A method and system for predicting pulmonary hypertension

Abstract

The present invention discloses a method and system for predicting pulmonary hypertension. The present invention can well predict whether a patient has pulmonary hypertension by detecting the expression level of LINC02736 and / or AC009268.2, providing a new direction for early diagnosis and treatment of pulmonary hypertension, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of intelligent medical treatment, and in particular to a method and system for predicting pulmonary hypertension. Background Art

[0002] Pulmonary hypertension (PH) is a cardiovascular disease whose pathogenesis has not yet been elucidated. It is characterized by progressive occlusive vascular lesions in the pulmonary arteries, with high morbidity and mortality. Most patients have already developed right heart failure when they are discovered, and the disease progresses to the terminal stage. Therefore, early detection, early diagnosis, and early treatment are particularly important for prolonging the survival and improving the quality of life of patients with PH.

[0003] Studying biomarkers related to pulmonary hypertension can achieve early prediction of pulmonary hypertension and provide new means and directions for early intervention and treatment of pulmonary hypertension. Summary of the invention

[0004] To overcome the deficiencies of the prior art, the present invention provides a method and system for predicting pulmonary hypertension.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides a method for predicting pulmonary hypertension, the method comprising:

[0007] Obtaining expression data of predicted genes in the sample to be tested;

[0008] Extracting expression data of the predicted genes, wherein the predicted genes include AC009268.2;

[0009] Classification prediction is performed based on the expression data of the predicted gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension.

[0010] Furthermore, the predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain predicted genes with significant expression.

[0011] Furthermore, the predicted gene also includes LINC02736.

[0012] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0013] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0014] A second aspect of the present invention provides a pulmonary hypertension prediction system, the system comprising:

[0015] Acquisition unit: used to obtain the expression data of the predicted gene in the sample to be tested;

[0016] An extraction unit: used to extract the expression data of the predicted gene, wherein the predicted gene includes AC009268.2;

[0017] Prediction unit: used to perform classification prediction based on the expression data of the prediction gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension.

[0018] Furthermore, the predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain predicted genes with significant expression.

[0019] Furthermore, the predicted gene also includes LINC02736.

[0020] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0021] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0022] The third aspect of the present invention provides a computer device, comprising: a memory and a processor; the memory is used to store program instructions; the processor is used to call program instructions, and when the program instructions are executed, it is used to execute the steps of the method described in the first aspect of the present invention.

[0023] A fourth aspect of the present invention provides a computer-readable storage medium having a computer program stored thereon, wherein when the computer program is executed by a processor, the steps of the method described in the first aspect of the present invention are implemented.

[0024] A fifth aspect of the present invention provides a computer program product, comprising a computer program, which, when executed by a processor, implements the steps of the method described in the first aspect of the present invention.

[0025] A sixth aspect of the present invention provides use of a reagent for detecting the expression level of AC009268.2 and / or LINC02736 in the preparation of a product for diagnosing pulmonary arterial hypertension.

[0026] Furthermore, the reagents include primers for specifically amplifying AC009268.2 and / or LINC02736, and probes for specifically recognizing AC009268.2 and / or LINC02736.

[0027] Furthermore, the sequences of primers for specific amplification of AC009268.2 are shown in SEQ ID NO: 1-2.

[0028] Furthermore, the sequences of primers for specific amplification of LINC02736 are shown in SEQ ID NO:3-4.

[0029] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0030] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0031] A seventh aspect of the present invention provides a product for diagnosing pulmonary arterial hypertension, comprising a reagent for detecting the expression level of AC009268.2 and / or LINC02736.

[0032] Furthermore, the product includes a kit, a chip or a nucleic acid membrane strip.

[0033] Furthermore, the kit also includes a detectable reagent.

[0034] Furthermore, the detectable markers include magnetic beads, fluorescent dyes, radioactive markers, and enzymes.

[0035] Furthermore, the kit also includes instructions.

[0036] Furthermore, the kit also includes a buffer solution.

[0037] Advantages and beneficial effects of the present invention:

[0038] This application can well predict whether a person has pulmonary hypertension by detecting the expression levels of LINC02736 and / or AC009268.2, providing a new direction for the early diagnosis and treatment of pulmonary hypertension, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a flowchart of the prediction method of pulmonary hypertension;

[0040] Figure 2 It is a schematic diagram of the pulmonary hypertension prediction system;

[0041] Figure 3 It is a schematic diagram of computer equipment;

[0042] Figure 4 It is a sample PCA analysis graph;

[0043] Figure 5 It is the volcano map and heat map of differential lncRNA;

[0044] Figure 6 is the expression level graph of AC009268.2 in the training set;

[0045] Figure 7 is the expression level graph of LINC02736 in the training set;

[0046] Figure 8 This is the ROC curve of AC009268.2 in the training set;

[0047] Fig. 9 This is the ROC curve of LINC02736 in the training set;

[0048] Fig.10 This is the ROC curve of the joint diagnosis of AC009268.2 and LINC02736 in the training set;

[0049] Fig.11 This is the expression level graph of AC009268.2 in the validation set;

[0050] Fig.12 is the expression level graph of LINC02736 in the validation set;

[0051] Fig.13 This is the ROC curve of AC009268.2 in the validation set;

[0052] Fig.14 This is the ROC curve of LINC02736 in the validation set;

[0053] Fig.15 This is the ROC curve of the joint diagnosis of AC009268.2 and LINC02736 in the validation set. DETAILED DESCRIPTION

[0054] The definitions of some terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0055] In some of the processes described in the specification and claims of the present invention and the above-mentioned figures, multiple operations that appear in a specific order are included, but it should be clearly understood that these operations may not be executed in the order in which they appear in this article or executed in parallel. The serial numbers of the operations, such as 101, 102, etc., are only used to distinguish different operations, and the serial numbers themselves do not represent any execution order. In addition, these processes may include more or fewer operations, and these operations may be executed in sequence or in parallel. It should be noted that the descriptions of "first", "second", etc. in this article are used to distinguish different messages, devices, modules, etc., do not represent the order of precedence, and do not limit the "first" and "second" to be different types.

[0056] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0057] Figure 1 : is a flow chart of a method for predicting pulmonary hypertension provided by an embodiment of the present invention. Specifically, the method comprises the following steps:

[0058] 101: Obtain the expression data of the predicted gene of the sample to be tested

[0059] In one embodiment, pulmonary hypertension includes idiopathic pulmonary arterial hypertension (PAH), pulmonary arterial hypertension caused by left heart disease, pulmonary arterial hypertension caused by lung disease / hypoxia, pulmonary arterial hypertension caused by pulmonary artery obstruction, and pulmonary arterial hypertension caused by unknown or multiple factors.

[0060] Among them, idiopathic pulmonary hypertension includes heritable PH, PH caused by drugs and toxins, primary PH related to other diseases (connective tissue disease, HIV infection, portal hypertension, congenital heart disease, schistosomiasis, etc.), primary pulmonary hypertension with obvious venous / capillary involvement, and persistent pulmonary hypertension of the newborn.

[0061] Pulmonary hypertension caused by left heart disease includes PH caused by heart failure with preserved ejection fraction, PH caused by heart failure with reduced ejection fraction, post-capillary PH caused by congenital / acquired cardiovascular disease, and PH related to valvular heart disease.

[0062] Pulmonary hypertension caused by lung disease / hypoxia, such as chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis and mixed lung disease. In addition, pulmonary hypoxia without lung disease can also cause PH.

[0063] Pulmonary hypertension caused by pulmonary artery obstruction, such as chronic thromboembolic pulmonary hypertension (CTEPH).

[0064] PH of unknown cause or multifactorial cause, such as blood system diseases, systemic and metabolic diseases, and other systemic diseases.

[0065] In a preferred embodiment, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0066] In a specific embodiment, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension (CTEPH).

[0067] In one embodiment, the sample to be tested or the subject to be tested refers to any animal (e.g., mammal), including but not limited to humans, non-human primates, rodents, etc., which will be the recipient of a specific treatment. Generally, subjects and patients are used interchangeably herein when referring to human subjects.

[0068] In a preferred embodiment, the sample to be tested is a human.

[0069] In one embodiment, the sample to be tested is a patient used for clinical diagnosis.

[0070] In one embodiment, the predicted gene can be obtained through database data and sequencing data.

[0071] In a preferred embodiment, the predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain significantly expressed predicted genes.

[0072] The specific process is as follows:

[0073] Sequencing samples: 7 CTEPH patients and 5 healthy controls.

[0074] Inclusion criteria:

[0075] CTEPH was diagnosed by right heart catheterization (RHC) combined with lung ventilation and perfusion scanning and computed tomographic pulmonary angiography (CTPA).

[0076] All healthy volunteers were from the Health Examination Center of the China-Japan Friendship Hospital, with normal lung and liver functions, routine blood and urine tests, thyroid hormone levels, and electrocardiograms.

[0077] Exclusion criteria:

[0078] 1) Patients who underwent balloon pulmonary angioplasty (BPA).

[0079] 2) Patients without complete RHC data or who received PEA before blood sample collection.

[0080] 3) Participants with other types of pulmonary hypertension, smoking, chronic obstructive pulmonary disease, obstructive sleep apnea syndrome, asthma, infection, interstitial lung disease, connective tissue disease, endocrine disease, hypertension, diabetes, coronary heart disease, cardiomyopathy, congenital heart disease, malignant tumors, hepatitis and cirrhosis, nephritis and renal failure.

[0081] 1. Library construction and sequencing process

[0082] 1) Total RNA DNase I digestion: Use DNase I to digest the DNA fragments in the total RNA sample, purify the reaction products with magnetic beads, and finally dissolve them in DEPC water.

[0083] 2) Removal of rRNA: Remove the purified Total RNA sample and use a kit to remove rRNA. After removal, perform Agilent 2100 detection to verify the rRNA removal effect.

[0084] 3) mRNA shearing: Take the sample from the previous step, add shearing buffer, and place it in a PCR instrument for thermal shearing to 140-160 nt.

[0085] 4) Synthesis of one chain of reverse transcription: Add appropriate amount of primers to the sheared sample, mix thoroughly and react in a Thermomixer at an appropriate temperature for a certain period of time to open the secondary structure and bind with the primers, then add the one-chain synthesis reaction system Mix prepared in advance, and synthesize one-chain cDNA according to the corresponding program on the PCR instrument.

[0086] 5) Synthesis of the second strand of reverse transcription: prepare the second strand synthesis reaction system, react at an appropriate temperature for a certain period of time on a Thermomixer to synthesize the second strand of cDNA with dUTP, and purify and recover the reaction product using magnetic beads.

[0087] 6) End repair: Prepare the end repair reaction system, react at an appropriate temperature for a certain period of time in a Thermomixer, and repair the sticky ends of the cDNA double strands obtained by reverse transcription under the action of the enzyme. The end repair product is purified and recovered using magnetic beads, and finally the sample is dissolved in EB Solution.

[0088] 7) Adding "A" to the 3' end of cDNA: Prepare the "A" addition reaction system, react at an appropriate temperature for a certain period of time in a Thermomixer, and under the action of the enzyme, add the A base to the 3' end of the end-repaired product cDNA.

[0089] 8) Connection of cDNA 5'adapter: Prepare the adapter connection reaction system, react at an appropriate temperature for a certain time in a Thermomixer, connect the adapter to the A base under the action of the enzyme, and purify and recover the product with magnetic beads.

[0090] 9) UNG digestion of cDNA second strand: Prepare UNG digestion reaction system, digest the second strand of double-stranded DNA with UNG enzyme, and purify and recover the product with magnetic beads.

[0091] 10) PCR reaction and product recovery: Prepare the PCR reaction system, select the appropriate PCR reaction program, amplify the product obtained in the previous step, purify the PCR product with magnetic beads, dissolve the recovered product in EB solution, and label it. The library preparation is now complete.

[0092] 11) Library quality detection: The library quality was detected using Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System.

[0093] 12) Sequencing: After the qualified library is tested, NaOH is added to denature it into a single strand, and it is diluted to a certain concentration according to the expected amount of data to be loaded onto the machine. The denatured and diluted library is added to the FlowCell, hybridized with the adapter on the FlowCell, bridge PCR amplification is completed on the cBot, and finally sequenced using the BGIseq platform, using the PE100 strategy.

[0094] 2. Bioinformatics analysis

[0095] The rawdata analysis process after sequencing data is obtained is as follows:

[0096] 1) Use fastp to trim the 5' and 3' segments of the reads, trim the bases with quality < 20, and delete the reads with N greater than 10%.

[0097] 2) Hisat2 was aligned to the reference genome. The reference genome comes from the Ensembl database, the genome version is GRCh38, and the gene annotation information is Ensemble 92.

[0098] 3) stringtie quantifies lncRNA expression and standardizes the output.

[0099] 4) DESeq2 compares the expression differences of lncRNA between the control group and the disease group.

[0100] 3. Raw sequencing data

[0101] Based on the Sequencing By Synthesis (SBS) technology, the Illumina HiSeq high-throughput sequencing platform is used to sequence the cDNA library, which can produce a large number of high-quality Reads. These Reads or bases produced by the sequencing platform are called raw data. To facilitate the analysis, publication and sharing of sequencing data, the raw image data obtained by Illumina sequencing is converted into sequence data through Base Calling, that is, FASTQ format, to obtain the most original sequencing data file.

[0102] 4. Sequencing data quality control

[0103] Since the raw sequencing data may contain sequencing adapter sequences, low-quality reads, sequences with high N rates, and sequences that are too short, this will seriously affect the quality of subsequent assembly. To ensure the accuracy of subsequent bioinformatics analysis, the raw sequencing data is first filtered to obtain high-quality sequencing data (clean data).

[0104] The specific steps and sequence are as follows:

[0105] 1) Remove the adapter sequence in the reads.

[0106] 2) Remove non-AGCT bases at the 5' end before cleavage.

[0107] 3) Trim the ends of reads with low sequencing quality (sequencing quality value less than Q20).

[0108] 4) Remove reads containing N at a ratio of 10%.

[0109] 5) Discard small fragments less than 25 bp in length after adapter removal and quality trimming.

[0110] Software used: fastp.

[0111] 5. Comparison with reference genome

[0112] In transcriptome sequencing data, only data mapped to the reference genome can be used for subsequent analysis. Therefore, reads mapped to the specified reference genome are called mapped reads. Alignment efficiency refers to the percentage of mapped reads to clean reads, which is the most direct reflection of transcriptome data utilization. The high-quality sequencing sequences obtained after quality control are aligned with the specified reference genome, and the reference genome version is GRCh38.

[0113] In addition to being affected by the quality of data sequencing, the alignment efficiency is also related to the quality of the specified reference genome assembly and the biological classification relationship (subspecies) between the reference genome and the sequenced sample. If the reference genome is selected appropriately and there is no contamination in the relevant experiment, the percentage of alignment of the sequencing sequences generated by the experiment will normally be higher than 70%.

[0114] Analysis software: HISAT2, version v 2.1.0, https: / / ccb.jhu.edu / software / hisat2 / index.shtml.

[0115] 6. PCA principal component analysis among lncRNA samples

[0116] Sample PCA analysis is as follows Figure 4 shown.

[0117] 7. lncRNA differential expression analysis

[0118] Differential expression analysis was performed using DEseq2 with screening parameters of pvalue < 0.05 and |log2foldchange| > 1.

[0119] The volcano plot and heat map of differentially expressed lncRNAs are shown in Figure 2. Figure 5 shown.

[0120] 102: Extract the expression data of the predicted gene, the predicted gene includes AC009268.2

[0121] In one embodiment, the predicted gene also includes LINC02736.

[0122] In the training set, AC009268.2 was significantly downregulated in CTEPH ( Figure 6 ), LINC02736 was significantly upregulated in CTEPH ( Figure 7 ), the AUCs of AC009268.2 and LINC02736 were 0.929 and 0.871, respectively ( Figure 8 and Fig. 9 ), the AUC value of the combined diagnosis of AC009268.2 and LINC02736 was 0.971 ( Fig.10 ).

[0123] Clinical sample validation of AC009268.2 and LINC02736:

[0124] Validation samples: 28 CTEPH patients and 30 healthy subjects.

[0125] 1. Primer design

[0126] Real Time PCR detection target gene primers are as follows:

[0127] AC009268.2-F:TCCCTGCCCTCATACTAGTCC(SEQ ID NO:1)

[0128] AC009268.2-R:AGAGGCCCCTAGAGAACTGAG(SEQ ID NO:2)

[0129] LINC02736-F:TCATTCCAGCACTCACCACC(SEQ ID NO:3)

[0130] LINC02736-R:AACAAGTCAGCTGCCCCATC(SEQ ID NO:4)

[0131] 2. Extract total RNA from samples

[0132] 1) Add 0.75 mL MagZol LS Reagent to the EP tube, then add 0.25 mL blood sample, mix by pipetting 3-5 times, then vortex mix for more than 15 seconds to completely disperse the precipitate, and leave at room temperature for 5-10 minutes.

[0133] 2) Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and place on ice for 10 minutes.

[0134] 3) Centrifuge at 12000 rpm for 10 min at 4°C. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the upper aqueous phase. The volume of the aqueous phase is approximately 70% of the added RLS volume. Transfer the aqueous phase to a new tube and proceed to the next step.

[0135] 4) Add 1.5 times the volume of anhydrous ethanol, vortex mix for 15 seconds, and purify the RNA through a column (the following centrifugation is performed at room temperature).

[0136] 5) Place the HiPure Viral Mini Column in a 2 mL collection tube. Transfer half of the mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds, discard the waste liquid, and put the adsorption column back into the collection tube. Transfer the remaining mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0137] 6) Add 350 μL Buffer RWC to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0138] 7) Add 500 μL Buffer RW2 to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0139] 8) Repeat step 7), discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 13000 rpm for 3 minutes to dry the matrix of the column.

[0140] 9) Transfer the column to a 1.5 mL centrifuge tube, add 30-50 μL RNase free water to the middle of the adsorption membrane according to the expected RNA yield, place at room temperature for 2 minutes, and centrifuge at 13,000 rpm for 1 minute.

[0141] 10) Discard the RNA column and store the RNA sample at -80°C.

[0142] 3. Reverse transcription to synthesize mRNA cDNA

[0143] The FastQuant cDNA First-Strand Synthesis Kit (Cat. No. KR106) was used for mRNA reverse transcription. First, the genomic DNA reaction was removed, and 2.0 μL of 5×gDNA Buffer and 1 μg of TotalRNA were added to the test tube. RNase Free ddH2O was added to make the total volume 10 μL, and the mixture was heated at 42°C for 3 min in a water bath. Then, 2.0 μL of 10×Fast RT Buffer, 1.0 μL of RTEnzyme Mix, 2.0 μL of FQ-RT Primer Mix, and 5.0 μL of RNase Free ddH2O were mixed and added to the above test tube to mix together for a total of 20 μL. The mixture was heated at 42°C for 15 min and at 95°C for 3 min in a water bath. If the synthesized cDNA needs to be stored for a long time, it should be stored at -20°C or lower.

[0144] 4. Real Time PCR

[0145] Gene-9660 fluorescence quantitative PCR instrument was used. -△△CT Relative quantitative analysis of the data was performed.

[0146] 1) Reaction system: Use SuperReal PreMix Plus (SYBR Green) (Cat. No.: FP205) for amplification, and perform the experimental operation according to the product manual. The Real Time PCR reaction system is shown in Table 1.

[0147] Table 1 Real Time PCR reaction system

[0148]

[0149]

[0150] 2) The amplification program was: 95°C for 15 min, (95°C for 10 sec, 55°C for 30 sec, 72°C for 32 sec) × 40 cycles, 95°C for 15 sec, 60°C for 60 sec, 95°C for 15 sec.

[0151] 3) Primer screening

[0152] After mixing the cDNA of each sample, use it as a template for 3-10 times gradient dilution. Take 2 μL of each diluted sample as a template and amplify with target gene primers and internal reference gene primers respectively. At the same time, perform melting curve analysis at 60-95°C, and screen primers based on high amplification efficiency and single peak of melting curve.

[0153] 4) Real Time PCR detection of samples

[0154] After diluting the cDNA of each sample 3-10 times, 2 μL was taken as a template and amplified using target gene primers and internal reference gene primers (see Table 2). At the same time, melting curve analysis was performed at 60-95°C.

[0155] Table 2 Sample RealTime PCR detection design

[0156] template Sample cDNA Sample cDNA Repeated detection channel number 3 3 Primers Target gene primers Internal reference gene primers

[0157] 5. Experimental results

[0158] In the validation set, AC009268.2 was significantly downregulated in CTEPH ( Fig.11 ), LINC02736 was significantly upregulated in CTEPH ( Fig.12 ), the AUCs of AC009268.2 and LINC02736 were 0.715 and 0.625, respectively ( Fig.13 and Fig.14 ), the AUC value of AC009268.2 and LINC02736 combined diagnosis was 0.813 ( Fig.15 ).

[0159] 103: Perform classification prediction based on the expression data of the predicted gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension

[0160] In one embodiment, if the expression level of AC009268.2 in the test sample is lower than that in the healthy control, a classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of AC009268.2 in the test sample is higher than that in the healthy control, a classification result is obtained that the test sample does not suffer from pulmonary hypertension.

[0161] In one embodiment, if the expression level of LINC02736 in the test sample is higher than that in the healthy control, a classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of LINC02736 in the test sample is lower than that in the healthy control, a classification result is obtained that the test sample does not suffer from pulmonary hypertension.

[0162] Figure 2 A pulmonary hypertension prediction system provided by an embodiment of the present invention comprises:

[0163] The acquisition unit 201 is used to acquire the expression data of the predicted gene of the sample to be tested.

[0164] Extraction unit 202: used to extract the expression data of the predicted gene, wherein the predicted gene includes AC009268.2.

[0165] Prediction unit 203: used to perform classification prediction based on the expression data of the prediction gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension.

[0166] Figure 3 A computer device is provided in an embodiment of the present invention, and the device comprises: a memory and a processor; the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, it is used to execute the steps of the above method.

[0167] Those skilled in the art can clearly understand that, for the convenience and brevity of description, the specific working processes of the systems, devices and units described above can refer to the corresponding processes in the aforementioned method embodiments and will not be repeated here.

[0168] The present invention provides use of a reagent for detecting the expression level of AC009268.2 and / or LINC02736 in preparing a product for diagnosing pulmonary hypertension.

[0169] The reagents include primers for specifically amplifying AC009268.2 and / or LINC02736, and probes for specifically recognizing AC009268.2 and / or LINC02736.

[0170] In one embodiment, primer and amplification primer are interchangeable, and primer refers to the oligonucleotide that hybridizes with target nucleic acid or its complement and participates in nucleic acid amplification reaction. Amplification primer hybridizes with template nucleic acid and has 3'-OH (3'-hydroxyl) group that can be extended by polymerization reaction. In some embodiments, amplification primer is 15-60, 15-55, 15-50, 15-45, 15-40, 15-35, 15-30 bases in length. In some embodiments, the length of amplification primer is 18-30 bases. In some embodiments, the length of amplification primer is 18-60 bases, and comprises 18-30 continuous bases (target hybridization region) that hybridize with the corresponding 18-30 nucleotide oligonucleotide hybridization sequences present in the target nucleic acid sequence. In some embodiments, 18-30 continuous bases are at the 3' end of amplification primer.

[0171] In one embodiment, a probe refers to an oligonucleotide capable of hybridizing to a target nucleic acid of interest. One skilled in the art will appreciate that, depending on the stringency of the hybridization conditions, a probe will typically substantially allow a target sequence lacking complete complementarity to form a chemical bond with the probe sequence. The probe may be associated with an appropriate tag or reporter moiety so that the probe (and therefore its target) can be detected, visualized, measured and / or determined.

[0172] The product includes a test kit, a chip or a nucleic acid membrane strip.

[0173] In one embodiment, a test kit refers to any delivery system for delivering materials. In the context of nucleic acid purification systems and reaction assays, such delivery systems include systems that allow storage of reagents and devices (e.g., chaotropic salts, particles, buffers, denaturants, oligonucleotides, filters, etc. in appropriate containers) and / or support materials (e.g., sample processing or sample storage containers, written instructions for executing procedures, etc.), transportation from one location to another, or delivery. For example, a test kit includes one or more housings (e.g., boxes) containing relevant reaction reagents and / or support materials.

[0174] In one embodiment, the kit includes a fragmentation kit and a combination kit. A fragmentation kit refers to a delivery system comprising two or more separate containers, each container comprising a sub-portion of the entire kit components. The containers can be delivered to the intended recipient together or individually. For example, a first container may contain materials and buffer for sample collection, while a second container contains capture oligonucleotides and denaturants. A combination kit refers to a delivery system comprising all components of a reaction assay in a single container (e.g., in a single box containing each required component).

[0175] The kit also includes a detectable label.

[0176] In one embodiment, suitable detectable labels include, but are not limited to, magnetic beads (e.g., Dynabeads™), fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, green fluorescent protein, red fluorescent protein, yellow fluorescent protein, etc.), radioactive labels (e.g., 3 H, 125 I, 35 S, 14 C, or 32 P), enzymes (e.g., horseradish peroxidase, alkaline phosphatase, luciferase, and others commonly used in enzyme-linked immunosorbent assays (ELISA)), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.

[0177] In the several embodiments provided in the present application, it should be understood that the disclosed systems, devices and methods can be implemented in other ways. For example, the device embodiments described above are only schematic. For example, the division of the units is only a logical function division. There may be other division methods in actual implementation, such as multiple units or components can be combined or integrated into another system, or some features can be ignored or not executed. Another point is that the mutual coupling or direct coupling or communication connection shown or discussed can be an indirect coupling or communication connection through some interfaces, devices or units, which can be electrical, mechanical or other forms.

[0178] The units described as separate components may or may not be physically separated, and the components shown as units may or may not be physical units, that is, they may be located in one place or distributed on multiple network units. Some or all of the units may be selected according to actual needs to achieve the purpose of the solution of this embodiment.

[0179] In addition, each functional unit in each embodiment of the present invention may be integrated into one processing unit, or each unit may exist physically separately, or two or more units may be integrated into one unit. The above-mentioned integrated unit may be implemented in the form of hardware or in the form of software functional units.

[0180] A person of ordinary skill in the art can understand that all or part of the steps in the various methods of the above embodiments can be completed by instructing related hardware through a program, and the program can be stored in a computer-readable storage medium, and the storage medium may include: a read-only memory (ROM), a random access memory (RAM), a disk or an optical disk, etc.

[0181] A person skilled in the art can understand that all or part of the steps in the above-mentioned embodiment method can be completed by instructing related hardware through a program, and the program can be stored in a computer-readable storage medium. The above-mentioned storage medium can be a read-only memory, a disk or an optical disk, etc.

[0182] The above is a detailed introduction to a computer device provided by the present invention. For a person skilled in the art, according to the concept of the embodiments of the present invention, there may be changes in the specific implementation method and application scope. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A pulmonary hypertension prediction system, characterized in that: The system comprises: Acquisition unit: used to obtain the expression data of the predicted gene in the sample to be tested; An extraction unit: used to extract the expression data of the predicted gene, wherein the predicted gene includes AC009268.2; Prediction unit: used for performing classification prediction based on the expression data of the prediction gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension; If the expression level of AC009268.2 in the test sample is lower than that in the healthy control, the classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of AC009268.2 in the test sample is higher than that in the healthy control, the classification result is obtained that the test sample does not suffer from pulmonary hypertension.

2. The pulmonary hypertension prediction system according to claim 1, characterized in that: The predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain significantly expressed predicted genes.

3. The pulmonary hypertension prediction system according to claim 1, characterized in that: The predicted genes also include LINC02736.

4. The pulmonary hypertension prediction system according to claim 3, characterized in that: The pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

5. The pulmonary hypertension prediction system according to claim 4, characterized in that: The pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

6. A computer device, characterized in that: The device comprises: a memory and a processor; the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, it is used to execute the steps of the method described below; The method comprises: Obtaining expression data of predicted genes in the sample to be tested; Extracting expression data of the predicted genes, wherein the predicted genes include AC009268.2; Performing classification prediction based on the expression data of the predicted gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension; If the expression level of AC009268.2 in the test sample is lower than that in the healthy control, the classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of AC009268.2 in the test sample is higher than that in the healthy control, the classification result is obtained that the test sample does not suffer from pulmonary hypertension.

7. The computer device according to claim 6, characterized in that The predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain significantly expressed predicted genes.

8. The computer device according to claim 7, characterized in that The predicted genes also include LINC02736.

9. The computer device according to claim 6, characterized in that The pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

10. The computer device according to claim 9, characterized in that The pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

11. A computer-readable storage medium, characterized in that: A computer program is stored thereon, and when the computer program is executed by a processor, the steps of the method described below are implemented; The method comprises: Obtaining expression data of predicted genes in the sample to be tested; Extracting expression data of the predicted genes, wherein the predicted genes include AC009268.2; Performing classification prediction based on the expression data of the predicted gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension; If the expression level of AC009268.2 in the test sample is lower than that in the healthy control, the classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of AC009268.2 in the test sample is higher than that in the healthy control, the classification result is obtained that the test sample does not suffer from pulmonary hypertension.

12. The computer-readable storage medium according to claim 11, wherein: The predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain significantly expressed predicted genes.

13. The computer-readable storage medium according to claim 12, wherein: The predicted genes also include LINC02736.

14. The computer-readable storage medium according to claim 11, wherein: The pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

15. The computer-readable storage medium according to claim 14, wherein: The pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

16. A computer program product comprising a computer program, characterized in that When the computer program is executed by a processor, the steps of the method described below are implemented; The method comprises: Obtaining expression data of predicted genes in the sample to be tested; Extracting expression data of the predicted genes, wherein the predicted genes include AC009268.2; Performing classification prediction based on the expression data of the predicted gene to obtain a classification result of whether the sample to be tested suffers from pulmonary hypertension; If the expression level of AC009268.2 in the test sample is lower than that in the healthy control, the classification result is obtained that the test sample suffers from pulmonary hypertension; if the expression level of AC009268.2 in the test sample is higher than that in the healthy control, the classification result is obtained that the test sample does not suffer from pulmonary hypertension.

17. The computer program product according to claim 16, characterized in that The predicted genes are obtained through genome sequencing data, and the original sequencing is used for data quality control, and differential genes are screened after comparison with the reference genome to obtain significantly expressed predicted genes.

18. The computer program product according to claim 17, characterized in that The predicted genes also include LINC02736.

19. The computer program product according to claim 16, characterized in that The pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

20. The computer program product according to claim 19, characterized in that The pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

21. Use of a reagent for detecting the expression level of AC009268.2 and / or LINC02736 in the preparation of a product for diagnosing pulmonary hypertension, wherein the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction, and the pulmonary artery hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

22. The use according to claim 21, characterized in that The reagents include primers for specifically amplifying AC009268.2 and / or LINC02736, and probes for specifically recognizing AC009268.2 and / or LINC02736.

23. The use according to claim 22, characterized in that The sequences of primers for specific amplification of AC009268.2 are shown in SEQ ID NO: 1-2.

24. The use according to claim 22, characterized in that The sequences of primers for specific amplification of LINC02736 are shown in SEQ ID NOs: 3-4.

25. A product for diagnosing pulmonary hypertension, characterized in that: The product includes a reagent for detecting the expression level of AC009268.2 and / or LINC02736, and the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction, and the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

26. The product according to claim 25, characterized in that The product includes a test kit, a chip or a nucleic acid membrane strip.

27. The product according to claim 26, characterized in that The kit also includes a detectable reagent.

28. The product according to claim 27, characterized in that The detectable reagents include magnetic beads, fluorescent dyes, radioactive markers, and enzymes.

29. The product according to claim 26, characterized in that The kit also includes instructions.

30. The product according to claim 26, characterized in that The kit also includes a buffer.

Images