A SNP marker related to six-week-old weight trait of chicken and application thereof

Abstract

The application discloses a SNP marker (chr1: 171261208, located downstream of the RNASEH2B gene) related to a six-week-old weight trait of a chicken and an application thereof. By determining and recording the six-week-old weight of individuals of a chicken crossbreeding population, 1183 chickens are sequenced by using resequencing technology, and further whole genome association analysis is carried out, so that a SNP (chr1: 171261208) site affecting the six-week-old weight is obtained. The SNP frequencies of the SNP site in low-weight chicken species and high-weight chicken species in resequencing are counted, and it is found that the SNP site exists significant difference in the low-weight chicken species and the high-weight chicken species. In the high-weight chicken, A is the dominant allele, and in the low-weight chicken, G is the dominant allele. In the population with low weight, by selecting individuals with the A allele of the site, the weight of the breeding population can be improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, and in particular to a SNP marker related to the six-week-old body weight trait of chicken and application thereof. BACKGROUND

[0002] Chicken meat is one of the main meat varieties in China, which has the characteristics of high protein, low fat and low cholesterol. In recent years, the output of chicken meat in China has been increasing continuously. Improving muscle yield and improving the quality of chicken meat has been the long-term exploration of breeding scientists. The classical breeding method has made a great contribution to the improvement of production traits of agricultural animals. With the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select the genetic potential of chickens and accelerate the breeding process.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variations in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and accuracy. If a SNP molecular marker related to the target trait of chicken can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chicken and bring breakthrough progress to the field of poultry breeding. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application aims to provide a SNP marker related to the six-week-old body weight trait of chicken and application thereof. The individuals of a 1183 crossbreed population with only six-week-old body weight records are sequenced by using resequencing technology and GWAS analysis is performed, and a SNP site significantly related to six-week-old body weight is obtained. The SNP is rs13553254 (chr1:171261208) located in the genome GRCg6a 104. The site contains three genotypes of AA, GG and AG. The SNP frequencies of the SNP in other low-weight chicken species and high-weight chicken species in resequencing are counted, and it is found that the SNP frequency distribution in low-weight chicken species and high-weight chicken species is significantly different. In high-weight chicken, A is the dominant allele, and in low-weight chicken, G is the dominant allele. High-weight chicken has higher body weight than low-weight chicken, indicating that this SNP site can be used as a molecular marker for the breeding of excellent chicken species. In the population with lower body weight, by selecting individuals with allele A, the body weight of the population can be improved.

[0005] To solve the above technical problems, the technical scheme provided by the present application is:

[0006] A SNP molecular marker related to the body weight of six-week-old chickens,

[0007] The SNP molecular marker is located at chr1:171261208 of GRCg6a 104, and the alleles of the SNP site are A and G.

[0008] The economic trait is the body weight of six-week-old chickens, and A is the dominant allele in high-weight chickens, and G is the dominant allele in low-weight chickens.

[0009] Preferably,

[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO. 1.

[0011] The SNP molecular marker described above is applied in the detection of the body weight of six-week-old chickens.

[0012] Preferably, the method comprises the following steps:

[0013] (1) detecting the genotype of the sample chicken at the SNP site;

[0014] (2) selecting sample chickens with A / A genotype for selection of dominant lines.

[0015] Preferably,

[0016] The step (1) can adopt direct sequencing, or first amplifying the gene fragment containing the SNP molecular marker and then detecting. For example, a primer is designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1, and then detect the alleles at the site. The SNP molecular marker described above is applied in marker-assisted selection breeding, and chickens with A / A genotype are selected for breeding.

[0017] A primer pair for amplifying the SNP molecular marker, characterized in that the sequence of the primer pair is shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0018] The beneficial effects of the present application are:

[0019] The present application can early, quickly, low-cost and effectively predict the high and low weight of chickens by detecting the SNP molecular marker, has a broad application prospect in chicken breed improvement, and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS

[0020] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, illustrate the present application together with the embodiments thereof, and explain the present application, and do not constitute a limitation of the present application. In the drawings:

[0021] Figure 1 Manhattan plot of six-week-old body weight GWAS results DETAILED DESCRIPTION

[0022] The preferred embodiments of the present application will be described herein below with reference to the accompanying drawings, in which it needs to be understood that the following embodiments are given only for the purpose of illustration and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application.

[0023] The present application provides a SNP marker (chr1:171261208, located downstream of the RNASEH2B gene) related to the six-week-old body weight trait of chickens and its application. The SNP molecular marker is located at chr1:171261208 of the genome GRCg6a 104, and the SNP molecular marker is located at the 101st base of the nucleotide sequence shown in SEQ ID NO. 1. The alleles of the SNP site are A and G.

[0024] The economic trait is the six-week-old body weight of chickens, and G is the dominant allele in high-weight chickens, and T is the dominant allele in low-weight chickens. In the population with lower body weight, by selecting individuals with allele G, the body weight of chickens can be improved.

[0025] SEQ ID NO. 1 (chr1:171261108-171261308)

[0026] gactggatgatcctgtgggtcttttccaaccttagcgattctatgattctaagaacaagcacttggtgagcccggaatgagca

[0027] actgcagttgtgaacttggaagggttaggttttgaaaagcattcaacttagcccagcggtttttgttgagaataaaagatgcctt

[0028] ccaaattggtatcagtagaaaaaagggatgcac

[0029] Example 1 Whole genome association analysis of six-week-old body weight of chickens

[0030] 1. Test material

[0031] The individuals of a chicken crossbreeding population were taken as the research object, and the body weight of 1183 individuals was measured at six weeks old. The determination was strictly carried out in accordance with the internal specifications of the chicken farm.

[0032] 2. Test method

[0033] 2.1 Phenotyping

[0034] When the chickens reached six weeks of age, each chicken was placed on a weighing device and waited until the chicken remained relatively calm and balanced, then the displayed weight value was recorded, and the gender was recorded.

[0035] 2.2 Whole genome SNP typing method of chicken based on resequencing technology

[0036] The sequencing data was aligned to the GRCg6a 104 reference genome using gtx align, SNP site detection was performed using Basevar, and STITCH estimated the genotype probability of all individuals. For the SNP sites obtained by typing, according to MAF <0.05, site call rate <0.95, info score <0.4, high-quality sites were filtered, and a total of 7,901,521 SNPs were retained.

[0037] The specific steps of amplification are as follows: the blood tissue of the hybrid population sample is used to extract DNA using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd., the OD value of the extracted DNA is detected by NanoDrop 2000 spectrophotometer to determine the concentration and purity of the DNA, and the integrity of the DNA is detected by agarose gel electrophoresis. The genome of the hybrid population sample is used as a template, and the corresponding primers are designed for its sequence using Oligo7 software, and the sequence is amplified using Novozyme 2xTaq Master Mix, the reaction system is as follows: 95°C, pre-denaturation 3min; 95°C, denaturation 15s, 60°C, annealing 15s, 72°C, extension 15s, 30 cycles; 72°C, complete extension 5min. Finally, the product fragment size is detected by agarose gel electrophoresis.

[0038] The sequence of the primer pair for amplifying the fragment containing the above SNP site is as follows:

[0039] F: GACTGGATGATCCTGTGGGT (SEQ ID NO. 2)

[0040] R: GTGCATCCCTTTTTTCTACT (SEQ ID NO. 3)

[0041] 2.3 Whole genome association analysis

[0042] FastGWA was used to perform whole genome association analysis on the six-week-old body weight phenotype of 1183 chickens.

[0043] 2.4 SNP sites significantly associated with body weight traits

[0044] Detection of significant sites at genome level, significant sites were identified according to FDR < 0.05.

[0045] 3. Results and analysis

[0046] The present application takes 1183 chicken crossbreeding groups as the object, uses 7,901,521 SNPs obtained by resequencing technology to carry out GWAS analysis on the six-week-old weight of chickens, determines a SNP (chr1: 171261208) site significantly related to the six-week-old weight of chickens, and the results are shown as follows. Figure 1

[0047] Example 2 Frequency distribution of SNP (chr1: 171261208) in different chicken breeds

[0048] 1. Test materials

[0049] Low-weight chicken breeds: Mustache chicken (n = 15), tea flower chicken (n = 30) and Dawei mountain miniature chicken (n = 33).

[0050] High-weight chicken breeds: Lingnan yellow-feather broiler (n = 16), white-feather broiler (n = 20), Kebao chicken (n = 33) and recessive white-feather chicken (n = 113).

[0051] 2. Test method

[0052] 2.1 Data collection

[0053] The above whole genome resequencing data from 3 Chinese low-weight chicken breeds and 4 high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).

[0054] 2.2 SNP typing using GATK

[0055] The above resequencing samples were constructed gVCF based on GRCg6a 104 reference genome using GTX server gtx wgs command, and then joint variant detection was carried out on all gVCF samples using gtx gi and gtxjoint commands to obtain genotype VCF file.

[0056] 2.3 Filtering and quality control of SNPs

[0057] ​After joint variant calling, SNPs sites were extracted using the SelectVariants tool of the GATK software package, and then the whole genome resequencing data was quality controlled according to the following hard filtering parameters using the VariantFiltration tool of the GATK software package: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30. Finally, after the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.

[0058] 2.4 Calculation of allele frequency of chr1:171261208 in different chicken breeds

[0059] The allele frequency of chr1:171261208 in different chicken breeds was calculated using vcftools--freq2.

[0060] 3 Results and analysis

[0061] The results of SNP frequency distribution of SNP (chr1:171261208) in different low-weight chicken breeds and high-weight chicken breeds are shown in Table 1, and there is a significant difference between low-weight chicken breeds and high-weight chicken breeds. In high-weight chickens, A is the dominant allele, and in low-weight chickens, G is the dominant allele.

[0062] Table 1 SNP frequency of SNP (chr1:171261208) in different low-weight chicken breeds and high-weight chicken breeds

[0063]

[0064] It was found that a SNP molecular marker (chr1:171261208) related to the six-week-old chicken weight trait, in the population with lower weight, by breeding individuals with allele A / A, the weight of the breeding population can be improved.

[0065] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.

[0066] Finally, it should be noted that: the above only for the preferred examples of the present application, and not for limiting the present application, although the present application is described in detail with reference to the foregoing examples, for those skilled in the art, it still can modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. The application of an SNP molecular marker in the detection of body weight traits in six-week-old chickens, characterized in that, The SNP molecular marker is located at chr1:171261208 of the GRCg6a genome, and the alleles of the SNP site are A and G.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select sample chickens with A / A genotypes for breeding superior strains.

3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

Images