Method for preventing and controlling bactrocera dorsalis by light intensity

By knocking out the white-eye gene or the Orco gene in fruit flies and using pyrazine substances and light, the problem of attracting and killing male fruit flies in existing technologies has been solved, achieving efficient interference and control of male fruit flies, reducing costs and providing flexible control methods.

CN118947639BActive Publication Date: 2026-03-27AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411062892.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-26
Publication Date
2026-03-27
Estimated Expiration
2042-12-26

AI Technical Summary

Technical Problem

Existing technologies are not effective at simultaneously attracting and killing male oriental fruit flies, and methyl eugenol needs to be combined with other insecticides to be effective. Furthermore, existing visual interference methods are ineffective against fruit fly courtship and mating.

Method used

By knocking out the white-eye gene or the Orco gene in fruit flies, combined with medium-intensity or strong light exposure, and using pyrazine-based substances as attractants or insecticides, along with methyl eugenol, the wing flapping and mating behavior of male fruit flies can be interfered with.

Benefits of technology

Pyrazines can attract and kill male fruit flies on their own. Knocking out genes or interfering with light can effectively inhibit or delay their wing flapping and mating behaviors, reduce reproduction, save costs, and provide flexible control measures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118947639B_ABST
    Figure CN118947639B_ABST
Patent Text Reader

Abstract

The application relates to a method for preventing and controlling Bactrocera minax by light intensity. The application proves the influence of white eye gene, Orco gene and light on the wing vibration, mating and chemotaxis of Bactrocera minax, and provides support and reference for controlling the population breeding of fruit fly.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to a method for preventing and controlling Bactrocera dorsalis by light intensity, and belongs to the technical field of biotechnology. The application is a re-divisional application of the original patent CN202211680423.3 (the first divisional application is CN202410278116.5). BACKGROUND

[0002] Bactrocera dorsalis, also known as oriental fruit fly, yellow fly or fruit maggot, belongs to the order Diptera, the family Tephritidae and the genus Bactrocera Macquar, and is a dangerous quarantine pest with wide food habits, serious overlapping generations, strong reproductive capacity, fast transmission, serious damage and difficulty in prevention and control. The hosts include banana, citrus, tomato, eggplant, pepper and other fruit and vegetable crops. The larvae of the fly cause harm, the adults lay eggs under the fruit skin, the larvae hatch and develop by feeding on fruit pulp, causing fruit rot and falling, and seriously affecting the quality and yield of fruits. The larvae and eggs of the fly can hide in the host fruits, and the adults have strong migratory and spreading capacity. In recent years, B. dorsalis has broken out and spread in the south and southwest of China, and has a tendency to spread northward and more widely. It has been widely distributed in Guangdong, Guangxi, Hunan, Guizhou, Fujian, Hainan, Yunnan, Sichuan, Taiwan and other places, causing serious economic losses to the local fruit industry.

[0003] Among fruit flies, female and male flies have different chemotactic responses to attractants. Some attractants can only attract females, some attractants can only attract males, and some attractants can attract both females and males. Methyl eugenol is a natural plant source attractant for the family Tephritidae, and has a trapping effect on female and male B. dorsalis. However, methyl eugenol itself does not have insecticidal capacity, and even has a certain promoting effect on the mating of B. dorsalis. Therefore, when using methyl eugenol, it needs to be compounded with other insecticides to achieve the effect of trapping and killing at the same time. At present, there is an urgent need for a substance that can attract and kill male flies of the family Tephritidae at the same time, so as to replace methyl eugenol and achieve the effect of trapping and killing male flies of the family Tephritidae by using one attractant alone.

[0004] Bactrocera and Drosophila are completely different genera, but often confused due to the similar Chinese names. The mating methods of the two genera are quite different: Drosophila males chase females by vision, and females are the main attractant in mating; while Bactrocera males gather together to emit pheromones to attract females. Therefore, the method of inhibiting Drosophila mating by visual interference (such as white eye gene mutation) may not affect the mating of Bactrocera. It is worth noting that "inhibition" and "delay" are different concepts, the former means weakening or eliminating, while the latter means only time delay or postponement, and may not be weakened or eliminated.

[0005] The white gene belongs to the ATP-binding cassette (ABC) transporter gene family, and the encoded transporter protein is located on the pigment granule membrane and can transport pigment precursors in the cytoplasm into the pigment granule. The white eye mutation of Drosophila is easily recognized, and is often used as a marker for molecular manipulation. At the same time, the Orco gene plays a key role in the process of insect olfactory recognition. Therefore, researchers hope to explore the effect of the white gene or the Orco gene on Bactrocera, especially on its wing-flapping courtship or mating behavior, so as to provide support and reference for controlling the population reproduction of Bactrocera. SUMMARY

[0006] To solve the above technical problems, the first object of the present application is to provide a method for simultaneously attracting and killing Bactrocera males, the second object is to provide a method for regulating the reproduction of Bactrocera by using the eye color gene, and the third object is to provide a method for assisting in interfering with the wing-flapping and mating of Bactrocera males by using light intensity. Specifically:

[0007] The present application provides a method for inhibiting or delaying the wing-flapping of Bactrocera, comprising the following steps:

[0008] ① knocking out the white eye gene of Bactrocera; and / or

[0009] ② knocking out the Orco gene of Bactrocera; and / or

[0010] ③ using medium or strong light irradiation.

[0011] The present application also provides a method for inhibiting or delaying the mating of Bactrocera, comprising the following steps:

[0012] ① knocking out the white eye gene of Bactrocera; and / or

[0013] ② knocking out the Orco gene of Bactrocera; and / or

[0014] ③ using medium or strong light irradiation.

[0015] The application also provides a method for inhibiting the chemotaxis of real flies, comprising the following steps:

[0016] ① knocking out the white gene of real flies; and / or

[0017] ② knocking out the Orco gene of real flies; and / or

[0018] ③ using medium or strong light irradiation.

[0019] In some embodiments, the medium or strong light is light with an intensity greater than 2000 lux.

[0020] The application also provides a method for attracting and / or killing real flies, using an effective amount of a pyrazine substance as an attractant or insecticide.

[0021] The application provides the use of a pyrazine substance as a pesticide or insecticide for preventing and controlling real flies.

[0022] In some embodiments, the pyrazine substance is a substance comprising trimethylpyrazine and / or tetramethylpyrazine and / or a mixture thereof.

[0023] In some embodiments, further comprising the joint use of other attractants or insecticides, such as methyl eugenol.

[0024] In some embodiments, the real fly is a Drosophila fruit fly; preferably, the real fly is a Bactrocera dorsalis.

[0025] In some embodiments, the real fly is a female or a male.

[0026] Positive effects of the application:

[0027] (1) It is verified that the pyrazine substance not only has an attracting effect on male real flies, but also can kill male real flies, i.e. the pyrazine substance itself can be used as a pesticide or insecticide. Therefore, using the pyrazine substance to replace methyl eugenol can overcome the defect that methyl eugenol needs to be compounded with other insecticides to function.

[0028] (2) Knocking out the Orco gene or the white gene can hinder the attraction of pyrazine to male flies and delay the wing vibration of male flies. Male real flies attract female flies by high-frequency wing vibration, and wing vibration is a necessary condition for the mating behavior of real flies. Interfering with it can effectively inhibit the reproduction of pest populations, and this interference is only directed at male flies, which can greatly save costs.

[0029] (3) The mating of white-eyed Drosophila males is reduced and delayed. The mating of Drosophila mostly occurs in the dusk period, and the time window is relatively short. Delayed mating will make the means of controlling population reproduction not dependent on the time window of the short dusk period, and can work for a long time, increasing the opportunity for human behavior regulation, which has important theoretical and application values.

[0030] (4) Strong light can inhibit or delay the wing vibration and mating of Drosophila males. People can flexibly apply various prevention and control needs by assisting different light conditions in the process of regulating the reproduction of Drosophila. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 The figure shows the attraction of pyrazine to Drosophila Suzukii males.

[0032] Figure 2 The figure shows the killing effect of pyrazine on Drosophila Suzukii males.

[0033] Figure 3 The figure shows that pyrazine has an attractive effect on both female and male Drosophila Suzukii.

[0034] Figure 4 The figure shows the attractive effect of pyrazine mixed with methyl eugenol.

[0035] Figure 5 The figure shows that knocking out Orco gene hinders the attraction of pyrazine to males and delays wing vibration.

[0036] Figure 6 The figure shows the effect of different light intensities on the mating of Drosophila Suzukii.

[0037] Figure 7 The figure shows the effect of different light intensities on the wing vibration of Drosophila Suzukii males.

[0038] Figure 8 The figure shows the result of gel electrophoresis for detecting amplified target genes.

[0039] Figure 9 The figure shows the result of synthesizing four gRNAs.

[0040] Figure 10 The figure shows part of the nucleic acid fragments of the mutant strain.

[0041] Figure 11 The figure shows the design of the mating behavior experiment of the white-eyed mutant population.

[0042] Figure 12 The figure shows the result of the mating behavior experiment of the white-eyed mutant population.

[0043] Figure 13 The figure shows the effect of light intensity on the mating of Drosophila Suzukii white-eyed mutants.

[0044] Figure 14 A behavior chart showing the wing-flapping of the white-eye mutant of B. dorsalis.

[0045] Figure 15 A chart showing the results of the effect of pyrazine on the wing-flapping behavior of the white-eye mutant.

[0046] Figure 16 A chart showing the effect of light on the tendency of female B. dorsalis to pyrazine. DETAILED DESCRIPTION

[0047] To specifically illustrate the design idea of the present application, the following specific experimental parameters are taken as examples for demonstration, but this should not be taken as a limitation of the scope of protection of the present application.

[0048] In some embodiments, the pyrazine substance is used in combination with methyl eugenol, preferably, the ratio of the pyrazine substance and methyl eugenol is 10:1.

[0049] In some embodiments, the pyrazine substance is administered at 17:30-21:30.

[0050] In some embodiments, the pyrazine substance is administered at the same time as the 50 lux intensity of light.

[0051] In some embodiments, the pyrazine substance is trimethylpyrazine; preferably, the dosage is 10 mg.

[0052] In some embodiments, the B. dorsalis is given 2,000-10,000 lux intensity of light.

[0053] In some embodiments, the white-eye gene or Orco gene of B. dorsalis is knocked out by CRI SPR / Cas9.

[0054] "Light intensity (light intensity)" includes weak light (50-1,000 lux), moderate light (1,500-5,000 lux), and strong light (10,000-30,000 lux and above 30,000 lux). Generally, above 2,000 lux is medium light, for example, 2,000-5,000 lux, or 5,000-10,000 lux.

[0055] "Effective amount" refers to a dosage that can achieve the desired effect, for example, 10 mg, 1 mg, or 0.1 mg.

[0056] "attractant" refers to an active substance produced by plants or artificially synthesized, which has a behavioral attraction effect on specific insects. The attractant has the effect of attraction and induction, but not necessarily the effect of killing or damaging.

[0057] "Pesticide" refers to an agent or a chemical that can kill pests.

[0058] "Chemotaxis" refers to the taxis of an organism to a chemical stimulus in the external environment, such as taxis to a pyrazine.

[0059] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0060] Before mating behavior occurs, male flies of B. dorsalis gather and emit a typical high-frequency wing vibration sound, and alternately scratch the abdomen with the hind legs, which can emit sound signals and odor signals. These signals enable female flies to locate the position of male flies and come to mate. Therefore, the behavior of gathering wing vibration is a unique male courtship behavior in real flies.

[0061] Example 1 Attracting effect and insecticidal effect of pyrazine on male flies of B. dorsalis

[0062] 1.1 Attracting effect of pyrazine on male flies of B. dorsalis

[0063] The experimental method for determining the taxis behavior of flies to specific chemicals was used to determine the attracting effect of pyrazine on male flies. The experimental method was to use a transparent acrylic cage, place a conical bottle as a trap for attracting insects inside, and use a 1000 μl syringe tip as an adult fly access channel. The tip of the syringe was cut off. One of the two conical bottle traps was placed with the test odor, and the other was placed with the control solvent. The test odor was dissolved in paraffin oil and can be diluted to the desired concentration.

[0064] Results: Pyrazine (such as trimethylpyrazine or tetramethylpyrazine) has an attracting effect on male flies of B. dorsalis, and 10 mg has the best attracting effect. Trimethylpyrazine has the best effect and has a clear dose-dependent performance. Figure 1

[0065] 1.2 Insecticidal effect of pyrazine on male flies of B. dorsalis

[0066] ​Procedure: The effect of high dose 10 mg trimethylpyrazine on the death of male B. dorsalis was determined by measuring the death rate of male B. dorsalis at high dose 10 mg trimethylpyrazine. The experimental method was to use an acrylic transparent insect cage (18 cm x 25 cm x 14 cm), and a conical bottle was placed inside as a trap for trapping insects. The conical bottle plug was made of silica gel, and had a circular through-opening on the top. A 1000 μl pipette tip was used as an adult entry channel, and the tip was truncated at the tip. Four conical bottles were placed in one trap, 10 mg trimethylpyrazine was placed in one trap, 1 mg trimethylpyrazine was placed in one trap, 0.1 mg trimethylpyrazine was placed in one trap, and 0.01 mg trimethylpyrazine was placed in one trap. Ten male B. dorsalis were placed in each trap bottle, and a small amount of cotton was inserted into the opening at the top of each trap bottle to ensure that the trap bottle was ventilated, simulating the experiment of male insects falling into the trap bottle. Experimental time: 17:00-9:00, light condition: 50 lux.

[0067] Results: The death rate of male insects increased with the increase of trimethylpyrazine dose, and the death rate of male insects at 10 mg trimethylpyrazine was close to 100% Figure 2 ). That is, 10 mg trimethylpyrazine can best attract male insects while killing male insects most efficiently.

[0068] Example 2 Pyrazine Attracts Both Female and Male B. dorsalis

[0069] The effect of trimethylpyrazine on the attraction of male and female B. dorsalis in the time period of 8:00-22:00 was determined by measuring the response of B. dorsalis to specific chemicals. The experimental method was to use an acrylic transparent insect cage, and a conical bottle was placed inside as a trap for trapping insects. The conical bottle plug was made of silica gel, and had a circular through-opening on the top. A 1000 μl pipette tip was used as an adult entry channel, and the tip was truncated at the tip. Two conical bottles were placed in one trap, 10 mg paraffin oil was placed in one trap, and 10 mg trimethylpyrazine was placed in one trap.

[0070] Results: Through the trap experiment, the trapping effect of trimethylpyrazine on female and male insects was detected at different time periods. The trapping was divided into 7 time periods from 8:00 to 22:00, and each 2 hours was a separate trapping experiment section, which were 8:00-10:00, 10:00-12:00, 12:00-14:00, 14:00-16:00, 16:00-18:00, 18:00-20:00, and 20:00-22:00. The overall trend of male insect trapping was stronger in the daytime, and decreased with time. The trapping effect reached a peak at 10:00-12:00, and decreased in the time period after 12:00. In the different time periods from 8:00 to 22:00, the trapping effect was the strongest at 10:00-12:00, and the weakest at 20:00-22:00. The overall trend of female insect trapping was stronger in the evening, and the trapping effect became higher and higher with the arrival of dusk. The trapping effect was weak at 8:00-16:00, and increased in the time period after 16:00. Figure 3

[0071] Example 3 Attracting ability of pyrazine mixed with methyl eugenol

[0072] The experiment method for determining the response of real flies to the tendency behavior of specific chemicals was used to judge the attracting effect of pyrazine mixed with methyl eugenol on male real flies. The experiment method was to use a transparent fly cage made of acrylic, and a conical bottle was placed inside as a fly trap. The conical bottle plug was made of silica gel, and had a circular through opening on the top. A 1000 μl pipette gun head was used as the adult insect access pipeline, and the tip of the gun head was truncated. Two conical bottle traps were placed, one with 1 mg of methyl eugenol, and the other with 1 mg of methyl eugenol and 10 mg of trimethylpyrazine.

[0073] Results: Through the trap experiment, the two kinds of odor sources competed in the same space for competitive trapping. When trapping was performed from 9:00 to 10:00 in the morning, the trapping effect of methyl eugenol mixed with trimethylpyrazine on male insects was significantly higher than that of methyl eugenol alone 20 min, 40 min, and 60 min after the odor was set. Figure 4 When trapping was performed from 18:00 to 20:00 in the evening, the trapping effect of methyl eugenol mixed with trimethylpyrazine on male insects was also stronger than that of methyl eugenol alone, and the methyl eugenol competing with it hardly trapped adult insects. Figure 4 It can be seen that trimethylpyrazine is the main attractant for orange real fly male insects, and its ability to trap orange real fly male insects is significantly stronger than that of methyl eugenol.

[0074] Example 4 Knocking out Orco gene can hinder the trapping of pyrazine on male insects and delay wing fluttering

[0075] ​Procedure: The change of male flies' response to trimethylpyrazine after Orco gene knockout was determined by measuring the flies' response to specific chemicals. The experiment method was to use a plastic transparent cage, inside which a conical bottle was placed as a trap for flies. The conical bottle plug was made of silica gel and had a circular through opening on it. A 1000 μl pipette tip was used as the adult entry channel, and the tip was truncated at the end. Two conical bottle traps were placed, one with 10 mg trimethylpyrazine and the other with paraffin oil as a control.

[0076] The changes in the wing-flapping behavior of Orco-knockout flies were observed using a camera device, and the number of male flies that exhibited wing-flapping behavior within 5 minutes was recorded. For example, if 5 male flies were observed to exhibit wing-flapping behavior within 5 minutes, the wing-flapping frequency within that time was recorded as 5. The wing-flapping frequency within 1 hour was the cumulative number of wing-flapping flies in all 5-minute intervals within that time period. For example, from 16:30 to 17:30, there were 12 5-minute intervals, and the number of wing-flapping flies was 9 (16:35), 10 (16:40), 11 (16:45), 10 (16:50), 11 (16:55), 11 (17:00), 11 (17:05), 9 (17:10), 9 (17:15), 9 (17:20), 9 (17:25), and 10 (17:30). The final cumulative wing-flapping frequency was the total number of these 10 intervals, which was 119 (9+10+11+20...). When the wing-flapping frequency was statistically analyzed over time, the frequency of male flies wing-flapping within 5 minutes was directly used.

[0077] Mass mating: 12 healthy male and female Orco mutant and wild-type control Bactrocera dorsalis flies, respectively, at the age of 12 days, were placed in a mating cage with dimensions of 18 cm x 12.5 cm x 14 cm. The mating cage was placed under an adjustable light intensity LED white light observation panel, and the light intensity gradient was set to 50 lux using a Shimadzu (AS813) handheld illuminometer. The observation time was from 16:30 to 22:00, the behavior room temperature was (26 ± 1) °C, and the relative humidity was (60 ± 5)%. The number of mating behaviors at each light intensity was counted every 30 minutes, and a total of 5 replicates were observed.

[0078] Results: After Orco was knocked out, the attraction of trimethylpyrazine to male flies decreased significantly, and almost lost the ability to attract. It was proved that Orco was the main gene responsible for trimethylpyrazine response. The wing-flapping behavior of Orco mutants decreased significantly and was delayed during the natural mating peak of Bactrocera dorsalis (17:00-19:00), indicating that the perception of pyrazine substances was crucial for wing-flapping behavior. Orco-knockout males could not perform wing-flapping courtship normally and timely, and their mating success rate with females decreased significantly. Figure 5

[0079] ​Example 5. Effect of light on mating and wing vibration of B. dorsalis

[0080] 5.1 Effect of light intensity on mating of B. dorsalis

[0081] Procedure: The effect of light on mating behavior of B. dorsalis was determined by using the experimental method of measuring the effect of light on the mating behavior of B. dorsalis. The experimental method was to use an acrylic transparent cage (18 cm x 12.5 cm x 14 cm) as the mating cage for the mating experiment. It was placed on the adjustable white light plate of the behavior detection system, and 10 experimental light intensities of high light (10,000-30,000 lux), medium light intensity (2,000-5,000 lux), and weak light (50-1,000 lux) were set and video recorded, and the video was analyzed the next day.

[0082] Results: The mating behavior of adults under 10 different light intensities was observed by using a video recording system through mating experiments. Generally speaking, when the light intensity exceeds 1,000 lux, the mating of adults will decrease. Under the light conditions in the laboratory ( Figure 6 B) After 1 hour of exposure (16:30-17:30), mating behavior occurred in weak light (50-1,000 lux) conditions, with no significant difference compared to 100-1,000 lux mating events (p=0.9873, p=0.7956, p=0.9999). The number of mating observed under medium light (2,000-5,000 lux) was very low, significantly lower than 50 lux (p=0.0025, p=0.0166, P=0.0011). No mating events were found under strong light (10,000-30,000 lux) conditions. However, when the adults were continuously exposed to the corresponding light intensities, the mating behavior under medium and strong light increased significantly. From 17:30 to 18:30, adults under 2,000 lux and 3,000 lux began to mate, reaching the level of 50 lux below (p=0.9413, p=0.6310) Figure 6 C). From 18:30 to 19:30, the mating behavior of adults under 5,000 lux further increased, reaching the level of 50 lux (P=0.2786) Figure 6 D). The mating behavior of adults under 10,000 lux gradually increased from 17:30 to 21:30, generally reaching the level of 50 lux or the same level (P<0.0001, P=0.0003, P=0.0108, P=0.0509) Figure 6C, D, E, F). In contrast, at higher intensities such as 20,000 and 30,000 lux, mating behavior was sporadic. Trends over time were observed at 50, 2,000, and 10,000 lux. At 50 lux, most mating began within 1 hour. Adults did not mate at 2,000 and 10,000 lux during the early part of the experiment, and subsequent mating was delayed (50 lux R2=0.9731, 2,000 lux R2=0.9856, 10,000 lux R2=0.9841) Figure 6 G). Thus, strong light has an inhibitory effect on mating, delaying mating.

[0083] 5.2 The effect of light on wing vibration of male B. dorsalis

[0084] Procedure: The effect of light on wing vibration behavior of male B. dorsalis was determined using the experimental method of determining the effect of light on the behavior of male B. dorsalis wing vibration. The experimental method was to use an acrylic transparent insect cage (18 cm x 12.5 cm x 14 cm) as the wing vibration cage for male wing vibration experiments. It was placed on the adjustable white light plate of the behavior detection system, and each of the three light intensities was selected in strong light, medium light intensity and weak light. Set three experimental light intensities of strong light (10000 lux), medium light intensity (2000 lux), and weak light (50 lux) and record the video, and analyze the video the next day.

[0085] Results: Based on the results obtained in the above experiments, male wing vibration behavior was observed at three light intensities (50 lux, 2,000 lux, 10,000 lux) that strongly regulated mating behavior through mating experiments. At 2000 lux and 10000 lux, the wing vibration behavior of males was significantly reduced. Most of the male B. dorsalis below 50 lux actively vibrated their wings and slapped their butts from 16:30 to 17:30. Compared with 50 lux, only a few adult males vibrated their wings below 2000 lux, and no wing vibration behavior was observed below 10000 lux (2000 lux p=0.0009, 10000 lux p=0.0034) Figure 7 B) Male wing vibration behavior increased significantly between 17:30 and 19:30 below 2000 lux, only slightly lower or equal to 50 lux (p=0). 0288, p=0.7528). Only a few males vibrated their wings at 10,000 lux, which was significantly lower than 50 lux (P<0.0001, P=0.0023) Figure 7 CD) From 19:30 to 20:30, there was still some wing vibration behavior below 50 lux, but it was significantly lower than 2000 lux and 10000 lux (p=0.0003, p=0.0004) Figure 7E) From 20:30 to 21:30, only weak wing-flapping behavior was observed under the three light intensities. There was no significant difference between 2000 lux and 50 lux (p = 0.1315), and 10000 lux was only slightly higher than 50 lux (P = 0.0072) Figure 7 F) The trend of wing-flapping over time was observed under 50 lux, 2000 lux and 10000 lux. Wing-flapping behavior was also delayed at 2000 lux and 10000 lux Figure 7 G) Therefore, strong light has the effect of inhibiting wing-flapping and delaying wing-flapping.

[0086] Example 6 Obtaining orange Bactrocera white gene mutation homozygous line

[0087] 6.1 According to the analysis of the orange Bactrocera genome, specific primers for the white gene were designed to amplify and sequence the 2, 3 exon regions.

[0088] (1) Specific primers

[0089] BdorWhite F: GCAGTCCTATGAGCAGTCTTC

[0090] BdorWhite R: TGTACCCAGAAAGGCGACT

[0091] (2) Extraction of orange Bactrocera genome DNA

[0092] Ten wild-type orange Bactrocera males and females were taken, and the middle legs were removed separately, one insect per tube, and the DNA was extracted. The extraction reagents and methods are as follows:

[0093] Reagent preparation: Two reagents were prepared using three stock solutions of 2M-NaOH, 0.5M-EDTA, and 1M-Tris-HCL, respectively, and were named solution I and solution II.

[0094] Solution I: 625 μl NaOH, 20 μl EDTA, 49.355 mL sterilized water were prepared to a total volume of 50 mL solution I; solution II: 2 mL Tris-HCl, 48 mL sterilized water were prepared to solution II.

[0095] a. Ten male and ten female orange Bactrocera adults were taken, and the middle legs were removed separately, one insect per tube, and placed in a 1.5 mL centrifuge tube, then a steel ball was added, and then ground after quick freezing in liquid nitrogen;

[0096] b. 50 μL of solution I was added to each tube (the volume added is related to the size of the tissue), and after shaking and mixing, centrifuged at 10000 r / min for 3 min;

[0097] c. After centrifugation, the centrifuge tube was placed in a 95°C dry bath for 20 min, with gentle shaking 2-3 times.

[0098] d. 50 μL of solution II (same volume as I) was added to the tube, shaken to mix, and centrifuged at 10,000 r / min for 3 min.

[0099] e. 50 μL of the supernatant was transferred to a clean centrifuge tube. This solution was the B. dorsalis gDNA, and 1-3 μL could be directly used for PCR.

[0100] (3) PCR amplification

[0101] Reaction system:

[0102]

[0103] Reaction conditions:

[0104]

[0105] The amplified target gene was detected by gel electrophoresis, and the band size was basically consistent with the results of genomic analysis. Figure 8 ).

[0106] 6.2 Design of CRISPR / Cas9 target sites for knockout in the 2 and 3 exon regions according to the sequencing results of each gene above.

[0107] (1) According to the sequencing results above, a total of 4 target sites were selected

[0108] Target sequence (BdorWhite target):

[0109] BdorWhite Target1: CTATCCGGGTGAATTGCTAGCGG

[0110] BdorWhite Target2: CGGTGGCGAACGTAAACGCTTGG

[0111] BdorWhite Target3: ACGTTGTGCTTATGTTCAACAGG

[0112] BdorWhite Target4: CAACTGCTGAATCGTGTAAAAGG

[0113] a. Preparation of sgRNA DNA template

[0114] PCR was performed at room temperature, with a system of 25 μL. Phusion TMHigh-Fidelity PCR Master Mix (2X), 12.5 μΐ; Tracr Fragment + T7 Primer Mix, 1 μΐ; 0.3 μΜ Target F1 / R1 oligonucleotide mix, 1 μΐ; Nuclease-free water, 10.5 μΐ. Reaction conditions are, 98°C 10s; 98°C 5s, 55°C 15s - x32; 72°C 1 min; 4°C hold (as the gRNA DNA template is very short (120bp), a two-step PCR protocol is used. No separate extension step is needed in the 32 polymerase chain reaction cycles). Take 5uL product to run electrophoresis to detect template assembly (120bp), if the target band is correct, then proceed to in vitro transcription to produce gRNA.

[0115] b. gRNA is obtained by in vitro transcription, sequentially add, NTP mix (100 mM each of ATP, GTP, CTP, UTP), 8 μΐ; gRNA DNA template (from PCR assembly), 6 μΐ; 5X TranscriptAid TM Reaction Buffer, 4 μΐ; TranscriptAid TM Enzyme Mix, 2 μΐ.

[0116] Mix the reaction components thoroughly, centrifuge and incubate at 37°C for 2 hours (can also be extended to 4h to improve yield). Immediately after the in vitro transcription reaction is completed, add 1 μΐ of DNase I and incubate at 37°C for 15 minutes to remove the remaining DNA template, stop the transcription reaction, and prevent the template DNA from interfering with the downstream reaction of the RNA transcript. After the reaction is completed, take 0.5 μΐ of IVT product and dilute it in 10 μΐ of DEPC-treated water. 2% agarose gel detection, the expected gRNA size is 100 bases. The discrete band at 100 bases indicates a complete ribonucleic acid.

[0117] c. Purification of in vitro transcribed gRNA

[0118] Purify the in vitro transcribed gRNA with the gRNA purification kit, elute the gRNA with 10 μΐ of RNA-free H2O, determine the gRNA concentration after purification, dilute and aliquot according to the required concentration, and store at -80°C. Figure 9 It is shown that 4 gRNAs are successfully synthesized.

[0119] 6.3 Injection at the embryonic stage of B. dorsalis, screening of mutant types in G0 generation, screening of mutant offspring types with frameshift termination or more than 3 amino acids cut off, hybrid construction of mutants.

[0120]

[0121] (1) Preparation of injection solution

[0122] Each of the target points shown in the above table was mixed with 2.5 μl, 1 μL of phenol red and 0.3 μL of 500 mg / mL Cas9 protein were added. After mixing by flicking, centrifugation was performed at 4°C at 10,000 rpm / min for 10 min.

[0123] (2) Embryo collection

[0124] The B. dorsalis adults were collected in the rearing cage, the population density was controlled at 300 per cage, and the artificial feed (beer yeast: sugar = 1:1) was used for feeding, and the feed and water were replaced every two days. After 6 days of age, the rearing cage was placed in the dark light (50 Lux) for mating every evening, and the mating was continued for 3-5 days, and then the eggs were collected for microinjection. The egg laying box was placed in the rearing cage 30 min before the start of injection, and a new egg laying box was replaced when a large number of female insects began to lay eggs, and fresh eggs were discharged on the self-made egg beating table. Generally, the peak of egg laying of B. dorsalis is at 3 pm, and microinjection is started after 3 pm.

[0125] (3) Microinjection

[0126] 3 μL of the prepared injection solution was taken and added to the pulled microinjection needle, and the air in the needle was excluded. The needle tip was ground to the desired tip on the needle grinder, and then the needle was mounted on the microinjection instrument. The distance between the needle and the egg was adjusted so that it was inserted at an angle of 45° from the tail of the egg, and the injection was completed by stepping on the pedal. All eggs were injected in turn, 200 eggs were injected each time, and continuous injection was performed for 2-3 times.

[0127] (4) Mutant screening

[0128] The injected eggs were immediately picked up to the wet filter paper for moisturizing, and were placed in the artificial incubator (temperature 26.5°C, humidity 55%, L:D = 14:10) for incubation. The next afternoon, the larvae were picked up to the feed for feeding. After the injected insects were molted, the gDNA of the adult insects was extracted, the exon 2 and 3 of the white gene of B. dorsalis was amplified by PCR, and the mutation was detected. The generation was carried out until the homozygous mutant strain was screened.

[0129] (5) The construction of the mutant strain is shown in Figure 10 .

[0130] Example 7 Mating of White population

[0131] (1) Preparation of test insects

[0132] Single oviposition about 200 eggs, larvae feed placed about 1 / 3 of the feeding bowl. When approaching pupation, the larvae along with the feed into the pupa box. About 2 days after the pupa sand, placed 7 days after screening sand pupae, pupae will be in about 2 days after emergence. Emergence of adult insects strictly distinguish between male and female, respectively, in the size of 18 cm x 12.5 cm x 14 cm cage, each cage about 30-50 head, every 2 days to replace the feed, add water.

[0133] (2) White mutant population mating behavior experiments

[0134] Intra-population mating: 12-day-old orange Bactrocera dorsalis adults were paired in mating cages (18 cm x 12.5 cm x 14 cm) with 12 healthy males and 12 healthy females each. Wild-type control B. dorsalis adults were paired in mating cages (18 cm x 12.5 cm x 14 cm) with 12 healthy males and 12 healthy females each. The mating cages were placed under an adjustable light intensity LED white light observation board, and a Shimadzu (AS813) handheld illuminometer was used to set the light intensity gradient to 50 lux with 5 replicates. The observation time was from 16:30 to 22:00, the behavior room temperature was (26 ± 1) °C, and the relative humidity was (60 ± 5) %. The number of mating behaviors at each light intensity was counted every 30 minutes, and a total of 5 replicates were observed. The experimental design is shown in Figure 11 . Related literature shows that the optimal mating light intensity of B. dorsalis is 57.8 lux. To explore whether the White eye mutation affects population mating, WT was used as a control.

[0135] The results show that the white eye mutation of B. dorsalis can delay mating time and reduce the number of mating Figure 12 A, Figure 12 B).

[0136] Inter-population mating: To explore whether the female or male white eye mutation reduces mating, WT females or males were mated with White males or females at 12 days old.

[0137] The results show that the mating number of White ♀ x WT ♂ is consistent with that of the wild-type population mating, and the mating results of White ♂ x WT ♀ are also the same as those of the White population mating experiment Figure 12 C, Figure 12 D). Therefore, the low and delayed population mating of White is mainly affected by the white eye males.

[0138] Example 8: Effect of light intensity on mating of White mutant of B. dorsalis

[0139] Respectively, 12 healthy female and male 12-day-old white eye mutant and wild type (control) B. dorsalis adults were put into a mating cage with a length of 18 cm, a width of 12.5 cm, and a height of 14 cm to mate. The mating cage was placed under the LED white light observation board with adjustable light intensity, and the light intensity gradient was set to 50 lux, 2000 lux, and 10000 lux using a Shimadzu (AS813) handheld illuminometer. Each gradient was repeated 5 times. The shooting time was from 16:30 to 22:00, the behavior room temperature was (26±1)℃, and the relative humidity was (60±5)%. The number of mating behaviors under each light intensity was counted every 30 minutes, and a total of 5 repeats were observed.

[0140] Results: Using the behavior monitoring system, three different light intensities of 50 lux, 2000 lux, and 10000 lux were set to observe the mating of WT and White mutant adults. The results showed that under 50 lux light, within the first hour of the experiment (16:30-17:30), the average number of mating pairs of wild type was 10, the average number of mating pairs of 2000 lux was 4, and there was no mating phenomenon in White; from 17:30 to 18:30, under the conditions of 50 lux, 2000 lux, and 10000 lux, the number of mating pairs of WT increased, and the White mutant had an average of 5 mating pairs under 50 lux, which was significantly different from WT, and there was no mating under 2000 lux and 10000 lux; from 18:30 to 19:30, under the condition of 50 lux, the mating of WT tended to be stable, and under the conditions of 2000 lux and 10000 lux, the number of mating pairs of WT increased, and the White mutant began to mate under the condition of 2000 lux; from 19:30 to 20:30, under the conditions of 2000 lux and 10000 lux, the number of mating pairs of WT increased, and the number of mating pairs of White under 2000 lux also increased, and there was no mating under 10000 lux; from 20:30 to 21:30, under the condition of 10000 lux, a small number of White mated, which was significantly different from WT; from 21:30 to 22:00, under the condition of 2000 lux, individual B. dorsalis ended mating, the number of mating pairs decreased, and White was basically stable. The results showed that the higher the light intensity, the lower the number of mating pairs of White white eye mutant compared to WT, and the mating time was delayed. Figure 13 )。

[0141] Example 9 White eye mutant delays group wing flapping behavior

[0142] The number of males showing wing-flapping behavior in 5 min was recorded while watching the video. For example, if 5 males were observed showing wing-flapping behavior in 5 min, then the wing-flapping frequency in that time was recorded as 5. The wing-flapping frequency in 1 h was the cumulative number of wing-flapping males in all 5-min intervals in that time period. For example, from 16:30 to 17:30, there were 12 intervals of 5 min, and the number of wing-flapping males was 9 (16:35), 10 (16:40), 11 (16:45), 10 (16:50), 11 (16:55), 11 (17:00), 11 (17:05), 9 (17:10), 9 (17:15), 9 (17:20), 9 (17:25), and 10 (17:30). The final cumulative wing-flapping frequency was 119 (9 + 10 + 11 + 20…). When the wing-flapping frequency was analyzed over time, the wing-flapping frequency in 5 min was directly used.

[0143] According to the results of the mating experiment, the wing-flapping phenomenon of 12-day-old WT and White males under 50 lux low light conditions was studied. The results showed that most of the WT had flapped their wings from 16:30 to 17:30, while the number of White wing-flapping was significantly different from that of WT; from 17:30 to 18:30, the number of WT wing-flapping was basically the same as that of the previous hour, and the number of White wing-flapping gradually increased compared to the previous hour, but was significantly different from that of WT; from 18:30 to 19:30, the number of WT wing-flapping gradually decreased, while White was still in the rising stage and was basically the same as WT; from 19:30 to 20:30, the number of WT wing-flapping decreased, while the number of White increased and was higher than that of WT; from 20:30 to 21:30, the number of WT wing-flapping was still in the declining stage, while White decreased, but the number of wing-flapping was higher than that of WT, and the difference was significant; from 21:30 to 22:00, the number of WT and White wing-flapping was basically the same, with no difference. The results showed that the peak period of White mutant wing-flapping was delayed, which corresponded to the results of the group mating experiment. Figure 14

[0144] Example 10 Effect of pyrazine on trapping of white mutant B. dorsalis males and females

[0145] Bdwhite was determined using a dual-choice olfactory trap - / - ​and WT to TMP. The experimental method was to use a plastic transparent insect cage (18 cm x 24 cm x 14 cm), inside which a conical bottle was placed as a trap for insects, the conical bottle plug was made of silica gel with a circular through opening on the top, a 1000 μΐ micropipette tip was used as an adult entry channel, and the tip end was truncated. Paraffin oil was used as a solvent to prepare 100 μg / μL of TMP. A total of 100 μL of TMP solution was dropped on a filter paper strip (1 x 2 cm) and placed in the trap to ensure a dose of 10 mg. The control was a trap bottle filled with paraffin oil. A total of 30 Bdwhite - / - or WT females or males were placed in the cage, and their preference for trimethylpyrazine was observed. Five replicates were performed. The trapping rate was calculated as: Trapping rate = number of insects in the trap / number of insects used in the experiment.

[0146] Results: Comparison of the tendency of Bdwhite - / - and WT to trimethylpyrazine by double-choice trap experiment. When trapping males, the tendency of Bdwhite- / - male adults to trimethylpyrazine was much lower than that of WT, and the number of WT trapped by trimethylpyrazine continued to increase every 20 min, while Bdwhite- / - did not significantly increase Figure 15 A). When trapping females, the chemotaxis of Bdwhite- / - to TMP was not reduced Figure 15 B). Therefore, pyrazine reduced the trapping of male B. dorsalis, but had no effect on female B. dorsalis.

[0147] Example 11 Effect of light on the tendency of B. dorsalis females to pyrazine

[0148] Procedure: The effect of pyrazine on B. dorsalis females was determined by measuring the behavioral response of flies to specific chemicals. The experimental method was to use a plastic transparent insect cage, inside which a conical bottle was placed as a trap for insects, the conical bottle plug was made of silica gel with a circular through opening on the top, a 1000 μΐ micropipette tip was used as an adult entry channel, and the tip end was truncated. One of the two conical bottle traps was placed with 1 mg of trimethylpyrazine, and the other was placed with 10 μΐ of paraffin oil.

[0149] Results: By trap experiment, the tendency of B. dorsalis females to trimethylpyrazine was observed under low, medium and high light intensities, which represent three representative light intensities. The light intensity could reduce the number of B. dorsalis trapped, and within the first hour of placement (16:30-17:30), low light intensity of 50 lux successfully trapped B. dorsalis females, while the control group did not trap any B. dorsalis females (p=0.0002). Medium light intensity of 2000 lux and high light intensity of 10000 lux had no trapping effect, which was significantly lower than 50 lux (p<0.0001, p<0.0001) Figure 16B). With the lapse of time, female B. dorsalis were successively trapped at moderate light intensity, and the number of female B. dorsalis trapped at 2000 lux was successively lower than that at 50 lux from 17:30 to 21:30 (p = 0.0104, p = 0.0149, p = 0.0149, p = 0.0237). The number of female B. dorsalis trapped at 10000 lux was successively lower than that at 50 lux (p = 0.0000, p = 0.0000, p = 0.0000, p = 0.0000). Figure 16 CDEF).

[0150] Obviously, various modifications and changes can be made to the present application by those skilled in the art without departing from the spirit and scope of the application. Accordingly, it is intended that the present application cover all such modifications and changes as fall within the scope of the claims and their equivalents.

Claims

1. A method of inhibiting or delaying mating of Bactrocera dorsalis (Hendel) comprising, Comprising the following steps: ① irradiation with medium or strong light; or ② knocking out the white eye gene and Orco gene of B. dorsalis and irradiation with medium or strong light; The medium or strong light is light with an intensity greater than 2000 lux.

2. A method of inhibiting the chemotaxis of Bactrocera dorsalis, characterized in that, Comprising the following steps: ① irradiation with medium or strong light; or ② knocking out the white eye gene and Orco gene of B. dorsalis and irradiation with medium or strong light; The medium or strong light is light with an intensity greater than 2000 lux.

3. The method according to one of claims 1-2, characterized in that, The B. dorsalis is a female or a male.

Citation Information

Patent Citations

  • Method for preventing and controlling bactrocera dorsalis by adopting gene and illumination means

    CN117965627A

  • Method for constructing white-eye strain of bactrocera dorsalis

    CN108795990A

  • Non-naturally occurring animal that expresses an untranslated non-coding RNA

    US20060212947A1