A method for producing plant-based fermented milk by co-fermentation of Lactobacillus brevis and Lactobacillus plantarum

Abstract

The present invention discloses a method for co-fermenting Lactobacillus brevis and Lactobacillus plantarum to produce plant-based fermented milk, belonging to the field of food biotechnology. Compared with single-strain fermentation, when the present invention uses Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 for dual-strain co-inoculation, while ensuring the production amount of GABA, it reduces the heterofermentation characteristics of excessive acetic acid and ethanol production during the fermentation of a single Lactobacillus brevis strain. When D17 and JNU-JLB9 are inoculated in a ratio of 8:2 (total inoculation amount 1×10<supgt;9< / supgt; CFU / mL), 9.8 g / L of lactic acid and 437.9 mg / L of GABA can be produced after 12 h of fermentation. The co-fermentation of high-yield GABA heterofermentative lactic acid bacteria and homofermentative lactic acid bacteria has important application value in the field of plant-based fermentation.

Description

Technical Field

[0001] The invention relates to a method for producing plant-based fermented milk by co-fermentation of Lactobacillus brevis and Lactobacillus plantarum, belonging to the field of food biotechnology. Background Art

[0002] In recent years, people's living standards have been improving, and animal-based foods such as meat, eggs, and milk have accounted for an increasing proportion of the dietary structure. As a result, the incidence of many chronic diseases such as hypertension and obesity has also increased year by year. However, plant-based foods do not contain substances such as saturated fatty acids and cholesterol that promote the above chronic diseases, and are rich in many bioactive substances with antioxidant activity such as polyphenols and flavonoids, which are also in line with the current global vegetarian trend. Therefore, plant-based foods are gradually becoming an important choice for people to adjust to a healthy dietary structure.

[0003] Plant-based matrices usually have some unpleasant flavors such as bitterness and beany smell, and the nutrition is relatively simple. After being fermented by lactic acid bacteria, plant-based matrices can not only eliminate unpleasant odor substances, but also further enrich the taste and nutrition. Fermenting plant-based beverages with lactic acid bacteria has gradually become a research hotspot in plant-based beverages. At present, there are not many fully plant-based lactic acid fermented beverages on the market, most of which are mainly oat products. The sales market is mainly in developed regions such as Europe, the United States, and Japan. The domestic industry is still in its infancy. Lactic acid bacteria used in fully plant-based fermentation include dairy-derived lactic acid bacteria, such as Lactobacillus bulgaricus, Streptococcus thermophilus, Lactobacillus paracasei, Lactobacillus acidophilus, and plant-derived lactic acid bacteria such as Lactobacillus plantarum.

[0004] Since lactic acid bacteria are nutritionally deficient in most amino acids, they require a higher nutritional environment for growth. Plant-based matrices are mostly simple in nutrition and cannot directly provide certain amino acids, vitamins and other growth factors required for the growth and reproduction of lactic acid bacteria. Therefore, lactic acid bacteria may lack many genes encoding enzymes that hydrolyze proteins in plant-based matrices, which requires higher nutrition and also presents many difficulties and challenges in the production and preparation of plant-based fermented foods.

[0005] The research group screened multiple strains of lactic acid bacteria producing γ-aminobutyric acid (GABA) from the fermented mash of liquor acid fermentation, represented by Lactobacillus brevis D17. The Lactobacillus brevis D17 is a high-yield GABA lactic acid bacteria (it can produce 26.1g / L of GABA under uncontrolled pH fermentation conditions, which is 2.3 times higher than the typical strain Lactobacillus brevis ATCC 367). GABA is an important inhibitory neurotransmitter of the central nervous system, with multiple physiological functions such as anti-obesity, anticonvulsant, lowering blood pressure, improving brain function and calming the mind. Moreover, the lactic acid bacteria of the liquor brewing system are domesticated for a long time in a high-starch, high-acidity environment, so that they have high starch matrix growth adaptability and high acid resistance characteristics. Based on the above characteristics, the Lactobacillus brevis and plant lactobacillus plantarum from the liquor brewing system have good plant-based fermentation and probiotic properties.

[0006] However, Lactobacillus brevis fermentation usually shows obvious heterotypic fermentation characteristics, which will make the acetic acid and ethanol content in the fermentation liquid higher, and is not suitable for beverage production. Plant lactobacillus fermentation is usually homotypic fermentation or partial homotypic fermentation, that is, the lactic acid content in the fermentation liquid will be higher, while the acetic acid and ethanol content will be less. The co-fermentation of two strains may be an effective solution to amplify the advantages of single strain fermentation and reduce the disadvantages of single strain fermentation. At present, there is no technology for co-fermentation of Lactobacillus brevis and plant lactobacillus to produce plant-based fermented milk. Therefore, it is of great application value to explore the method of co-fermentation of Lactobacillus brevis and plant lactobacillus to produce plant-based fermented milk. Summary of the invention

[0007] The first object of the present invention is to provide a method for preparing a plant-based fermented beverage using high-yield GABA-producing Lactobacillus brevis D17 (with a deposit number of CGMCC NO.14385, recorded in the Chinese invention patent text with a publication number of CN108034599B) and high-acid-resistant Lactobacillus plantarum JNU-JLB9 (with a deposit number of GDMCC No: 64586) from fermented grains.

[0008] The present invention provides a strain of Lactobacillus plantarum, which has been deposited in Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC No.64586 and a deposit date of April 30, 2024.

[0009] The present invention also provides a microbial agent, which contains the above-mentioned Lactobacillus plantarum or its fermentation liquid or freeze-dried powder or its wet bacteria;

[0010] Or the microbial agent contains the above-mentioned Lactobacillus plantarum or its fermentation liquid or freeze-dried powder or wet bacteria, and Lactobacillus brevis CGMCC NO.14385 or its fermentation liquid or freeze-dried powder or wet bacteria at the same time.

[0011] In one embodiment of the present invention, the microbial agent is obtained by mixing the Lactobacillus plantarum and Lactobacillus brevis CGMCC NO.14385 in a ratio of 7 to 9:1 to 3 in terms of viable cell count.

[0012] In one embodiment of the present invention, the number of viable bacteria in the microbial agent is not less than: 1×10 9 CFU / mL.

[0013] The present invention also provides a method for preparing oat milk rich in GABA without exogenous addition of auxiliary growth factors, glutamic acid and glutamate, characterized in that the oat milk is prepared according to the following steps:

[0014] (1) Preparation of prehydrolyzed oat flour

[0015] The pretreatment method comprises: mixing oat flour with water, adding α-amylase for enzymolysis, adding saccharifying enzyme to the enzymolysis solution for saccharification, and performing enzyme inactivation treatment after the saccharification is completed;

[0016] Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder;

[0017] (2) mixing the prepared pre-hydrolyzed oat flour with water in a material-water ratio of 1-2:5-10, sterilizing, and preparing pre-hydrolyzed oat milk;

[0018] (3) adding protease to the pre-hydrolyzed oat milk obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oat milk for fermentation;

[0019] (4) Adding the above-mentioned microbial agent to the enzymatic oat milk for fermentation obtained in step (3) and fermenting it to prepare oat milk.

[0020] In one embodiment of the present invention, in step (3), the protease includes but is not limited to: cereal hydrolase ZB3-1P, lytic enzyme Viscozyme L, neutral protease Neutrase 0.8L;

[0021] In one embodiment of the present invention, in step (1), the conditions for adding α-amylase for enzymolysis are: 55-65°C for enzymolysis for 60-70 min; the conditions for saccharifying by saccharifying by saccharifying by saccharifying by saccharifying by 55-65°C for 60-70 min; the conditions for adding protease for enzymolysis are: 50-60°C for enzymolysis for 60-70 min;

[0022] In one embodiment of the present invention, in step (3), the enzymatic hydrolysis conditions are: 40-50° C., 7-10 h;

[0023] In one embodiment of the present invention, the fermentation conditions in step (4) are: 35-40° C., 100-200 rpm, and fermentation for 12-36 hours.

[0024] In one embodiment of the present invention, in step (1), the oatmeal powder and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase is 2-3%; the added amount of the saccharifying enzyme is 2-3%; and the added amount of the protease is 0.2-0.3%.

[0025] In one embodiment of the present invention, step (1) is:

[0026] Oatmeal powder (purchased from Xuzhou Fangde Food Co., Ltd.) was mixed with water at a mass ratio of 1:4, and then 2% (m / v) α-amylase (named BAN480 L) was added and enzymolyzed at 60°C for 60 minutes. Subsequently, 2% (m / v) saccharifying enzyme (named Amylase AG 300L) was added to the enzymolysis solution and enzymolyzed at 60°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for 10 minutes. Subsequently, 0.2% (m / v) protease (named Neutrase 0.8L) was added to the inactivated enzymolysis solution and enzymolyzed at 50°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for another 10 minutes. Then it was filtered with a 60-mesh sieve. The enzymolysis solution was concentrated, then drum-dried, and finally ground into powder to obtain pre-hydrolyzed oatmeal powder.

[0027] In one embodiment of the present invention, the microbial agent is a microbial agent of Lactobacillus brevis D17, a microbial agent of Lactobacillus plantarum JNU-JLB9, or a microbial agent obtained by compounding Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9.

[0028] In one embodiment of the present invention, the preparation method of the microbial agent is to add the bacterial solution stored in a glycerol tube to a liquid MRS culture medium, culture it at 37° C. for 24 hours, and activate it three times.

[0029] The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation volume and cultured to the mid-logarithmic phase (10-12 h). The culture solution was diluted to 1×10 9 CFU / mL was used as the fermentation seed solution.

[0030] In one embodiment of the present invention, the microbial agent obtained after the compounding of the Lactobacillus brevis D17 and the Lactobacillus plantarum JNU-JLB9 is: the seed liquid of the Lactobacillus brevis D17 and the Lactobacillus plantarum JNU-JLB9 prepared according to the above method is inoculated in the enzymatic oat milk with a CFU number ratio of 10:0, 9:1, 8:2, 7:3, 6:4, 5:5 and 0:10, respectively, and fermented at 37°C, 200rpm for 24h, and sampled every 4h. The total reducing sugar in the fermentation broth is determined by the DNS method. The contents of maltose, glucose, lactic acid, acetic acid, ethanol, glutamic acid and GABA in the fermentation broth are detected by high performance liquid chromatography (HPLC).

[0031] The present invention also provides a method for increasing the GABA content in oat milk prepared by fermentation with Lactobacillus brevis and improving the flavor, wherein the method does not require exogenous addition of auxiliary growth factors, glutamic acid and glutamate, and specifically comprises the following steps:

[0032] (1) Preparation of prehydrolyzed oat flour

[0033] The pretreatment method comprises: mixing oat flour with water, adding α-amylase for enzymolysis, adding saccharifying enzyme to the enzymolysis solution for saccharification, and performing enzyme inactivation treatment after the saccharification is completed;

[0034] Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder;

[0035] (2) mixing the prepared pre-hydrolyzed oat flour with water in a material-water ratio of 1-2:5-10, sterilizing, and preparing pre-hydrolyzed oat milk;

[0036] (3) adding protease to the pre-hydrolyzed oat milk obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oat milk for fermentation;

[0037] (4) Adding the above-mentioned microbial agent to the enzymatic oat milk for fermentation obtained in step (3) and fermenting it to prepare oat milk.

[0038] In one embodiment of the present invention, in step (3), the protease includes but is not limited to: cereal hydrolase ZB3-1P, lytic enzyme Viscozyme L, neutral protease Neutrase 0.8L;

[0039] In one embodiment of the present invention, in step (1), the conditions for adding α-amylase for enzymolysis are: 55-65°C for enzymolysis for 60-70 min; the conditions for saccharifying by saccharifying by saccharifying by saccharifying by saccharifying by 55-65°C for 60-70 min; the conditions for adding protease for enzymolysis are: 50-60°C for enzymolysis for 60-70 min;

[0040] In one embodiment of the present invention, in step (3), the enzymatic hydrolysis conditions are: 40-50° C., 7-10 h;

[0041] In one embodiment of the present invention, the fermentation conditions in step (4) are: 35-40° C., 100-200 rpm, and fermentation for 12-36 hours.

[0042] In one embodiment of the present invention, in step (1), the oatmeal powder and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase is 2-3%; the added amount of the saccharifying enzyme is 2-3%; and the added amount of the protease is 0.2-0.3%.

[0043] In one embodiment of the present invention, step (1) is:

[0044] Oatmeal powder (purchased from Xuzhou Fangde Food Co., Ltd.) was mixed with water at a mass ratio of 1:4, and then 2% (m / v) α-amylase (named BAN480 L) was added and enzymolyzed at 60°C for 60 minutes. Subsequently, 2% (m / v) saccharifying enzyme (named Amylase AG 300L) was added to the enzymolysis solution and enzymolyzed at 60°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for 10 minutes. Subsequently, 0.2% (m / v) protease (named Neutrase 0.8L) was added to the inactivated enzymolysis solution and enzymolyzed at 50°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for another 10 minutes. Then it was filtered with a 60-mesh sieve. The enzymolysis solution was concentrated, then drum-dried, and finally ground into powder to obtain pre-hydrolyzed oatmeal powder.

[0045] In one embodiment of the present invention, the microbial agent is a microbial agent of Lactobacillus brevis D17, a microbial agent of Lactobacillus plantarum JNU-JLB9, or a microbial agent obtained by compounding Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9.

[0046] In one embodiment of the present invention, the preparation method of the microbial agent is to add the bacterial solution stored in a glycerol tube to a liquid MRS culture medium, culture it at 37° C. for 24 hours, and activate it three times.

[0047] The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation volume and cultured to the mid-logarithmic phase (10-12 h). The culture solution was diluted to 1×10 9 CFU / mL was used as the fermentation seed solution.

[0048] In one embodiment of the present invention, the microbial agent obtained after the compounding of the Lactobacillus brevis D17 and the Lactobacillus plantarum JNU-JLB9 is: the seed liquid of the Lactobacillus brevis D17 and the Lactobacillus plantarum JNU-JLB9 prepared according to the above method is inoculated in the enzymatic oat milk with a CFU number ratio of 10:0, 9:1, 8:2, 7:3, 6:4, 5:5 and 0:10, respectively, and fermented at 37°C, 200rpm for 24h, and sampled every 4h. The total reducing sugar in the fermentation broth is determined by the DNS method. The contents of maltose, glucose, lactic acid, acetic acid, ethanol, glutamic acid and GABA in the fermentation broth are detected by high performance liquid chromatography (HPLC).

[0049] The present invention also provides a fluorescence quantitative PCR method for analyzing biomass changes in co-fermented enzymatically hydrolyzed oat milk.

[0050] Primer design: The specific gene fragment was determined by comparing the whole genome sequences of D17 and JNU-JLB9. Specific primers were designed using the specific gene fragment (single copy) and named D17-F (ACCACCCACTTCAATTTCCC) / D17-R (TTTGTTGAGAAGGTTGACCG) and JNU-JLB9-F (GCAAACCGCGCAAATGGTCCAC) / JNU-JLB9-R (CAGCAGTCCTTATTCGCTGGT).

[0051] DNA extraction: According to the instructions of Qiagen PowerSoil DNA extraction kit, total DNA from D17, JNU-JLB9 and oat milk co-fermentation broth was extracted, and the integrity and concentration of total DNA were determined by agarose gel electrophoresis and NanoDrop 8000, respectively.

[0052] qPCR amplification: The genomic DNA concentration of D17 and JNU-JLB9 was diluted to 100 ng / μL and diluted tenfold. Each dilution of DNA was used as a template for qPCR amplification, and a standard curve was prepared based on the linear relationship between the number of cycles (Ct value) and the number of gene copies. The DNA of pure culture and co-culture samples was diluted to 1 ng / μL with sterile ultrafiltered water and used as a template for qPCR amplification. The Ct value obtained by the reaction was substituted into the standard curve to obtain the number of gene copies of each sample. qPCR reaction program: Amplification program: 95℃ pre-denaturation for 30s, one cycle of 95℃ denaturation for 10s, 60℃ annealing for 10s, and 72℃ extension for 30s, for a total of 40 cycles; Melting curve program: After the amplification program, 95℃ was maintained for 15s, then reduced to 72℃ for 2min, and then increased to 95℃ at 0.5℃ / s for 15s.

[0053] The present invention also provides a method for evaluating the safety of Lactobacillus plantarum JNU-JLB9 strain, which includes strain genome analysis, antibiotic resistance test and mouse in vivo toxicity test. It includes the following steps:

[0054] (1) Whole genome analysis of strains

[0055] The whole genome sequence of Lactobacillus plantarum JNU-JLB9 strain was compared with the Virulence Factor Database (VFDB) and the Antimicrobial Resistance Gene Database (CARD). According to the relevant guidelines of the European Food Safety Authority (EFSA), the gene sequence identity (identity) greater than 80%, coverage (coverage) greater than 70% and E value less than l×e -10 As screening criteria, virulence factors and drug resistance genes were predicted.

[0056] (2) Antibiotic resistance test

[0057] The KB disk diffusion method was used to determine the resistance of Lactobacillus plantarum JNU-JLB9 strain to 12 commonly used antibiotics. The seed solution of Lactobacillus plantarum JNU-JLB9 strain was diluted to a bacterial concentration of 1×10 8 CFU / mL, draw 1mL of bacterial solution into 15mL of MRS liquid medium containing agar cooled to 45℃, and mix well. After solidification, use sterile tweezers to evenly stick the drug-sensitive paper containing a certain concentration of antibiotics on the plate. Place it in a 37℃ incubator and culture it for 48h before measuring the diameter of the inhibition zone on the plate. Determine according to the antibiotic sensitivity test execution standards established by the Clinical and Laboratory Standards Institutes.

[0058] (3) In vivo toxicity test in mice

[0059] Twenty 6-8 week old SPF BALB / c mice (10 males and 10 females, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were selected and housed in a 12-h light-dark cycle, constant ambient temperature (22±2℃) and humidity (55±2%), with free access to food and water. After one week of adaptation, the mice were randomly divided into two groups, 10 mice in each group (5 females and 5 males, housed separately), and the groups were divided as follows: 1) SD group (control group): mice were fed with standard feed (Co60 irradiated experimental mouse maintenance feed, purchased from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.) and 200μL sterile saline; 2) JNU-JLB9 group: mice were fed with standard feed supplemented with 200μL (concentration of 1×10 9CFU / mL) of Lactobacillus plantarum JNU-JLB9 bacterial suspension. Daily gavage lasted for 28 days. During the gavage period, the mice were weighed daily, and the food intake, drinking water, activity status and mental state of the mice were observed and recorded. On the last day of the gavage period, all mice were fasted overnight, and then orbital blood was collected and the mice were euthanized by the carbon dioxide method. The liver, spleen, kidney and colon were then immediately removed for subsequent analysis. This experiment strictly followed the relevant ethical guidelines for experimental animals and was approved by the Experimental Animal Ethics Committee of Jiangnan University (Ethics Approval Number: JN.No20220315b0300601).

[0060] The present invention provides a method for preparing GABA using oatmeal as a substrate, wherein the method does not require exogenous addition of auxiliary growth factors, glutamic acid and glutamate, and specifically comprises the following steps:

[0061] (1) Preparation of prehydrolyzed oat flour

[0062] The pretreatment method comprises: mixing oat flour with water, adding α-amylase for enzymolysis, adding saccharifying enzyme to the enzymolysis solution for saccharification, and performing enzyme inactivation treatment after the saccharification is completed;

[0063] Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder;

[0064] (2) mixing the prepared prehydrolyzed oat flour with water in a material-water ratio of 1-2:5-10, sterilizing, and preparing prehydrolyzed oat flour;

[0065] (3) adding protease to the pre-hydrolyzed oats obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oats for fermentation;

[0066] (4) Inoculating Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 into the enzymatically hydrolyzed oats obtained in step (3) at a CFU ratio of 5-9:1-5 for fermentation to obtain a fermentation mixture, and extracting GABA from the fermentation mixture.

[0067] In one embodiment of the present invention, in step (3), the protease includes but is not limited to: cereal hydrolase ZB3-1P, lytic enzyme Viscozyme L, neutral protease Neutrase 0.8L.

[0068] In one embodiment of the present invention, in step (1), the conditions for adding α-amylase (named BAN480 L) for enzymolysis are: 55-65°C for enzymolysis for 60-70 min; the conditions for adding saccharifying enzyme (named Amylase AG 300L) for saccharification are: 55-65°C for saccharification for 60-70 min; the conditions for adding protease (named Neutrase 0.8L) for enzymolysis are: 50-60°C for enzymolysis for 60-70 min.

[0069] In one embodiment of the present invention, in step (3), the enzymatic hydrolysis conditions are: 40-50° C., 7-10 h.

[0070] In one embodiment of the present invention, the fermentation conditions in step (4) are: 35-40° C., 100-200 rpm, and fermentation for 12-36 hours.

[0071] In one embodiment of the present invention, in step (1), the oat flour and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase (named BAN480 L) is 2-3%; the added amount of the saccharifying enzyme (named AmylaseAG 300L) is 2-3%; the added amount of the protease (named Neutrase 0.8L) is 0.2-0.3%.

[0072] Beneficial Effects

[0073] (1) The plant-based fermented milk produced by inoculating and fermenting the Lactobacillus brevis D17 of the present invention at a relatively low inoculation amount has the lowest content of acetic acid and ethanol and can maintain a relatively high content of GABA.

[0074] (2) The plant-based fermented milk produced by inoculating and fermenting the plant lactobacillus JNU-JLB9 of the present invention at a high inoculation rate has the highest lactic acid content, the lowest acetic acid and ethanol contents, and can maintain a certain content of GABA.

[0075] (3) The plant-based fermented milk produced by co-fermentation of Lactobacillus brevis and Lactobacillus plantarum of the present invention can maintain the advantages of D17 strain fermentation, i.e., a higher content of GABA, and can also maintain the advantages of JNU-JLB9 strain fermentation, i.e., lower acetic acid and ethanol contents.

[0076] (4) The Lactobacillus plantarum JNU-JLB9 of the present invention has been proven to be a safe and usable strain through in vitro and in vivo tests. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 Substrate utilization and main metabolites of enzymatically hydrolyzed oat milk fermented with Lactobacillus brevis D17 at different inoculation ratios.

[0078] Figure 2 Substrate utilization and main metabolites of enzymatic oat milk fermented with different inoculation ratios of Lactobacillus plantarum JNU-JLB9.

[0079] Figure 3 The changes in biomass of oat milk hydrolyzed by co-fermentation with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at an inoculation ratio of 8:2.

[0080] Figure 4 This is the effect of Lactobacillus plantarum JNU-JLB9 on the body weight, food intake and organ indexes of mice.

[0081] Figure 5 This is the effect of Lactobacillus plantarum JNU-JLB9 on the microstructure of representative organ tissues of mice.

[0082] Figure 6 This is the effect of Lactobacillus plantarum JNU-JLB9 on mouse serum indicators.

[0083] Figure 7 This is the effect of Lactobacillus brevis D17 on the body weight, food intake and organ indexes of mice.

[0084] Figure 8 This is the effect of Lactobacillus brevis D17 on the microstructure of representative organ tissues of mice.

[0085] Fig. 9 This is the effect of Lactobacillus brevis D17 on mouse serum indicators.

[0086] Biomaterial Deposit

[0087] A strain of Lactiplantibacillus plantarum JNU-JLB9, taxonomically named Lactiplantibacillus plantarum, was deposited in Guangdong Provincial Microbiological Culture Collection Center on April 30, 2024, with the deposit number GDMCC No: 64586, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. DETAILED DESCRIPTION

[0088] The culture medium involved in the following embodiments is:

[0089] Liquid MRS medium: glucose 20g / L, peptone 10g / L, beef extract 10g / L, yeast extract 5g / L, ammonium citrate 2g / L, dipotassium hydrogen citrate 2g / L, Tween 80 1ml / L, sodium acetate 5g / L, magnesium sulfate 0.58g / L, manganese sulfate 0.25g / L.

[0090] The Lactobacillus brevis CGMCC NO.14385 strain described in the following examples is the same strain as Lactobacillus brevis D17. The deposit number of high-yielding GABA Lactobacillus brevis D17 is CGMCC NO.14385, which is recorded in the Chinese invention patent text with publication number CN108034599B.

[0091] The technical solution of the present invention is described in detail below in conjunction with the embodiments of the accompanying drawings.

[0092] Example 1: Obtaining Lactobacillus plantarum JNU-JLB9

[0093] (1) Screening

[0094] Weigh 10g of fermented mash of liquor, add 100mL of sterile saline, and shake at 37℃, 200rpm for 1h. Dilute the fully shaken bacterial suspension with sterile saline, take 100μL and spread it on the MRS medium solid plate, and culture it at 37℃ for 48h. After single colonies grow, pick single colonies of different morphologies and use universal primers (27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT) for colony PCR to identify the strain.

[0095] PCR reaction system: Taq enzyme 12.5 μL, sterile ultrapure water 10.5 μL, 27F 0.5 μL, 1492R 0.5 μL, bacterial solution 1 μL.

[0096] PCR reaction program: pre-denaturation at 95°C for 6 min; denaturation at 95°C for 3 min; annealing at 55°C for 30 s; product extension at 72°C for 90 s; 30 cycles; extension at 72°C for 10 min.

[0097] (2) Purification

[0098] The identified Lactobacillus plantarum culture solution was streaked onto a MRS medium solid plate, cultured at 37°C for 48 hours, and a single colony was picked for colony PCR to identify the purity of the strain. This step was repeated until the MRS culture solution of the single colony picked last time was a pure culture solution, which means that the purification of the target strain was completed.

[0099] The obtained Lactobacillus plantarum JNU-JLB9 was deposited in Guangdong Provincial Microbiological Culture Collection Center on April 30, 2024, with the deposit number GDMCC NO.64586.

[0100] Example 2: Fermentation capacity of Lactobacillus plantarum JNU-JLB9 and its acid and bile resistance

[0101] The specific steps are as follows:

[0102] 1. Detection of lactic acid, acetic acid, ethanol and GABA content in fermentation broth

[0103] (1) Lactobacillus plantarum JNU-JLB9 stored in a glycerol tube was inoculated into liquid MRS medium, cultured at 37°C for 24 h, and activated three times.

[0104] The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation volume and cultured at 37°C until the mid-logarithmic phase (10-12 h). The culture solution was diluted to 1×10 9 CFU / mL as fermentation seed solution;

[0105] (2) The fermentation seed liquid obtained in step (1) was transferred to 100 mL of liquid MRS medium supplemented with 10 g / L monosodium glutamate (MSG) at a 10% (v / v) inoculation amount, and fermented at 37° C., 200 rpm for 24 h, with samples taken every 4 h for a total of 24 h. The contents of lactic acid, acetic acid, ethanol and GABA in the fermentation liquid were detected by HPLC.

[0106] The results are shown in Table 1 below. When 10 g / L MSG was added exogenously, Lactobacillus plantarum JNU-JLB9 produced 16.41 g / L lactic acid, 2.17 g / L acetic acid, 0.69 g / L ethanol and 1.66 g / L GABA in MRS medium after fermentation for 24 h. This shows that Lactobacillus plantarum JNU-JLB9 is a heterofermentative lactic acid bacterium, but mainly produces lactic acid, with less acetic acid and ethanol production. In addition, Lactobacillus plantarum JNU-JLB9 also produces GABA using glutamate in the culture medium, indicating that Lactobacillus plantarum JNU-JLB9 has a certain GABA production capacity.

[0107] Table 1: Substrate utilization and metabolite production of MRS fermented by Lactobacillus plantarum JNU-JLB9 (added with 10 g / L MSG)

[0108]

[0109] 2. Gastric acid tolerance and intestinal fluid tolerance

[0110] (1) Preparation of fermentation seed liquid: The Lactobacillus plantarum JNU-JLB9 bacterial liquid stored in a glycerol tube was inoculated into a liquid MRS medium, cultured at 37°C for 24 hours, and activated three times according to the above method to obtain a bacterial liquid. The fully activated bacterial liquid was inoculated into 100 mL of liquid MRS medium at an inoculum volume of 10% (v / v), cultured at 37°C to the mid-logarithmic phase (fermentation time was 10-12 hours), and the culture liquid was diluted to 1×10 9CFU / mL was used as the fermentation seed solution.

[0111] (2) Preparation of simulated gastric fluid and simulated intestinal fluid:

[0112] The simulated gastric fluid was prepared by adding pepsin (1:10000) (purchased from Shanghai MacLean Biochemical Technology Co., Ltd., CAS No.: 9001-75-6) to sterile saline to make its concentration 3 g / L, and adjusting the pH to 2.5.

[0113] The method for preparing simulated intestinal fluid is as follows: add trypsin (1:250) (purchased from Shanghai McLean Biochemical Technology Co., Ltd., CAS No.: 9002-07-7) to sterile saline to a concentration of 1 g / L, adjust the pH to 8.0, and then add ox bile salt (purchased from Shanghai McLean Biochemical Technology Co., Ltd.) at a final concentration of 0.3%.

[0114] The simulated gastric fluid and simulated intestinal fluid were sterilized by filtration through a 0.22 μm sterile filter membrane.

[0115] (3) Gastric acid tolerance and intestinal fluid tolerance test:

[0116] The seed solution obtained in step (1) was dispensed into several sterile EP tubes with a volume of 1 mL of bacterial solution, and centrifuged at 8000 r / min for 10 min at 4°C to collect the bacterial cells. After static culture at 37°C for 0 h, 1 h, 2 h, and 2.5 h, an equal amount of simulated gastric fluid was immediately added to resuspend the cells. Static culture was continued at 37°C for 3 h, and the stress solution was centrifuged to collect the bacterial cells, and resuspended with sterile saline.

[0117] The method of simulated intestinal fluid tolerance test is similar to that of simulated gastric fluid, except that the treatment time intervals of simulated intestinal fluid are 0h, 1h, 2h, 3h and 4h. Resuspend with sterile saline, dilute 10 times and plate on MRS solid plate, and culture at 37℃ for 48h. The number of viable bacteria after stress is divided by the number of viable bacteria before stress to obtain the calculated survival rate.

[0118] The results are shown in Tables 2 and 3 below.

[0119] Table 2: Changes in survival rate of Lactobacillus plantarum JNU-JLB9 in simulated gastric fluid over time

[0120]

[0121] Table 3 Changes in survival rate of Lactobacillus plantarum JNU-JLB9 in simulated intestinal fluid over time

[0122]

[0123]

[0124] The results show:

[0125] During the 3-hour simulated gastric fluid stress process, the survival rate of Lactobacillus plantarum JNU-JLB9 was always above 50%, the survival rate of the stress time was less than 1 hour was above 90%, and the survival rate of the stress time was 3 hours was 55.76% (Table 2); during the 5-hour simulated intestinal fluid stress process, the survival rate of Lactobacillus plantarum JNU-JLB9 dropped sharply within the stress time of 0.5 to 1 hour, indicating that the strain was most damaged in the stage of just contacting the intestinal fluid stress environment, but when it adapted to this pressure (>1 hour stress), the degree of damage would be significantly reduced. After 5 hours of simulated intestinal fluid stress, the survival rate of Lactobacillus plantarum JNU-JLB9 was 17.39% (Table 3).

[0126] It can be seen that Lactobacillus plantarum JNU-JLB9 showed good tolerance to the simulated gastrointestinal fluid environment, especially to the gastric acid environment.

[0127] Example 3: Safety evaluation of Lactobacillus brevis D17 strain

[0128] This test example evaluated the safety of Lactobacillus brevis D17 and ensured the application safety of Examples 1-3.

[0129] The specific test method steps are:

[0130] (1) Whole genome analysis of strains

[0131] The whole genome sequence of Lactobacillus brevis D17 strain was compared with the Virulence Factor Database (VFDB) and the Antimicrobial Resistance Gene Database (CARD). According to the relevant guidelines of the European Food Safety Authority (EFSA), the genome identity (identity) greater than 80%, coverage (coverage) greater than 70% and E value less than l×e -10 As screening criteria, virulence factors and drug resistance genes were predicted.

[0132] Comparison with the Virulence Factor Database (VFDB) and the Drug Resistance Gene Database (CARD) showed that Lactobacillus brevis D17 had no potential virulence factors and drug resistance genes.

[0133] (2) Antibiotic resistance test

[0134] The KB disk diffusion method was used to determine the resistance of Lactobacillus brevis D17 strain to 12 commonly used antibiotics (penicillin G, ampicillin, erythromycin, norfloxacin, ciprofloxacin, chloramphenicol, cotrimoxazole, cefazolin, gentamicin, amikacin, tetracycline, and vancomycin). The seed solution of Lactobacillus brevis D17 strain was diluted to a bacterial concentration of 1×10 8CFU / mL, draw 1mL of bacterial solution into 15mL of MRS liquid medium containing agar cooled to 45℃, and mix well. After solidification, use sterile tweezers to evenly stick antibiotic sensitive paper on the plate. Place in a 37℃ incubator and incubate for 48h before measuring the diameter of the inhibition zone on the plate. Determine according to the antibiotic sensitivity test execution standards established by the Clinical and Laboratory Standards Institutes.

[0135] The results are shown in Table 4 below. Lactobacillus brevis D17 is sensitive to penicillin G, erythromycin, chloramphenicol, ampicillin, cefazolin and gentamicin; moderately sensitive to tetracycline and cotrimoxazole; and resistant to amikacin, norfloxacin, ciprofloxacin and vancomycin. Lactobacillus such as Lactobacillus plantarum and Lactobacillus brevis have intrinsic resistance to fluoroquinolones (norfloxacin, ciprofloxacin), aminoglycoside antibiotics (gentamicin, amikacin) and vancomycin, while the intrinsic resistance of lactobacillus generally does not cause safety problems. This shows that Lactobacillus brevis D17 only has intrinsic resistance that does not cause safety problems, and there is no risk of transferable resistance with potential safety hazards.

[0136] Table 4 Drug sensitivity results of Lactobacillus brevis D17

[0137]

[0138] Note: S means sensitive; I means moderately sensitive; R means resistant

[0139] (3) In vivo toxicity test in mice

[0140] Twenty 6-8 week old SPF BALB / c mice (10 males and 10 females, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were selected and lived in a 12-h light-dark cycle, constant ambient temperature (22±2°C), humidity (55±2%), free access to food and water. After one week of adaptation, the mice were randomly divided into 2 groups, 10 in each group (5 females and 5 males, and kept separately), and the groups were as follows:

[0141] (1) SD group (control group): mice were fed with standard feed (Co60 irradiated experimental mouse maintenance feed, purchased from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.) and 200 μL sterile saline;

[0142] (2) D17 group: In addition to the standard feed, 200 μL (concentration of 1×10 9 CFU / mL) of Lactobacillus brevis D17 bacterial suspension.

[0143] Daily gavage lasted for 28 days. The mice were weighed daily during gavage, and their food intake, drinking water, activity status, and mental state were observed and recorded. On the last day of the gavage period, all mice were fasted overnight, and then orbital blood was collected and the mice were euthanized by carbon dioxide method. The liver, spleen, kidney, and colon were then immediately removed for subsequent analysis. This experiment strictly followed the relevant ethical guidelines for experimental animals and was approved by the Experimental Animal Ethics Committee of Jiangnan University (Ethics Approval Number: JN.No20220315b0300601).

[0144] Organ index determination: The liver, spleen and kidneys were rinsed with physiological saline, dried with filter paper and weighed. The ratio of the weight to the final weight of the animal was the organ index.

[0145] Serum biochemical indexes determination: Commercial detection kits (purchased from Nanjing Jiancheng Bioengineering Institute) were used to detect serum alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein (TP), malondialdehyde (MDA), superoxide dismutase (SOD), triglyceride (TG), cholesterol (CHO), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) levels.

[0146] Histopathological examination: Tissue sections of the liver, spleen and colon were obtained, fixed with 4% paraformaldehyde, dehydrated, embedded, sectioned and stained with hematoxylin-eosin, and finally the tissue morphology was observed under an optical microscope.

[0147] The results are as follows Figure 7 , Figure 8 , Fig. 9 As shown in the 28-day mouse toxicology experiment, no mouse died, nor did it show other adverse health symptoms such as mental depression. The appetite, mental state, mouse skin, and fur were all normal. Lactobacillus brevis D17 had no effect on the weight and food intake of mice. The weight showed a gradual increase, and the weight gain and food intake of male mice were higher than those of female mice, which was in line with normal rules ( Figure 7 AB in the figure). Lactobacillus brevis D17 had no significant effect on the liver index, kidney index and spleen index, indicating that neither strain would cause abnormal weight changes in the liver, kidney and spleen of mice ( Figure 7 CE in the experiment). By observing the tissue morphology of the liver, spleen and colon, it was found that the liver, spleen and colon tissue morphology of the mice in the Lactobacillus brevis D17 strain experimental group were normal, similar to the control group (SD), and there was no histopathological abnormality in the liver, spleen cells and colon tissues ( Figure 8), further indicating that feeding Lactobacillus brevis D17 strain will not have a negative impact on the visceral and intestinal tissues of mice. In addition, Lactobacillus brevis D17 has no significant effect on serum alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), malondialdehyde (MDA), total protein (TP), triglycerides (TG), cholesterol (CHO) and low-density lipoprotein cholesterol (LDL), but can significantly increase the serum superoxide dismutase (SOD) content of male mice (increased by 10.2%). SOD is an important antioxidant enzyme that removes superoxide anion free radicals in the body and protects cells from damage by oxygen free radicals ( Fig. 9 ).

[0148] In summary, whole genome analysis and antibiotic resistance tests showed that Lactobacillus brevis D17 had no virulence factors or antibiotic resistance genes that could pose a safety hazard, and its drug resistance safety met multiple assessment criteria. In vivo safety assessments showed that Lactobacillus brevis D17 was non-toxic to mice, indicating that Lactobacillus brevis D17 was a safe and usable strain.

[0149] Example 4: Safety evaluation of Lactobacillus plantarum JNU-JLB9 strain

[0150] (1) Whole genome analysis of strains

[0151] The whole genome sequence of Lactobacillus plantarum JNU-JLB9 strain was compared with the Virulence Factor Database (VFDB) and the Antimicrobial Resistance Gene Database (CARD). According to the relevant guidelines of the European Food Safety Authority (EFSA), the genome identity (identity) greater than 80%, the gene sequence length coverage (coverage) greater than 70% and the E value less than l×e -10 As screening criteria, virulence factors and drug resistance genes were predicted.

[0152] Comparison with the Virulence Factor Database (VFDB) and the Drug Resistance Gene Database (CARD) showed that Lactobacillus plantarum JNU-JLB9 had no potential virulence factors and drug resistance genes.

[0153] (2) Antibiotic resistance test

[0154] The KB disk diffusion method was used to determine the resistance of Lactobacillus plantarum JNU-JLB9 strain to 12 commonly used antibiotics. The seed solution of Lactobacillus plantarum JNU-JLB9 strain was diluted to a bacterial concentration of 1×10 8CFU / mL, draw 1mL of bacterial solution into 15mL of MRS liquid medium containing agar cooled to 45℃, and mix well. After solidification, use sterile tweezers to evenly stick the drug-sensitive paper containing a certain concentration of antibiotics on the plate. Place it in a 37℃ incubator and culture it for 48h before measuring the diameter of the inhibition zone on the plate. Determine according to the antibiotic sensitivity test execution standards established by the Clinical and Laboratory Standards Institutes.

[0155] The results are shown in Table 5 below. Lactobacillus plantarum JNU-JLB9 is sensitive to penicillin G, chloramphenicol, cotrimoxazole, ampicillin, cefazolin and tetracycline; moderately sensitive to erythromycin; and resistant to norfloxacin, ciprofloxacin, gentamicin, amikacin and vancomycin. Lactobacillus such as Lactobacillus plantarum and Lactobacillus brevis have intrinsic resistance to fluoroquinolones (norfloxacin, ciprofloxacin), aminoglycoside antibiotics (gentamicin, amikacin) and vancomycin, while the intrinsic resistance of lactobacillus generally does not cause safety problems. This shows that Lactobacillus plantarum JNU-JLB9 only has intrinsic resistance that does not cause safety problems, and there is no risk of transferable resistance with potential safety hazards.

[0156] Table 5 Antibiotic susceptibility results of Lactobacillus plantarum JNU-JLB9

[0157]

[0158]

[0159] Note: S means sensitive; I means moderately sensitive; R means resistant

[0160] (3) In vivo toxicity test in mice

[0161] Twenty 6-8 week old SPF BALB / c mice (10 males and 10 females, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were selected and housed in a 12-h light-dark cycle, constant ambient temperature (22±2°C), humidity (55±2%), free access to food and water. After one week of adaptation, the mice were randomly divided into two groups, 10 in each group (5 females and 5 males, housed separately), and the groups were as follows:

[0162] (1) SD group (control group): mice were fed with standard feed (Co60 irradiated experimental mouse maintenance feed, purchased from Jiangsu Collaborative Pharmaceutical Bioengineering Co., Ltd.) and 200 μL sterile saline;

[0163] (2) JNU-JLB9 group: In addition to the standard diet, 200 μL (concentration of 1×10 9CFU / mL) of Lactobacillus plantarum JNU-JLB9 bacterial suspension.

[0164] Daily gavage lasted for 28 days. The mice were weighed daily during gavage, and their food intake, drinking water, activity status, and mental state were observed and recorded. On the last day of the gavage period, all mice were fasted overnight, and then orbital blood was collected and the mice were euthanized by carbon dioxide method. The liver, spleen, kidney, and colon were then immediately removed for subsequent analysis. This experiment strictly followed the relevant ethical guidelines for experimental animals and was approved by the Experimental Animal Ethics Committee of Jiangnan University (Ethics Approval Number: JN.No20220315b0300601).

[0165] Organ index determination: The liver, spleen and kidneys were rinsed with physiological saline, dried with filter paper and weighed. The ratio of the weight to the final weight of the animal was the organ index.

[0166] Serum biochemical indexes determination: Commercial detection kits (purchased from Nanjing Jiancheng Bioengineering Institute) were used to detect serum alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein (TP), malondialdehyde (MDA), superoxide dismutase (SOD), triglyceride (TG), cholesterol (CHO), low-density lipoprotein cholesterol (LDL) and high-density lipoprotein cholesterol (HDL) levels.

[0167] Histopathological examination: Tissue sections of the liver, spleen and colon were obtained, fixed with 4% paraformaldehyde, dehydrated, embedded, sectioned and stained with hematoxylin-eosin, and finally the tissue morphology was observed under an optical microscope.

[0168] The results are as follows Figure 4 , Figure 5 , Figure 6 As shown, in the 28-day mouse toxicology experiment, no mouse died, and no other adverse health symptoms such as mental depression occurred. Appetite, mental state, mouse skin, and fur all showed normal performance. Lactobacillus plantarum JNU-JLB9 had no effect on the weight and food intake of mice. The weight showed a gradual increase, and the weight gain and food intake of male mice were higher than those of female mice, which was in line with normal rules ( Figure 4 AB in).

[0169] Lactobacillus plantarum JNU-JLB9 had no significant effect on liver index, kidney index and spleen index, indicating that the bacteria did not cause abnormal weight changes in the liver, kidney and spleen of mice ( Figure 4 CE in ).

[0170] By observing the tissue morphology of the liver, spleen and colon, it was found that the liver, spleen and colon tissue morphology of the mice in the Lactobacillus plantarum JNU-JLB9 strain test group were normal, similar to the control group (SD), and there was no histopathological abnormality in the liver, spleen cells and colon tissues ( Figure 5 ), further indicating that feeding Lactobacillus plantarum JNU-JLB9 strain did not have a negative impact on the visceral and intestinal tissues of mice. In addition, Lactobacillus plantarum JNU-JLB9 had no significant effect on serum alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), superoxide dismutase (SOD), malondialdehyde (MDA), total protein (TP), triglycerides (TG), cholesterol (CHO) and low-density lipoprotein cholesterol (LDL) ( Figure 6 ).

[0171] In summary, whole genome analysis and antibiotic resistance tests showed that Lactobacillus plantarum JNU-JLB9 had no virulence factors or antibiotic resistance genes that could pose a safety hazard, and its drug resistance safety met multiple evaluation standards. In vivo safety assessments showed that Lactobacillus plantarum JNU-JLB9 was non-toxic to mice, indicating that Lactobacillus plantarum JNU-JLB9 was a safe and usable strain.

[0172] Example 5: Evaluation of inoculum amount of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 fermentation of oat milk

[0173] The specific steps are as follows:

[0174] 1. Preparation of GABA-enriched oat milk

[0175] (1) Preparation of prehydrolyzed oat flour

[0176] Oatmeal powder (purchased from Xuzhou Fangde Food Co., Ltd.) was mixed with water at a mass ratio of 1:4, and then 2% (m / v) α-amylase (named BAN480 L, purchased from Novozymes) was added and enzymolyzed at 60°C for 60 minutes. Subsequently, 2% (m / v) saccharifying enzyme (named Amylase AG 300L, purchased from Novozymes) was added to the enzymolysis solution and enzymolyzed at 60°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for 10 minutes. Subsequently, 0.2% (m / v) protease (named Neutrase 0.8L, purchased from Novozymes) was added to the inactivated enzymolysis solution and enzymolyzed at 50°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for another 10 minutes. Then it was filtered with a 60-mesh sieve. The enzymolysis solution was concentrated, then drum-dried, and finally ground into powder to obtain pre-hydrolyzed oatmeal powder.

[0177] (2) Preparation of prehydrolyzed oat milk

[0178] The prehydrolyzed oatmeal obtained in step (1) was mixed uniformly with water at a material-water ratio of 1:5 (m / v) to prepare prehydrolyzed oatmeal milk, which was sterilized at 115° C. for 30 min.

[0179] (3) Protease hydrolysis

[0180] 1% (m / v) protease ZB3-1P (purchased from Shandong Longkote Enzyme Preparation Co., Ltd., license number: SC20137132300142) was exogenously added to the pre-hydrolyzed oat milk obtained in step (2), placed in a 45°C water bath for enzymatic hydrolysis for 8 hours, and then sterilized and inactivated at 115°C for 30 minutes to obtain enzymatic oat milk for fermentation.

[0181] (4) Preparation of fermentation seed solution

[0182] The bacterial solution stored in the glycerol tube was connected to the liquid MRS medium and cultured at 37°C for 24 hours. The bacterial solution was activated three times according to the above method to obtain the bacterial solution. The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation amount and cultured at 37°C until the mid-logarithmic phase (fermentation time is 10-12 hours). The culture solution was diluted to 1×10 9 CFU / mL was used as the fermentation seed solution.

[0183] According to the above method, Lactobacillus brevis D17 fermentation seed liquid and Lactobacillus plantarum JNU-JLB9 fermentation seed liquid were prepared respectively.

[0184] (5) Strain fermentation

[0185] The Lactobacillus brevis D17 seed liquid obtained in step (4) was inoculated into the enzymatic oat milk obtained in step (3) at an inoculum amount of 2.5% (v / v), 5% (v / v) and 10% (v / v), respectively, and fermented at 37° C. and 200 rpm for 24 hours, with samples taken every 4 hours. The contents of maltose, glucose, lactic acid, acetic acid, ethanol, glutamic acid and GABA in the fermentation broth were detected by high performance liquid chromatography (HPLC).

[0186] According to the above method, the seed liquid of Lactobacillus plantarum JNU-JLB9 strain is inoculated into the enzymatic oat milk obtained in step (3) at an inoculum amount of 2.5% (v / v), 5% (v / v) and 10% (v / v), respectively, and fermented at 37° C. and 200 rpm for 24 hours, and samples are taken every 4 hours; the contents of maltose, glucose, lactic acid, acetic acid, ethanol, glutamic acid and GABA in the fermentation broth are detected by high performance liquid chromatography (HPLC).

[0187] The results show:

[0188] (1) Fermentation effect of Lactobacillus brevis D17

[0189] The results are as follows Figure 1 As shown, during the 24h fermentation cycle, when Lactobacillus brevis D17 was inoculated at an inoculum size of 2.5% (v / v), it was found that 5.9g / L of maltose and 6.4g / L of glucose were consumed, and 12.7g / L of lactic acid, 2.49g / L of acetic acid, and 1.56g / L of ethanol were produced; glutamate in oat milk could also be enzymatically hydrolyzed, and the glutamate content was reduced from 432mg / L to 124mg / L, producing 419mg / L of GABA.

[0190] When the D17 strain is inoculated at a 5% (v / v) inoculation rate, it can consume 7g / L maltose and 6.1g / L glucose, and produce 13.1g / L lactic acid, 2.6g / L acetic acid, and 1.8g / L ethanol. It can also utilize enzymatic hydrolysis of glutamate in oat milk, reducing the glutamate content from 430mg / L to 114mg / L, and producing 461mg / L of GABA.

[0191] When the D17 strain was inoculated at an inoculum size of 10% (v / v), it could consume 9.4 g / L maltose and 7.7 g / L glucose, and produce 14.5 g / L lactic acid, 3.24 g / L acetic acid, and 2.18 g / L ethanol. It could also utilize enzymatic hydrolysis of glutamate in oat milk, reducing the glutamate content from 429 mg / L to 84 mg / L, and producing 492 mg / L of GABA.

[0192] It can be seen that for the single-bacteria fermentation of the D17 strain, in order to reduce the degree of heterotypic fermentation and take into account the production of GABA, a low inoculation amount (2.5%) can be considered for inoculation fermentation.

[0193] (2) Fermentation effect of Lactobacillus plantarum JNU-JLB9

[0194] The results show:

[0195] The results are as follows Figure 2 As shown, during the 24h fermentation cycle, when Lactobacillus plantarum JNU-JLB9 was inoculated with an inoculum size of 2.5% (v / v), 7.3g / L glucose was consumed, and 14.5g / L lactic acid, 0.08g / L acetic acid, and 0.18g / L ethanol were produced; by enzymatic hydrolysis of glutamate in oat milk, the glutamate content was reduced from 432mg / L to 382mg / L, and 70.3mg / L GABA was produced.

[0196] When the JNU-JLB9 strain was inoculated at a 5% (v / v) inoculation rate, it consumed 7.1 g / L of glucose and produced 15.4 g / L of lactic acid, 0.16 g / L of acetic acid, and 0.3 g / L of ethanol. By enzymatic hydrolysis of glutamate in oat milk, the glutamate content was reduced from 430 mg / L to 372 mg / L, and the GABA produced was 78 mg / L.

[0197] When the JNU-JLB9 strain was inoculated at an inoculum size of 10% (v / v), it consumed 9.2 g / L of glucose and produced 16.7 g / L of lactic acid, 0.37 g / L of acetic acid, and 0.37 g / L of ethanol. By enzymatic hydrolysis of glutamate in oat milk, the glutamate content was reduced from 429 mg / L to 360 mg / L, and 86 mg / L of GABA was produced.

[0198] It is worth noting that the JNU-JLB9 strain has a very low utilization rate of maltose in the enzymatic hydrolyzed oat milk, almost no utilization. This inspired us to consider inoculation fermentation with a high inoculation amount for single-bacteria fermentation of the JNU-JLB9 strain in order to achieve a greater degree of homotypic fermentation and take into account the production of GABA.

[0199] Example 6: Co-fermentation of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 to hydrolyze oat milk

[0200] The specific steps are as follows:

[0201] (1) Preparation of Lactobacillus brevis D17 fermentation seed liquid and Lactobacillus plantarum JNU-JLB9 fermentation seed liquid

[0202] The bacterial solution stored in the glycerol tube was connected to the liquid MRS medium and cultured at 37°C for 24 hours. The bacterial solution was activated three times according to the above method to obtain the bacterial solution. The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation amount and cultured at 37°C until the mid-logarithmic phase (fermentation time is 10-12 hours). The culture solution was diluted to 1×10 9 CFU / mL was used as the fermentation seed solution.

[0203] According to the above method, Lactobacillus brevis D17 fermentation seed liquid and Lactobacillus plantarum JNU-JLB9 fermentation seed liquid were prepared respectively.

[0204] (2) Preparation of enzymatic oat milk

[0205] Oatmeal powder (purchased from Xuzhou Fangde Food Co., Ltd.) was mixed with water at a mass ratio of 1:4, and then 2% (m / v) α-amylase (named BAN480 L) was added and enzymolyzed at 60°C for 60 minutes. Subsequently, 2% (m / v) saccharifying enzyme (named Amylase AG 300L) was added to the enzymolysis solution and enzymolyzed at 60°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for 10 minutes. Subsequently, 0.2% (m / v) protease (named Neutrase 0.8L) was added to the inactivated enzymolysis solution and enzymolyzed at 50°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for another 10 minutes. Then it was filtered with a 60-mesh sieve. The enzymolysis solution was concentrated, then drum-dried, and finally ground into powder to obtain pre-hydrolyzed oatmeal powder.

[0206] The obtained pre-hydrolyzed oatmeal powder was mixed uniformly with water at a material-water ratio of 1:5 (m / v) to prepare pre-hydrolyzed oatmeal milk, which was sterilized at 115° C. for 30 min.

[0207] 1% (m / v) protease ZB3-1P (purchased from Shandong Longkote Enzyme Preparation Co., Ltd., license number: SC20137132300142) was exogenously added to the obtained pre-hydrolyzed oat milk, and the mixture was placed in a water bath at 45°C for 8 hours for enzymolysis, and then sterilized and inactivated at 115°C for 30 minutes to obtain enzymolyzed oat milk for fermentation;

[0208] (3) Oat milk co-fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9

[0209] The seed liquid of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 were inoculated into the enzymatic oat milk at seven inoculation ratios of 10:0, 9:1, 8:2, 7:3, 6:4, 5:5 and 0:10, respectively. The total inoculation amount of the strain was 1×10 9 CFU / mL, fermented at 37°C, 200 rpm for 24 h, and samples were taken every 4 h.

[0210] The total reducing sugar in the fermentation broth was determined by DNS method. The contents of maltose, glucose, lactic acid, acetic acid, ethanol, glutamic acid and GABA in the fermentation broth were detected by high performance liquid chromatography (HPLC).

[0211] The results are shown in Tables 6 to 12.

[0212] Table 6: Substrate utilization and metabolite production of oat milk fermented by Lactobacillus brevis D17 (10:0 group)

[0213]

[0214] Table 7: Substrate utilization and metabolite production of oat milk fermented by Lactobacillus plantarum JNU-JLB9 (0:10 group)

[0215]

[0216] Table 8: Substrate utilization and metabolite production of oat milk fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at a co-inoculation ratio of 8:2

[0217]

[0218]

[0219] Table 9: Substrate utilization and metabolite production of oat milk fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at a co-inoculation ratio of 9:1

[0220]

[0221] Table 10: Substrate utilization and metabolite production of oat milk fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at a co-inoculation ratio of 7:3

[0222]

[0223] Table 11: Substrate utilization and metabolite production of oat milk fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at a co-inoculation ratio of 6:4

[0224]

[0225]

[0226] Table 12: Substrate utilization and metabolite production of oat milk fermented with Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 at a co-inoculation ratio of 5:5

[0227]

[0228] The results show:

[0229] (1) During the 24-h fermentation period, Lactobacillus brevis D17 (10:0 group) consumed 7.56 g / L glucose and 5.3 g / L maltose, utilized 24.82 g / L of total reducing sugars, produced 11.06 g / L lactic acid, 3.97 g / L acetic acid and 1.06 g / L ethanol; the net utilization of glutamate was 330 mg / L, and the GABA produced was 480 mg / L.

[0230] (2) During the fermentation process, Lactobacillus plantarum JNU-JLB9 (0:10 group) consumed 11.48 g / L of glucose and basically did not utilize maltose. The total reducing sugar utilization was 21.4 g / L, producing 16.26 g / L of lactic acid, 1.79 g / L of acetic acid, and 0.41 g / L of ethanol. The net utilization of glutamate was 55 mg / L, and the GABA produced was 97 mg / L.

[0231] (3) The metabolite production of the co-fermentation system is between the two single bacteria, and the higher the ratio of JNU-JLB9 inoculated, the stronger the lactic acid production capacity, while the production of acetic acid, ethanol and GABA is less. The specific situation is as follows: compared with the D17 single bacteria fermentation, the acetic acid and ethanol contents decreased to 2.93 g / L and 0.35 g / L, respectively, which were reduced by 26.2% and 66.9%, respectively, indicating that the efficiency of mixed bacteria co-fermentation can significantly reduce the heterosexual fermentation characteristics of the D17 strain during fermentation, and can reduce the production of acetic acid and ethanol, which is of great significance for ensuring the flavor. Specifically, when the D17 strain was fermented with a single strain, the lactic acid and GABA produced were 8.1 g / L and 334 mg / L, respectively, which were 63.5% of the lactic acid production (12.75 g / L) and 79.7% of the GABA production (419 mg / L) during the entire fermentation cycle (24 h) (Example 2). When the mixed bacteria fermented (8:2) oat milk for 12 h, the lactic acid production was 9.8 g / L, reaching 73.2% of the lactic acid production (13.39 g / L) during the entire fermentation cycle, and the GABA production reached a peak at the midpoint of the fermentation (12 h). Therefore, the co-fermentation of the two bacteria does not affect the GABA production capacity of D17.

[0232] In summary, in order to reduce the content of acetic acid and ethanol in the enzymatic oat milk fermentation product and to achieve the yield of lactic acid and GABA, Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 were co-inoculated at a CFU ratio of 8:2 (total inoculation amount of 1×10 9 CFU / mL) fermentation of oat milk was the most suitable fermentation strategy. Under this inoculation ratio, the lactic acid production could reach 13.39 g / L, and the GABA production could also maintain a high level of 402 mg / L.

[0233] Therefore, considering flavor, nutrition and fermentation efficiency, D17 strain and JNU-JLB9 strain were inoculated at a ratio of 8:2 (total inoculum size was 1×10 9 CFU / mL) mixed fermentation is an ideal fermentation strategy.

[0234] 3. Fluorescence quantitative PCR analysis of biomass changes in co-fermented enzymatic oat milk

[0235] Primer design: The specific gene fragment was determined by comparing the whole genome sequences of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9. Specific primers were designed using the specific gene fragment (single copy) and named D17-F / D17-R and JNU-JLB9-F / JNU-JLB9-R.

[0236] DNA extraction: DNA from D17, JNU-JLB9 and oat milk co-fermentation broth was extracted according to the instructions of Qiagen PowerSoil DNA extraction kit, and the integrity and concentration of DNA were determined by agarose gel electrophoresis and NanoDrop 8000, respectively.

[0237] qPCR amplification: The DNA concentration of D17 and JNU-JLB9 was diluted to 100 ng / μL and diluted tenfold. Each dilution of DNA was used as a template for qPCR amplification, and a standard curve was prepared based on the linear relationship between the number of cycles (Ct value) and the number of gene copies. The DNA of pure culture and co-culture samples was diluted to 1 ng / μL with sterile ultrafiltered water and used as a template for qPCR amplification. The Ct value obtained by the reaction was substituted into the standard curve to obtain the number of gene copies of each sample. qPCR reaction program: Amplification program: 95℃ pre-denaturation for 30s, one cycle of 95℃ denaturation for 10s, 60℃ annealing for 10s, and 72℃ extension for 30s, for a total of 40 cycles; Melting curve program: After the amplification program, 95℃ was maintained for 15s, then reduced to 72℃ for 2min, and then increased to 95℃ at 0.5℃ / s for 15s.

[0238] The results are as follows Figure 3 As shown in the figure, the biomass of the D17 co-fermentation group was slightly higher than that of the D17 single fermentation group before the middle fermentation (12h), and the biomass of the D17 co-fermentation group was gradually lower than that of the D17 single fermentation group during the period from the middle fermentation to the end fermentation (24h), indicating that the growth of the D17 strain was not affected before the middle fermentation, and the growth was gradually inhibited from the late fermentation to the end. The biomass of the JNU-JLB9 co-fermentation group was significantly lower than that of the JNU-JLB9 single fermentation group before the middle fermentation (12h), and the biomass of the JNU-JLB9 co-fermentation group was gradually higher than that of the JNU-JLB9 single fermentation group during the period from the middle fermentation to the end fermentation (24h), indicating that the growth of the JNU-JLB9 strain was inhibited before the middle fermentation, but this growth inhibition gradually weakened and turned into growth promotion from the late fermentation to the end.

[0239] In other words, in the mixed bacteria fermentation system inoculated with 8:2 by Lactobacillus brevis D17 and plant lactobacillus JNU-JLB9, in the fermentation mid-term (12h) and the previous time period, the growth of D17 strain is not inhibited, but may be because of its high biomass of inoculation, the ecological niche occupied is many, and the growth of JNU-JLB9 strain is inhibited. But along with the fermentation, in the late fermentation period to the last stage (24h), the biomass of JNU-JLB9 strain increases gradually, and its growth inhibition phenomenon is removed, and then the growth of D17 strain is inhibited. The side shows that plant lactobacillus JNU-JLB9 competitive nutrition ability is stronger, if inoculated under the same biomass, plant lactobacillus JNU-JLB9 can competitively inhibit Lactobacillus brevis D17. It also further proved that the co-inoculation ratio of 8:2 is the optimal inoculation ratio, which can fully guarantee the fermentation performance of the D17 strain and the JNU-JLB9 strain. In the middle and before fermentation, the D17 strain can fully ferment and produce GABA, and in the middle and late fermentation, the JNU-JLB9 strain can fully ferment and produce lactic acid.

[0240] Example 7: Preparation of a postbiotic preparation containing GABA using oatmeal as a substrate

[0241] The specific steps are as follows:

[0242] (1) Preparation of Lactobacillus brevis D17 fermentation seed liquid and Lactobacillus plantarum JNU-JLB9 fermentation seed liquid

[0243] The bacterial solution stored in the glycerol tube was connected to the liquid MRS medium and cultured at 37°C for 24 hours. The bacterial solution was activated three times according to the above method to obtain the bacterial solution. The fully activated bacterial solution was inoculated into 100 mL of liquid MRS medium at a 10% (v / v) inoculation amount and cultured at 37°C until the mid-logarithmic phase (fermentation time is 10-12 hours). The culture solution was diluted to 1×10 9 CFU / mL was used as the fermentation seed solution.

[0244] According to the above method, Lactobacillus brevis D17 fermentation seed liquid and Lactobacillus plantarum JNU-JLB9 fermentation seed liquid were prepared respectively.

[0245] (2) Preparation of enzymatic oat milk

[0246] Oatmeal powder (purchased from Xuzhou Fangde Food Co., Ltd.) was mixed with water at a mass ratio of 1:4, and then 2% (m / v) α-amylase (named BAN480 L) was added and enzymolyzed at 60°C for 60 minutes. Subsequently, 2% (m / v) saccharifying enzyme (named Amylase AG 300L) was added to the enzymolysis solution and enzymolyzed at 60°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for 10 minutes. Subsequently, 0.2% (m / v) protease (named Neutrase 0.8L) was added to the inactivated enzymolysis solution and enzymolyzed at 50°C for 60 minutes. After the enzymolysis was completed, the enzyme was inactivated at 90°C for another 10 minutes. Then it was filtered with a 60-mesh sieve. The enzymolysis solution was concentrated, then drum-dried, and finally ground into powder to obtain pre-hydrolyzed oatmeal powder.

[0247] The obtained pre-hydrolyzed oatmeal powder was mixed uniformly with water at a material-water ratio of 1:5 (m / v) to prepare pre-hydrolyzed oatmeal milk, which was sterilized at 115° C. for 30 min.

[0248] 1% (m / v) protease ZB3-1P (purchased from Shandong Longkote Enzyme Preparation Co., Ltd., license number: SC20137132300142) was exogenously added to the obtained pre-hydrolyzed oat milk, and the mixture was placed in a water bath at 45°C for 8 hours for enzymolysis, and then sterilized and inactivated at 115°C for 30 minutes to obtain enzymolyzed oat milk for fermentation;

[0249] (3) Co-fermentation of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9

[0250] The seed liquid of Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 were inoculated into the enzymatic oat milk at a CFU ratio of 8:2, and the total inoculation amount of the strains was 1×10 9 CFU / mL, fermented at 37°C, 200 rpm for 24 h.

[0251] The results show:

[0252] Lactobacillus brevis D17 and Lactobacillus plantarum JNU-JLB9 were co-inoculated at a CFU ratio of 8:2 (total inoculation volume of 1×10 9 CFU / mL) fermentation of oat milk was the most suitable fermentation strategy. Under this inoculation ratio, the lactic acid production could reach 13.39 g / L, and the GABA production could also maintain a high level of 402 mg / L.

[0253] (4) Preparing a postbiotic preparation containing GABA from the fermentation end product obtained in step (3)

[0254] The fermentation end product is concentrated at 60-65°C for 1-2h, and after the total solid content reaches 20-40%, it is spray-dried to obtain the postbiotic powder containing GABA and fire-extinguishing bacteria. The spray drying conditions are: feed temperature 30-40°C, inlet temperature 130-150°C, outlet temperature 50-60°C, inlet air pressure 0.25-0.3MPa, centrifugal turntable speed 19000-20000r / min, and drying time 5-15s.

[0255] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Lactobacillus plantarum ( Lactiplantibacillus plantarum ), has been deposited in Guangdong Microbiological Culture Collection Center, with the deposit number GDMCC No: 64586 and the deposit date is April 30, 2024.

2. A microbial agent, characterized in that: The microbial agent contains the plant lactobacillus or its freeze-dried powder or its wet bacterial bodies as claimed in claim 1, and the Lactobacillus brevis CGMCC NO.14385 or its freeze-dried powder or its wet bacterial bodies.

3. The microbial agent according to claim 2, characterized in that: The microbial agent is obtained by mixing the plant lactobacillus and the brevis lactobacillus CGMCC NO.14385 in a ratio of 5-9:1-5 in terms of viable bacteria count.

4. The microbial agent according to claim 2 or 3, characterized in that: The number of viable bacteria in the microbial agent is not less than: 1×10 9 CFU / mL.

5. A method for preparing oat milk rich in GABA without adding glutamate and glutamate from exogenous sources, characterized in that: The oat milk is prepared according to the following steps: (1) Preparation of pre-hydrolyzed oat flour The oatmeal powder is mixed with water, α-amylase is added for enzymolysis, saccharifying enzyme is added to the enzymolysis solution for saccharification, and the enzyme is inactivated after the saccharification is completed; Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder; (2) mixing the prepared prehydrolyzed oatmeal powder with water in a material-water ratio of 1-2:5-10, sterilizing the mixture, and preparing prehydrolyzed oatmeal milk; (3) adding protease to the pre-hydrolyzed oat milk obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oat milk for fermentation; (4) Adding the microbial agent according to any one of claims 2 to 4 to the enzymatically hydrolyzed oat milk for fermentation obtained in step (3) and fermenting the oat milk to prepare oat milk.

6. The oat milk according to claim 5, characterized in that In step (3), the proteases are: protease ZB3-1P, lytic enzyme Viscozyme L, and neutral protease Neutrase 0.8 L.

7. The oat milk according to claim 6, characterized in that In step (1), the conditions for adding α-amylase for enzymatic hydrolysis are: 55-65°C for 60-70 min; the conditions for saccharifying by saccharifying enzyme are: 55-65°C for saccharifying for 60-70 min; the conditions for adding protease for enzymatic hydrolysis are: 50-60°C for 60-70 min; in step (3), the enzymatic hydrolysis conditions are: 40-50°C for 7-10 h; in step (4), the fermentation conditions are: 35-40°C, 100-200 rpm for 12-36 h.

8. The oat milk according to claim 7, characterized in that In step (1), the oatmeal powder and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase is 2-3% by mass volume ratio; the added amount of the saccharifying enzyme is 2-3% by mass volume ratio; and the added amount of the protease is 0.2-0.3% by mass volume ratio.

9. A method for increasing the GABA content in oat milk prepared by fermentation with Lactobacillus brevis and improving the flavor, characterized in that: The method does not require exogenous glutamate and glutamate, and specifically comprises the following steps: (1) Preparation of pre-hydrolyzed oat flour The oatmeal powder is mixed with water, α-amylase is added for enzymolysis, saccharifying enzyme is added to the enzymolysis solution for saccharification, and the enzyme is inactivated after the saccharification is completed; Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder; (2) mixing the prepared prehydrolyzed oatmeal powder with water in a material-water ratio of 1-2:5-10, sterilizing the mixture, and preparing prehydrolyzed oatmeal milk; (3) adding protease to the pre-hydrolyzed oat milk obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oat milk for fermentation; (4) Adding the microbial agent according to any one of claims 2 to 4 to the enzymatically hydrolyzed oat milk for fermentation obtained in step (3) and fermenting the oat milk to prepare oat milk.

10. The method according to claim 9, characterized in that In step (3), the proteases are: protease ZB3-1P, lytic enzyme Viscozyme L, and neutral protease Neutrase 0.8 L.

11. The method according to claim 10, characterized in that In step (1), the conditions for adding α-amylase for enzymatic hydrolysis are: 55-65°C for 60-70 min; the conditions for saccharifying by saccharifying enzyme are: 55-65°C for saccharifying for 60-70 min; the conditions for adding protease for enzymatic hydrolysis are: 50-60°C for 60-70 min; in step (3), the enzymatic hydrolysis conditions are: 40-50°C for 7-10 h; in step (4), the fermentation conditions are: 35-40°C, 100-200 rpm for 12-36 h.

12. The method according to claim 11, characterized in that In step (1), the oatmeal powder and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase is 2-3% by mass volume ratio; the added amount of the saccharifying enzyme is 2-3% by mass volume ratio; and the added amount of the protease is 0.2-0.3% by mass volume ratio.

13. A method for preparing GABA using oatmeal as a substrate, characterized in that: The method does not require exogenous addition of glutamate and glutamate, and specifically comprises the following steps: (1) Preparation of pre-hydrolyzed oat flour The oatmeal powder is mixed with water, α-amylase is added for enzymolysis, saccharifying enzyme is added to the enzymolysis solution for saccharification, and the enzyme is inactivated after the saccharification is completed; Adding protease to the enzyme-inactivated saccharification liquid for enzymolysis, inactivating the enzyme, and obtaining an enzymolysis liquid; concentrating and drying the obtained enzymolysis liquid to obtain pre-hydrolyzed oatmeal powder; (2) mixing the prepared prehydrolyzed oatmeal powder in a material-water ratio of 1-2:5-10, sterilizing, and preparing prehydrolyzed oatmeal; (3) adding protease to the pre-hydrolyzed oats obtained in step (2) for enzymatic hydrolysis to obtain enzymatically hydrolyzed oats for fermentation; (4) Inoculating Lactobacillus brevis CGMCC No. 14385 and Lactobacillus plantarum described in claim 1 into the enzymatically hydrolyzed oats obtained in step (3) at a CFU ratio of 5-9:1-5 for fermentation to obtain a fermentation mixture, and extracting GABA from the fermentation mixture.

14. The method according to claim 13, characterized in that In step (3), the proteases are: protease ZB3-1P, lytic enzyme Viscozyme L, and neutral protease Neutrase 0.8 L.

15. The method according to claim 14, characterized in that In step (1), the conditions for adding α-amylase for enzymatic hydrolysis are: 55-65°C for 60-70 min; the conditions for saccharifying by saccharifying enzyme are: 55-65°C for saccharifying for 60-70 min; the conditions for adding protease for enzymatic hydrolysis are: 50-60°C for 60-70 min; in step (3), the enzymatic hydrolysis conditions are: 40-50°C for 7-10 h; in step (4), the fermentation conditions are: 35-40°C, 100-200 rpm for 12-36 h.

16. The method according to claim 15, characterized in that In step (1), the oatmeal powder and water are mixed in a ratio of 1-2:4-8, the added amount of the α-amylase is 2-3% by mass volume ratio; the added amount of the saccharifying enzyme is 2-3% by mass volume ratio; and the added amount of the protease is 0.2-0.3% by mass volume ratio.

Images