, incubate at 72°C for 3 minutes to fully lyse the cell sample;

[0133] S1-3: Reverse transcription: Add reagent II to the lysed sample to reverse transcribe the transcriptome mRNA into cDNA. The reverse transcription program is as follows: 25℃ for 5 minutes, 42℃ for 60 minutes, 50℃ for 30 minutes, 70℃ for 10 minutes, and hold at 4℃.

[0134] Step S2 specifically includes the following steps:

[0135] S2-1: cDNA Amplification: Add reagent 3 to the cDNA product obtained in S1-3 and perform PCR amplification. The specific reaction program is as follows: 95°C for 3 min; 18 cycles: 98°C for 20 s, 66°C for 15 s, 72°C for 5 min; 72°C for 5 min; store at 4°C.

[0136] S2-2: Purification of cDNA products: The amplified cDNA products were purified using 0.8× Agencourt AMPure XP Beads to remove primer sequences and other small fragments (less than 200 bp) from the reverse transcription and amplification process, thus obtaining samples with high purity.

[0137] S3: Using the purified cDNA product obtained in S2 as a template, the target region was amplified using the primer pairs described above. The PCR amplification system consisted of: 18 μL of reagent IV, 1-2 μL of cDNA template, and 0.5 μL each of the upstream and downstream primers (10 μmol / L) for each primer pair. The PCR amplification program was as follows: 94°C for 5 minutes; 35 cycles: 94°C for 30 seconds, 57°C for 30 seconds, 72°C for 4 minutes; 72°C for 10 minutes; hold at 4°C.

[0138] S4: Perform Sanger sequencing (Sangon / Tianyi Huiyuan) on the PCR target product obtained in S3 and compare it with the reference sequence.

[0139] Example 4:

[0140] The method described in Example 3 is performed using the kit from Example 1 in an in vitro experiment:

[0141] In this family, the man's mother had breast cancer. Genetic testing at another hospital indicated that both the man and his mother were carriers of the virus. BRCA1 Heterozygous mutation in gene c.2572C>T. Both partners underwent PGT-M testing. BRCA1 Genetic inheritance blockade.

[0142] 1. Obtaining extrablastotrophic cell samples

[0143] Following intracytoplasmic sperm injection (ICSI), three fertilized eggs developed into blastocysts (embryos 1, 2, and 3). Extrablastotrophic cell biopsies were performed on these three embryos. Three extrablastotrophic cells were obtained from embryo 1, three from embryo 2, and four from embryo 3. The collected cell samples from embryos 1, 2, and 3 were placed in lysis buffer (containing RNase inhibitors, dNTPs, Triton X-100, and nuclease-free water; this lysis buffer was prepared in-house) and stored at -80°C.

[0144] 2. Obtain sufficient cDNA for detection.

[0145] 2.1 Cell lysis

[0146] Shake the embryonic 1, embryonic 2, and embryonic 3 cell samples thoroughly for 30-60 seconds, then incubate at 72°C for 3 minutes to allow the cells to fully cleave.

[0147] 2.2 Synthesis of complementary cDNA strands

[0148] In step 2.1, reverse transcription buffer was added to lysed embryo samples 1, 2, and 3 to synthesize complementary cDNA strands. The reverse transcription system used a self-prepared reagent, comprising: RNase inhibitor, dNTPs, polyT primers, Triton X-100, SuperScript II reverse transcriptase, 0.1M DTT, betaine (5M), MgCl2 (1M), SuperScript II first-strand buffer (5×), nuclease-free water, and terminal fixation sequences. The reverse transcription program was: 25°C for 5 min; 42°C for 60 min; 50°C for 30 min; 70°C for 10 min; and stored at 4°C.

[0149] 2.3 PCR amplification to obtain cDNA

[0150] Amplification mixture was added to embryo samples 1, 2, and 3 obtained in step 2.2. The mixture consisted of TagDNA synthase, a fixed-sequence upstream primer, a fixed-sequence downstream primer, and nuclease-free water. The amplification program was as follows: 95°C for 3 min; 18 cycles: 98°C for 20 s, 66°C for 15 s, 72°C for 5 min; 72°C for 5 min; stored at 4°C.

[0151] 2.4 cDNA purification

[0152] The products of embryo 1, embryo 2, and embryo 3 obtained after amplification were purified using 0.8× magnetic beads (Beckman) to remove primer sequences from the reverse transcription and amplification process, as well as small fragment sequences less than 200 bp, to obtain cNDA samples.

[0153] 3. BRCA1 / 2 Gene c. DNA Targeted Amplification

[0154] The family variant c.2572C>T is located in exon 9. PCR amplification was performed on cDNA samples from two pairs of embryos (embryo 1, embryo 2, and embryo 3) using primer pairs. The PCR system was as follows: 20 μL of PCR amplification reagent (containing dNTPs, DNA polymerase, magnesium ions, etc.) mixed thoroughly; 1 μL each of forward and reverse primers; 2 μL of cDNA template from embryos 1 / 2 / 3 obtained in section 2.4; and 17 μL of ddH2O. The PCR program was: 94°C for 5 min; 35 cycles: 94°C for 30 s, 58°C for 30 s, 72°C for 4 min; 72°C for 10 min; stored at 4°C. The products were sent to a first-generation sequencing company for Sanger sequencing (Sangon Biotech / Tianyi Huiyuan).

[0155] 4. Sanger sequencing analysis of pathogenic variants

[0156] The sequencing results were analyzed using Chromas software to check for the presence of [certain pathogens / carriers]. BRCA1 The c.2572C>T mutation in the gene. (For example...) Figure 15 As shown, embryo 1 exhibits a bimodal distribution at this locus. Compared to the reference genome, one allele strand has a point mutation at position 2572, changing from C to T. Therefore, the diagnosis is that embryo 1 carries this variant. Figure 16 As shown, embryo 2 has a C locus at this site, with no mutations in the preceding and following sequences, consistent with the reference genome, meaning embryo 2 does not carry this gene mutation. Figure 17 As shown, embryo 3 has a C locus at this site, with no mutations in the preceding and following sequences, consistent with the reference genome, meaning that embryo 3 does not carry this gene mutation.

[0157] Example 5:

[0158] The method described in Example 3 was performed using the kit from Example 2 in an in vitro experiment:

[0159] The female's medical examination revealed that... BRCA2 The woman has a heterozygous mutation in the gene c.4415_4418del. Her aunt is a breast cancer patient and carries this heterozygous mutation, while her mother does not carry the mutation. Subsequent genetic testing confirmed that the woman's alteration was inherited heterozygous from her father. Both husband and wife underwent PGT-M testing. BRCA2 Genetic inheritance blockade.

[0160] 1. Obtaining extrablastotrophic cell samples

[0161] Following intracytoplasmic sperm injection (ICSI), two fertilized eggs developed into blastocysts (embryo 1 and embryo 2). Extrablastotrophic cell biopsies were performed on these two embryos. Three extrablastotrophic cells were obtained from embryo 1 and three from embryo 2. The collected cell samples from embryo 1 and embryo 2 were placed in lysis buffer (containing RNase inhibitors, dNTPs, Triton X-100, and nuclease-free water; this lysis buffer was a self-prepared reagent) and stored at -80°C.

[0162] 2. Obtain sufficient cDNA for detection.

[0163] 2.1 Cell lysis

[0164] Shake the embryo 1 and embryo 2 cell samples thoroughly for 30-60 seconds, then incubate at 72°C for 3 minutes to allow the cells to fully cleave.

[0165] 2.2 Synthesis of complementary cDNA strands

[0166] In step 2.1, reverse transcription buffer was added to lysed embryo samples 1 and 2 to synthesize complementary cDNA strands. The reverse transcription system used a self-prepared reagent, comprising: RNase inhibitor, dNTPs, polyT primers, Triton X-100, SuperScript II reverse transcriptase, 0.1M DTT, betaine (5M), MgCl2 (1M), SuperScript II first-strand buffer (5×), nuclease-free water, and terminal fixation sequences. The reverse transcription program was: 25°C for 5 min; 42°C for 60 min; 50°C for 30 min; 70°C for 10 min; and stored at 4°C.

[0167] 2.3 PCR amplification to obtain cDNA

[0168] Amplification mixture was added to embryo samples 1 and 2 obtained in section 2.2. The mixture consisted of Tag DNA synthase, a fixed-sequence upstream primer, a fixed-sequence downstream primer, and nuclease-free water. The amplification program was as follows: 95°C for 3 min; 18 cycles: 98°C for 20 s, 66°C for 15 s, 72°C for 5 min; 72°C for 5 min; stored at 4°C.

[0169] 2.4 cDNA purification

[0170] The embryo 1 and embryo 2 products obtained after amplification were purified using 0.8× magnetic beads (Beckman) to remove primer sequences and other small fragment sequences below 200bp from the reverse transcription and amplification process, and to obtain cNDA samples.

[0171] 3. BRCA1 / 2 Gene c. DNA Targeted Amplification

[0172] The family variant c.4415_4418del is located in exon 10. PCR amplification was performed on cDNA samples from five pairs of embryos (Embryo 1 and Embryo 2) using primer pairs. The PCR system was as follows: 20 μL of PCR amplification reagent (containing dNTPs, DNA polymerase, magnesium ions, etc.) mixed thoroughly; 1 μL each of forward and reverse primers; 2 μL of cDNA template from embryos 1 / 2 obtained in section 2.4; and 17 μL of ddH2O. The PCR program was: 94°C for 5 min; 35 cycles: 94°C for 30 s, 58°C for 30 s, 72°C for 4 min; 72°C for 10 min; stored at 4°C. The products were sent to a first-generation sequencing company for Sanger sequencing (Sangon Biotech / Tianyi Huiyuan).

[0173] 4. Sanger sequencing analysis of pathogenic variants

[0174] The sequencing results were analyzed using Chromas software to check for the presence of [certain pathogens / carriers]. BRCA2 The c.4415_4418del mutation in the gene. For example... Figure 18 As shown, embryo 1 at this location is AGAA, with no mutations in the preceding and following sequences, consistent with the reference genome. Therefore, the diagnosis is that embryo 1 does not carry this variant. Figure 19 As shown, embryo 2 has a deletion of the AGAA sequence at this location, followed by the CAAA sequence on the right covering the original position, and then a bimodal pattern appears in the sequence. Compared with the reference genome, one allele strand shows a 4-base deletion at the position indicated by the horizontal line, meaning embryo 2 carries... BRCA2 The gene c.4415_4418del mutation.

Claims

1. Used for preimplantation embryos BRCA1 A gene sequence detection kit, characterized in that, The kit contains the following primer pairs: Primer pair 1 First upstream primer: CCTCTGCTCTGGGTAAAGT (SEQ ID No: 1) First downstream primer: CTGCTGTTCTCATGCTGTAATG (SEQ ID No: 2); Primer pair 2 Second upstream primer: CAGTGTGGGAGATCAAGAATTG (SEQ ID No: 3) Second downstream primer: GATGAGAAGGGTAGCTGTTAGA (SEQ ID No: 4); Primer pair 3 Third upstream primer: GTTGGTCTGAGTGACAAGGAA (SEQ ID No: 5) Third downstream primer: AGCAGTAGAAGGACTGAAGA (SEQ ID No: 6).

2. Used for preimplantation embryos BRCA2 A gene sequence detection kit, characterized in that, The kit contains the following primer pairs: Primer pair 4 Upstream primer: AAAGAACTGCACCTCTGGA (SEQ ID No: 7) Downstream primer: CCTTTGAGCTTGTCTGACATTT (SEQ ID No: 8); Primer pair 5 Upstream primer: CCTCTGAAAGTGGACTGGAAATA (SEQ ID No: 9) Downstream primer: GTACACAGGTAATCGGCTCTAAA (SEQ ID No: 10); Primer pair 6 Upstream primer: AGTCATGCCACACATTCTCTT (SEQ ID No: 11) Downstream primer: CGATACACAAACGCTGAGGTA (SEQ ID No: 12).

3. Used for preimplantation embryos BRCA1 and / or BRCA2 A gene sequence detection kit, characterized in that, The kit includes those described in claims 1 and 2.

4. A method for preimplantation embryos BRCA1 and / or BRCA2 A gene sequence detection system, characterized in that, include: A sample pretreatment device for obtaining nucleic acid samples from exotrophic cells; A specific nucleic acid sequence amplification device, wherein the specific nucleic acid sequence amplification device is connected to the sample pretreatment device, and is used to amplify the target gene using the kit according to claim 3; A sequencing device, which is connected to the specific nucleic acid sequence amplification device, so as to perform sequencing analysis on the amplified product.

5. The system according to claim 4, characterized in that, The sample preprocessing device includes: A cell lysis unit, wherein the outer trophoblast cells are fully lysed to expose their mRNA; A reverse transcription unit, obtained by adding a reverse transcription reagent to the cell lysis unit, is used to reverse transcribe the mRNA to obtain cDNA; A nucleic acid amplification unit, wherein the cDNA is amplified to obtain the nucleic acid sample.

6. The system according to claim 5, characterized in that, The exotrophic cells are exotrophic cells during the blastocyst stage.

Images