A method for improving potato's resistance to soil compaction stress

Abstract

The present invention discloses a method for improving the resistance of potatoes to soil compaction stress, comprising the following steps: cloning the ETP2 gene and HA‑3×FLAG separately, and performing overlapping PCR; recombining with the PEG100 vector after enzyme digestion, and transforming potato stem segments using Agrobacterium tumefaciens until a strain overexpressing ETP2 is obtained. The present invention discloses for the first time that potato plants overexpressing ETP2 have a higher plant height and more biomass than the wild type, and the ability to resist soil compaction stress is also significantly higher than that of the wild type; potato plants overexpressing ETP2 planted in compacted soil have a significant improvement in plant height, aboveground biomass, number of internodes, root length and number of tubers compared to the wild type. In summary, the present invention utilizes ETP2 to improve the resistance of potatoes to soil compaction stress, which is of great significance for increasing potato yield, expanding potato planting areas, and ensuring food security.

Description

Technical Field

[0001] The invention relates to a method for improving the soil compaction stress resistance of potatoes and belongs to the field of biotechnology. Background Art

[0002] With the continuous advancement and development of science and technology, agricultural cropping systems are becoming increasingly centralized and mechanized, resulting in shorter crop rotations and the use of more heavy machinery. This farming system has led to increasing soil compaction stress. Furthermore, the extensive use of chemical fertilizers has exacerbated soil compaction, which in turn causes stress on plants. Soil compaction stress has severely degraded approximately 65 million hectares of land worldwide. It is estimated that soil compaction stress is the primary cause of land degradation across 33 million hectares in Europe and approximately 30% (approximately 4 million hectares) of the wheat belt in Western Australia. Problems related to soil compaction stress have been reported on nearly every continent. While considered a serious soil environmental problem, soil compaction stress is a very difficult type of degradation to pinpoint, primarily because it lacks visible surface traces, unlike other land degradation types such as erosion and salinization, which exhibit distinct changes on the soil surface. Soil compaction stress leads to specific problems such as poor root growth and reduced water infiltration, reducing crop yields.

[0003] Potatoes are currently the world's third-largest food crop and a staple in the agricultural landscape in my country and around the world. Because potatoes are harvested from underground tubers, they are highly susceptible to soil compaction stress. During potato growth and development, soil compaction stress can lead to stunted root growth, decreased photosynthesis, excessive accumulation of reactive oxygen species, insufficient water and nutrient absorption, and tuber deformities, ultimately significantly reducing tuber yield and quality.

[0004] Therefore, improving the potato's ability to resist soil compaction stress and reducing the impact of soil compaction stress on potato tuber development during potato planting are of great significance to my country's agricultural production and ensuring national food security. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for improving the resistance of potatoes to soil compaction stress for the first time.

[0006] Technical solution: To solve the above technical problems, the present invention provides a method for improving the resistance of potatoes to soil compaction stress, which overexpresses the ETP2 gene in potatoes; the nucleotide sequence of the ETP2 gene is shown in SEQ ID NO.1.

[0007] Specifically, the following steps are included:

[0008] (1) The ETP2 gene and HA-3×FLAG were cloned separately and then subjected to overlapping PCR to obtain the complete target fragment; the nucleotide sequence of the HA-3×FLAG is shown in SEQ ID NO. 7;

[0009] (2) The complete target fragment described in step (1) is recombined with the linearized PEG100 vector after enzyme digestion, and the potato stem segment is transformed using Agrobacterium tumefaciens to cultivate potatoes with high resistance to soil compaction stress.

[0010] The primer pair for PCR amplification of ETP2 in step (1) is shown as SEQ ID No. 3 and SEQ ID No. 4. The primer pair for PCR amplification of HA-3×FLAG is shown as SEQ ID No. 5 and SEQ ID No. 6.

[0011] The primer pair sequences for overlapping PCR in step (1) are shown as SEQ ID No. 3 and SEQ ID No. 6, respectively.

[0012] The present invention also provides a method for cultivating potatoes with high resistance to soil compaction stress, and the steps are the same as those of the above method.

[0013] The present invention also provides a method for increasing potato yield in compacted soil, the steps of which are the same as those of the above method.

[0014] The present invention also provides a method for increasing the plant height, aboveground biomass, number of internodes, root length or tuber number of potatoes in compacted soil, and the steps are the same as those of the above method.

[0015] The present invention also provides the use of an ETP2 gene having a nucleotide sequence as shown in SEQ ID NO. 1, a protein encoded by the ETP2 gene, a vector for overexpressing the ETP2 gene, or a recombinant bacterium containing the ETP2 gene in improving the resistance of potatoes to soil compaction stress.

[0016] The present invention also provides the use of an ETP2 gene having a nucleotide sequence as shown in SEQ ID NO. 1, a protein encoded by the ETP2 gene, a vector for overexpressing the ETP2 gene, or a recombinant bacterium containing the ETP2 gene in improving potato yield in compacted soil.

[0017] The present invention also provides the use of an ETP2 gene having a nucleotide sequence as shown in SEQ ID NO. 1, a protein encoded by the ETP2 gene, a vector for overexpressing the ETP2 gene, or a recombinant bacterium containing the ETP2 gene in increasing potato plant height, aboveground biomass, internode number, root length, or tuber number in compacted soil.

[0018] The present invention also provides the use of an ETP2 gene having a nucleotide sequence as shown in SEQ ID NO. 1, a protein encoded by the ETP2 gene, a vector for overexpressing the ETP2 gene, or a recombinant bacterium containing the ETP2 gene in cultivating potatoes with high resistance to soil compaction stress.

[0019] The method for overexpressing the ETP2 gene is to construct an ETP2 gene overexpression vector, the nucleotide sequence of which is shown in SEQ ID No. 2, and then transform potatoes by Agrobacterium infection to obtain potato plants overexpressing the ETP2 gene.

[0020] Among them, plants overexpressing the ETP2 gene were planted on hard culture medium.

[0021] Wherein, the concentration of Agar in the culture medium with increased hardness is 3%.

[0022] Among them, plants overexpressing the ETP2 gene were planted in compacted soil.

[0023] Wherein, the bulk density of the compacted soil is 2g / cm 3 .

[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0025] 1. Through systematic research, the present invention discloses for the first time that a potato Desiree strain that overexpresses the ETP2 gene grows in a medium simulating soil compaction and has higher plant height and more biomass than the wild type;

[0026] 2. The present invention discloses for the first time that potato lines overexpressing ETP2 exhibit significantly higher resistance to soil compaction stress than the wild type, with roots able to penetrate a hard culture medium (3% agar concentration), whereas the wild type cannot;

[0027] 3. The present invention discloses for the first time the method of planting on compacted soil (bulk density of 2.0g / cm 3 ) potato lines overexpressing ETP2 showed significantly improved plant height, aboveground biomass, number of internodes, root length, and tuber number compared to the wild type;

[0028] 4. The present invention shows that the ETP2 gene can be applied to potato to resist soil compaction stress, improve the yield-increasing ability of potato in compacted soil, and help increase the yield of potato in compacted soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1Creation and identification of ETP2 overexpression materials. A: PCR detection results of 7 ETP2 overexpression lines. B: Western blotting detection results of ETP2 overexpression lines.

[0030] Figure 2 Analysis of the growth of ETP2-overexpressing strains in high-hardness substrates. A: Growth phenotype of ETP2-overexpressing strains, B: Plant height, C: Root length;

[0031] Figure 3 Analysis of the aboveground growth of ETP2-overexpressing strains under soil compaction stress. A: Growth phenotype of ETP2-overexpressing strains after 10 and 50 days of growth. B: Plant height after 60 days of growth. C: Aboveground biomass after 60 days of growth. D: Number of internodes after 60 days of growth.

[0032] Figure 4 Root and tuber analysis of ETP2 overexpression lines under soil compaction stress. A: Growth of ETP2 overexpression lines under compacted soil conditions. B: Root length. C: Tuber weight. D: Tuber number. DETAILED DESCRIPTION

[0033] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0034] Example 1 Creation of transgenic potato plants

[0035] (1) Construction of ETP2 overexpression vector. Based on the sequence of ETP2 in the potato reference genome, the HA-3×FLA G sequence (SEQ ID No.7: TACCCATACGATGTTCCAGATTACGCTctcgatggaggaGACTAC AAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGA CAAG, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) and the PEG100 vector sequence (Earley et al., 2006), primer pairs SEQ ID No.3 and SEQ ID No.4, as well as primer pairs SEQ ID No.5 and SEQ ID No.6 (synthesized by Sangon Biotech (Shanghai) Co., Ltd.) were designed and synthesized. The cDNA of potato WT plant Desiree was used as a template (total RNA was extracted and reverse transcribed using the Novozymes RNA extraction kit RC401-01 and R412-01, respectively), and the primers PEG100-ETP2-F: SEQ ID No. 3: 5'-CATTTGGAGAGGACACGctcgagATGAAGACAATACAGGAGCAG-3' and ETP2-HA-R: SEQ ID No. 4: 5'-CG TAATCTGGAACATCGTATGGGTAGTGCCCTCTTTTCCTGTTG-3' were amplified from the CDS sequence of ETP2 (amplification system see Table 1, PCR program see Table 2), and the ETP2 sequence of Desiree (SEQ ID No. 1) was amplified and sequenced. The synthetic HA-3×FLAG was then used as a template to amplify the HA-3×FLAG tag using primers ETP2-HA-3×FLAG-F (SEQ ID No. 5: 5'-GCAACAGGAAAAGAGGGCACTACCCATACGATGTTCCAGATTACG-3') and PEG100-HA-3FLAG-R (SEQ ID No. 6: 5'-GACTAGTCCCGGGTCTTAATTAACTCTCTAGAT TACTTGTCATCG-3') (see Table 3 for amplification system and Table 4 for PCR program). The products of the two PCR reactions were used as templates to obtain the complete target fragment (SEQ ID No. 2) by overlapping PCR (see Table 5 for amplification system and Table 6 for PCR program; primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 6). The fragment was then recombined with the PEG100 vector, which had been double-digested with restriction endonucleases XbaI and XhoI (NEB, Beijing), to obtain a recombinant plasmid. (See Tables 7 and 8 for the recombination system and program) The recombinant plasmid was transformed into Escherichia coli DH5α.After the plasmid was amplified, it was sent to Sangon Biotechnology for sequencing to confirm the sequence was correct. The correct plasmid was then transformed into GV3101 Agrobacterium tumefaciens to obtain Agrobacterium containing the PEG100-ETP2-HA-3×FLAG plasmid.

[0036] Table 1 PCR reaction system

[0037]

[0038] Table 2 PCR program for amplifying target fragments

[0039]

[0040] Table 3 PCR reaction system

[0041]

[0042] Table 4 PCR program for amplifying target fragments

[0043]

[0044]

[0045] Table 5 Overlapping PCR reaction system

[0046]

[0047] Table 6 Overlap PCR program

[0048]

[0049] Table 7 Recombination reaction system

[0050]

[0051]

[0052] Table 8 Recombination reaction procedure

[0053]

[0054] (2) Potato genetic transformation. After completing plasmid construction, sterile potato Desiree seedlings (gifted by Professor Huang Binquan of Yunnan University) were cultured and genetically transformed using Agrobacterium tumefaciens GV3101 infection (Millam, S. (2006). Potato (Solanum tuberosum L.). In: Wang, K. (eds) Agrobacterium Protocols Vol ume 2. Methods in Molecular Biology, vol 344. Humana Press. https: / / doi.org / 10.1385 / 1-59745-131-2:25). All culture media involved were prepared according to the method described in that article.

[0055] (2.1) Working on a clean bench, cut internodes of stem segments approximately 10 mm long and with a cross-section diameter of no less than 2.5 mm from sterile potato seedlings grown in tissue culture flasks for 3-4 weeks.

[0056] (2.2) Add the Agrobacterium transformed with the PEG100-ETP2-HA-3×FLAG plasmid to a 2 mL sterile centrifuge tube, centrifuge at 5000×g for 3 min, and then resuspend the bacteria in liquid MS medium to a concentration of Agrobacterium reaching OD 600 =0.5~0.8.

[0057] (2.3) Pipette 1 mL of the resuspended Agrobacterium solution into a culture dish, then place the explants in the dish, seal it with parafilm, and place it in a constant temperature shaker at 22°C and 50 rpm for 15 min.

[0058] (2.4) In a clean bench, remove any residual moisture from the explant surface using sterile filter paper and blow dry. Then, transfer the explant to CM medium, seal with parafilm, and incubate at 22°C under low light for 48 h.

[0059] (2.5) Transfer the transformed explants from CM medium to CMC medium on a clean bench for co-cultivation. Seal the culture flask with parafilm and place it in an artificial climate chamber. The culture conditions are set at 23°C, 16 hours of light (light intensity of 80-110 μE / m 2 / s), long-day conditions of 8 h darkness.

[0060] (2.6) After 12 days, transfer the explants from the CMC culture medium to the CMCK culture medium on a clean bench for culture. Seal the culture dish with parafilm and place it in an artificial climate chamber. The climate chamber conditions are 23°C, 16 hours of light (light intensity of 80-110 μE / m 2 / s), 8h dark, and CMCK medium was replaced every 14d.

[0061] (2.7) When the CMCK medium was changed for the third time, 5-10 mm clustered shoots were carefully cut on a clean bench and placed in SM medium. After sealing, the buds were placed in an artificial climate chamber at 23°C and 16 h of light (light intensity of 80-110 μE / m 2 / s), 8h darkness.

[0062] (2.8) After 14 days of culture in SM medium, 10-15 mm shoot tips were cut from surviving seedlings and screened twice in fresh SM medium supplemented with BASTA at a final concentration of 12.5 μg / mL. The SM medium was changed every 14 days.

[0063] (2.9) When the SM medium is changed for the fourth time, remove the shoot tips on the clean bench and continue screening. At the same time, remove a small number of leaves and extract DNA for PCR testing of positive plants.

[0064] (3) PCR identification of transgenic lines. DNA extracted from potato leaves was used as a template, and primers PEG100-F: SEQ ID NO.8: 5'-ACGCACAATCCCACTATC-3' and PEG100-R: SEQ ID NO.9: 5'-CGATCATAGGCGTCTCGC-3' on both sides of the target gene were used to perform PCR detection on positive seedlings that could root on SM screening medium (system and procedure are shown in Tables 9 and 10). The transformed plasmid PEG100-ETP2-HA-3×FLAG and wild-type potato total DNA were used as positive (CK) and negative controls (WT), respectively, to detect whether the vector had entered the potato genome. The test results are shown in Figure 9. Figure 1 As shown in A, a total of 7 lines were detected to have the target fragment containing ETP2 successfully inserted into their genomes, indicating that the ETP2 gene has been successfully transferred into WT potato plants.

[0065] Table 9 PCR reaction system

[0066]

[0067] Table 10 PCR program

[0068]

[0069] (4) Identification of ETP2 protein in transgenic lines. For transgenic lines identified as positive by PCR, Western-blotting was used to detect whether the target protein was successfully expressed. Figure 1As shown in Figure B, clear target protein bands were detected in four transgenic lines using the anti-DDDDK-Tag (anti-FLAG) monoclonal antibody, indicating successful expression of ETP2-HA-3×FLAG in these lines. Coomassie Brilliant Blue (CBB) staining revealed the major band of Rubisco's large subunit, serving as a guide for sample loading. Western blotting used an anti-DDDDK-Tag monoclonal antibody (ABclonal, AE005) as the primary antibody, and an HRP-conjugated goat anti-mouse IgG (H+L) (ABclonal, AS003) as the secondary antibody.

[0070] Example 2. Growth analysis of ETP2 overexpression strains in high-hardness substrates

[0071] (1) Preparation of high-hardness culture medium. Prepare BM culture medium with 1% and 3% agar concentration respectively. After autoclaving at 121°C, wait for the culture medium to cool to about 55°C. First, pour the BM culture medium with 3% agar concentration into the tissue culture bottle as the lower layer culture medium. After the lower layer culture medium solidifies, pour the BM culture medium with 1% agar concentration as the upper layer culture medium. Wait until it completely solidifies and then put it away.

[0072] (2) Plants overexpressing ETP2 were grown in a high-hardness medium. Internode stem segments of about 10 mm in length and 2.5 mm in diameter were cut from sterile WT seedlings and ETP2-overexpressing plants (ETP2-OE-7 and ETP2-OE-11) on a clean bench and placed on the upper layer of BM medium. They were then placed in an artificial climate chamber with growth conditions set at 23°C and 16 h of light (light intensity of 80-110 μE / m 2 / s) and grown under 8h dark conditions.

[0073] (3) Analysis of the root growth of the plant. Figure 2 As shown in Figure A (the two figures below are enlarged versions of the two figures above), in the upper culture medium with an agar concentration of 1%, the roots of both WT and ETP2-overexpressing strains can grow normally. In the lower culture medium with an agar concentration of 3%, the roots of WT cannot penetrate the hard culture medium and continue to grow, while the roots of ETP2-overexpressing strains can penetrate the hard culture medium and continue to grow. In the high-hardness culture medium, the plant height and root length of the ETP2-overexpressing strain are significantly higher than those of WT. This indicates that overexpression of ETP2 helps potato roots resist soil compaction stress.

[0074] Example 3. Agronomic trait analysis of ETP2 overexpression lines under soil compaction stress

[0075] (1) Soil compaction stress setting. The present invention uses the ring knife method to take soil samples and dry them, measure the soil bulk density, and calculate the soil bulk density according to the calculation formula of soil bulk density: soil bulk density (ρb) = dried soil sample mass / ring knife volume, and finally set the soil compaction degree according to the soil bulk density. The bulk density of the uncompacted soil is set to 1g / cm 3 , the bulk density of compacted soil is set to 2g / cm 3 .

[0076] (2) Overexpression of ETP2 promotes the aboveground growth of potato under soil compaction stress. To investigate the growth of ETP2 overexpression lines under soil compaction stress, potato WT plants and overexpression lines ETP2-OE-7 and ETP2-OE-11, which were propagated at the same time and had similar plant sizes, were planted in compacted soil, and the growth of the plants was measured after 60 days. Figure 3 As shown in the results, the plant height, aboveground biomass, and internode number of the overexpressing lines ETP2-OE-7 and ETP2-OE-11 were significantly higher than those of WT plants at the same growth period, regardless of whether they were 10, 50, or 60 days old. This suggests that overexpression of ETP2 promotes aboveground growth of potato under soil compaction stress.

[0077] (3) Overexpression of ETP2 helps potatoes resist soil compaction stress. The roots of WT, ETP2-OE-7, and ETP2-OE-11 strains grown for 60 days were removed from the compacted soil as much as possible, and the length of the underground roots and the size of the tubers were observed and measured. Figure 4 As shown in the results, under compacted soil conditions, the root lengths of ETP2-OE-7 and ETP2-OE-11 plants were significantly longer than those of WT plants at the same time. The number of tubers in ETP2-OE-7 and ETP2-OE-11 plants was slightly greater than that of WT plants, while the tuber weight was significantly higher than that of WT plants at the same time. These results indicate that overexpression of ETP2 helps potato resist soil compaction stress, promotes root growth, and increases tuber weight.

Claims

1. A method for improving the resistance of potatoes to soil compaction stress, characterized in that: Overexpression in potato ETP2 gene; ETP2 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that The specific steps include: (1) ETP2 Genes and HA-3×FLAG Clone them separately and perform overlapping PCR to obtain the complete target fragment; described HA-3×FLAG The nucleotide sequence is shown in SEQ ID NO.7; (2) The complete target fragment described in step (1) is recombined with the linearized PEG100 vector after enzyme digestion, and the potato stem segment is transformed using Agrobacterium tumefaciens to cultivate potatoes with high resistance to soil compaction stress.

3. The method according to claim 2, characterized in that In step (1) ETP2 The nucleotide sequences of the PCR amplification primer pair are shown in SEQ ID No. 3 and SEQ ID No. 4; HA-3×FLAG The nucleotide sequences of the PCR amplification primer pair are shown as SEQ ID No.5 and SEQ ID No.

6.

4. A method for cultivating potatoes with high resistance to soil compaction stress, characterized in that: The steps are as shown in any one of claims 1 to 3.

5. A method for increasing potato yield in compacted soil, characterized in that: The steps are as shown in any one of claims 1 to 3.

6. A method for increasing plant height, aboveground biomass, number of internodes, root length or tuber number of potatoes in compacted soil, characterized in that: The steps are as shown in any one of claims 1 to 3.

7. Overexpression ETP2 The application of the gene in improving the resistance of potato to soil compaction stress is characterized in that: described ETP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

8. Overexpression ETP2 The application of the gene in breeding potatoes with high resistance to soil compaction stress is characterized in that: described ETP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

9. Overexpression ETP2 The invention relates to a method for increasing potato yield in compacted soil by using a gene, characterized in that: described ETP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

10. Overexpression ETP2 The invention relates to a method for increasing the plant height, aboveground biomass, number of internodes, root length or tuber number of potatoes grown in compacted soil, wherein: described ETP2 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

11. The use according to any one of claims 7 to 10, characterized in that: Overexpression vectors were used.

Images