A method for isolating and purifying mRNA

Abstract

The application discloses an mRNA separation and purification method, and belongs to the technical field of biology. The method mainly comprises the following steps: extracting a nucleic acid sample to be separated and adjusting the concentration to be suitable for purification, selecting a suitable affinity chromatography medium according to the characteristics of target mRNA, preparing a salt-containing buffer, adjusting the pH and the salt concentration according to the type of nucleic acid, loading the affinity chromatography medium into a chromatographic column, and selecting elution conditions; loading the nucleic acid sample into the chromatographic column after dissolving the nucleic acid sample in a sample loading solution, capturing mRNA by using the affinity chromatography medium, pumping an eluent to perform step-by-step gradient elution, and collecting purified mRNA. The mRNA separation and purification method has the advantages of high selectivity, high purity, high yield, easy amplification reaction and good practical application value.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to an mRNA separation and purification method. BACKGROUND

[0002] As an important biomolecule, mRNA (messenger ribonucleic acid) plays a bridging role in cells to transfer genetic information from DNA to proteins. In recent years, mRNA technology has shown great application potential in the fields of vaccine development and gene therapy. With the rapid development of mRNA vaccine technology, higher requirements are put forward for mRNA purification technology. Traditional mRNA purification methods, such as lithium chloride precipitation, size exclusion chromatography, ion exchange high performance liquid chromatography and reverse phase ion pair high performance liquid chromatography, have the problems of low purity and low selectivity. The specific mRNA purification method with high selectivity mainly uses oligo(dT) as a ligand for mRNA affinity chromatography, but the previously reported methods for preparing oligo(dT) affinity chromatography medium have certain shortcomings. For example, when streptavidin is used to connect oligo(dT), the oligo(dT) density of the affinity chromatography medium is low due to steric hindrance factors, so only a small amount of mRNA can be separated and extracted; when CDI is used as a coupling agent, the reaction efficiency of the 5' and 3' end amino groups with CDI is low, and the connected oligo(dT) is only 20% of the original oligo(dT) material, which increases the consumption of raw materials and the production cost of the affinity chromatography medium; when ethylene oxide is used as an active group of the affinity chromatography medium to react with the 5' and 3' end amino groups of oligo(dT), the reaction activity is low, and the reaction can only be carried out at high temperature or under the condition of pH>9. In addition, it is difficult to obtain relatively pure mRNA through one-step purification, and multiple methods need to be combined, and multiple-step chromatography is often used for purification and separation of mRNA, which requires higher technical requirements for the operator. The above shortcomings are not conducive to the production and industrial application of the affinity chromatography medium. Therefore, it is essential to develop an efficient, simple and high-purity mRNA separation and purification method for the application of mRNA. SUMMARY

[0003] In order to solve the problems in the background art, the purpose of the present application is to provide an mRNA separation and purification method, which can solve the problems of low mRNA purification efficiency, high cost and complex operation in the prior art, and the process can realize high-purity and high-yield purification of mRNA.

[0004] In order to achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0005] The present application provides an mRNA separation and purification method, comprising the following steps:

[0006] (1) Sample preparation: extract the nucleic acid sample to be separated and adjust to a suitable concentration for purification;

[0007] (2) Affinity chromatography medium selection: select a suitable affinity chromatography medium according to the characteristics of the target mRNA;

[0008] (3) Buffer preparation: prepare a salt-containing buffer, adjust the pH and salt concentration according to the type of nucleic acid;

[0009] (4) Chromatography system setup: load the affinity chromatography medium obtained in step (2) into a chromatography column, and select the elution conditions;

[0010] (5) Sample loading: dissolve the nucleic acid sample obtained in step (1) in the sample loading solution and load it into the chromatography column, and use the affinity chromatography medium to capture the mRNA;

[0011] (6) Elution and collection: pump in the elution solution for stepwise gradient elution, and collect the purified mRNA.

[0012] For the technical solutions described above, preferably, the nucleic acid sample to be separated in step (1) includes but is not limited to using RNA extraction reagent, and obtaining total RNA sample by centrifugation, precipitation separation; or using in vitro transcription (IVT) technology, using specific DNA template and RNA polymerase, adding 1-80 nt poly(A) tail to synthesize target RNA sample.

[0013] For the technical solutions described above, preferably, the RNA extraction reagent includes Trizol reagent.

[0014] For the technical solutions described above, preferably, the method of using Trizol reagent to lyse cells and extract RNA includes the following steps: 1) first wash and centrifuge the cells, add Trizol reagent, and repeatedly blow or vigorously shake to lyse the cells; 2) sequentially extract with chloroform, isopropanol, and ethanol to obtain the RNA sample to be separated.

[0015] For the technical solutions described above, preferably, the method of synthesizing mRNA by in vitro transcription (IVT) technology includes the following steps: 1) providing a DNA template containing a specific gene sequence; 2) adding RNA polymerase (such as T7, SP6 or T3 RNA polymerase) and other necessary transcription factors; 3) under suitable buffer system and conditions, RNA polymerase catalyzing DNA template to transcribe into RNA molecule; 4) purifying the obtained RNA product, adding 0-80 nt length poly(A) tail for subsequent separation and purification experiment.

[0016] For the technical solutions described above, preferably, the concentration of the nucleic acid sample to be separated in step (1) is adjusted to 10-900 ng / μL.

[0017] For the technical solutions described above, preferably, the affinity chromatography medium in step (2) includes but is not limited to 6FF-BVS-Odt-Cys, which is an mRNA affinity chromatography medium obtained by connecting an oligonucleotide probe oligo(dT) to a matrix of Sepharose (6FF) with a connecting arm of bis(vinylsulfonyl)methane (BVS) and then blocking with cysteine, for specifically capturing mRNA with a poly(A) tail.

[0018] For the technical solutions described above, preferably, the density of oligo(dT) is 0.05-0.25 μmol / mL.

[0019] For the technical solutions described above, preferably, the length of oligo(dT) is 1-80 nt.

[0020] For the technical solutions described above, preferably, the salt-containing buffer in step (3) is a phosphate buffer, a Tris buffer or a buffer system suitable for nucleic acid stabilization.

[0021] For the technical solutions described above, preferably, the type of salt in the buffer is one or a combination of two or more of sodium chloride, sodium sulfate, sodium oxalate, sodium acetate, sodium citrate and ammonium sulfate.

[0022] For the technical solutions described above, preferably, the concentration of salt in the salt-containing buffer is 0.01 M-1.0 M.

[0023] For the technical solutions described above, preferably, the pH value of the buffer is in the range of 6.8-7.4.

[0024] For the technical solutions described above, preferably, the chromatography system in step (4) is selected from purifier 10 system, and the automatic control software is UNICORN software to set the parameters of the chromatography system.

[0025] For the technical solutions described above, preferably, before loading the nucleic acid sample in step (5), the chromatography system is washed and equilibrated with a washing solution and an equilibration solution in sequence, the washing solution is ultrapure water, the volume of washing is 5-25 column volumes, and the equilibration solution is the salt-containing buffer, the volume of equilibration is 25-50 column volumes.

[0026] For the technical solutions described above, preferably, the loading of the nucleic acid sample to be separated is completed by an automatic sampler or a manual injector.

[0027] For the technical solutions described above, preferably, the concentration of the nucleic acid sample in the sample solution is 1-50 μg / mL or 5-10 nmol / mL.

[0028] For the technical solutions described above, preferably, the sample solution is a lithium chloride solution and a salt-containing buffer prepared in step 3) compounded in a volume ratio of 1:1-1:20, which synergistically promotes the binding of mRNA to the affinity chromatography medium, and preferably, the concentration of the lithium chloride solution is 0.5-5 M.

[0029] For the technical solutions described above, preferably, the flow rate of the sampling process is controlled within the range suitable for chromatography, i.e., 0.2-1.0 mL / min; preferably, the flow rate is first controlled at 0.8-1.0 mL / min, so that the mRNA in the sample rapidly binds to the oligo(dT) probe in the affinity chromatography medium, and then the flow rate is adjusted to 0.2-0.5 mL / min to allow all unbound oligo(dT) probes to bind.

[0030] For the technical solutions described above, preferably, the gradient elution in step (6) is a stepwise concentration gradient elution, specifically, using 0.5 M NaCl aqueous solution for elution for 5 min, 0.1 M NaCl aqueous solution for elution for 5 min, and ultrapure water for elution for 5 min, with a flow rate of 0.2-0.5 mL / min, a pressure of 0.01-0.3 MPa, and a temperature of room temperature. When an absorption peak is detected at an ultraviolet absorption wavelength of 260 nm, the mRNA is collected, and the collection is stopped until the absorption peak returns to the baseline.

[0031] Compared with the prior art, the mRNA separation and purification method of the present application has the following beneficial effects:

[0032] (1) High purity: through affinity chromatography technology, impurities in the sample are effectively removed, and the purity of mRNA is improved.

[0033] (2) High efficiency: using an automatic purifier 10 system, manual operation is reduced, and separation efficiency is improved.

[0034] (3) Repeatability: through standardized operation procedures and parameter settings, the repeatability of experimental results is ensured.

[0035] (4) Wide application: suitable for RNA samples of various sources, including total RNA in cell lysates and IVT crude products. BRIEF DESCRIPTION OF DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present application, the drawings involved in the embodiments will be briefly introduced as follows.

[0037] Figure 1 Schematic diagram for extracting mRNA from total RNA;

[0038] Figure 2 Capillary electrophoresis chart of IVT product before (A) and after (B) purification by oligo (dT) affinity chromatography medium. DETAILED DESCRIPTION

[0039] The present application will be described in detail below with reference to the embodiments, but the embodiments of the present application are not limited thereto. Obviously, the embodiments described below are only some of the embodiments of the present application, and other similar embodiments obtained by those skilled in the art without creative labor are also within the protection scope of the present application.

[0040] Example 1

[0041] The present embodiment provides a method for extracting a total RNA sample from a cell lysate, and the preparation method is as follows:

[0042] 1. Prepare 0.01M PBS (pH = 7.4) buffer solution.

[0043] 2. Transfer human pancreatic cancer cells SW1990 cultured with a T75 culture bottle into a centrifuge tube, wash twice with 0.01M PBS (pH = 7.4) and then absorb the liquid. Mix 1ml Trizol reagent with 1ml 0.01M PBS buffer solution, add to the cells and mix well, and then stand on ice for 5min. Centrifuge the cells at 4℃, 12000rpm for 15min, and then use a pipette to absorb the upper water layer to obtain a cell lysate.

[0044] 3. Add 200μl chloroform again, stand on ice for 5min, and then centrifuge at 4℃, 12000rpm for 10min. Absorb the upper water phase into another centrifuge tube, add 200μL isopropanol and mix well, stand on ice for 10min, and then centrifuge at 4℃, 12000rpm for 10min. Remove the supernatant, add 1ml 75% ethanol, centrifuge at 4℃, 12000rpm for 5min. Remove the supernatant, dry, add 20μl sterile enzyme-free water to dissolve the precipitate, and then obtain total RNA.

[0045] Measure the total RNA sample using Nano Drop 2000, A 260 / A 280= 1.88, i.e. the total RNA concentration was 3426.6 ng / μL, proving that a total RNA sample can be extracted from the cell lysate for further isolation and purification of mRNA.

[0046] Example 2

[0047] This example provides a preparation of an mRNA in vitro transcription system, and the preparation method is as follows:

[0048] The firefly luciferase mRNA was selected as a template, and the linearized firefly luciferase DNA obtained by enzyme digestion was subjected to in vitro transcription by a High Yield T7 RNA Synthesis Kit to obtain an in vitro transcription (IVT) crude product.

[0049] The nucleotide sequence of the firefly luciferase mRNA is as follows:

[0050] > T7 promoter

[0051] TAATACGACTCACTATA + AGG

[0052] > 5'UTR-Pfizer-V1 truncated

[0053] TAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0054] > Luciferase (ORF optimized)

[0055]

[0056] >3'UTR-Pfizer

[0057] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0058] >polyA tail (80)

[0059] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0060] >enzyme site

[0061] AGAAGAGC.

[0062] Example 3

[0063] The present embodiment provides an mRNA isolation and purification method, which comprises the following steps:

[0064] 1. Prepare affinity chromatography medium 6FF-BVS-Odt-Cys (refer to CN117123201A), the preparation method is: take agarose gel (6FF) as the matrix, bis (vinyl sulfone) methane (BVS) as the connecting arm, in the salt-containing coupling buffer with pH 7, react the 5' end and 3' end un-pre-modified oligonucleotide probe Oligo(dT) (length 50nt) with the vinyl sulfone functionalized agarose gel matrix for 24h, and finally block the excess BVS with blocking reagent cysteine (Cys), to obtain the mRNA affinity chromatography medium 6FF-BVS-OdT-Cys, which is used for specific capture of mRNA with poly(A) tail, and the final Oligo(dT) density is 0.25μmol / mL, and the prepared affinity chromatography medium 6FF-BVS-OdT-Cys is soaked in 20% ethanol for standby.

[0065] 2. Use 0.1% DEPC to treat centrifuge tubes, buffers, and other experimental supplies to remove RNase, and then rinse with enzyme-free water.

[0066] 3. Dilute the total RNA sample in the human pancreatic cancer cell SW1990 cell lysate to 100 μl, then add 100 μl of 100 mM PBS buffer (1.0 M NaCl, pH = 7) and mix, and then add the affinity chromatography medium 6FF-BVS-Odt-Cys, 4°C, 750 rpm shaking for 15 min. After the reaction is completed, wash the affinity chromatography medium with sterile enzyme-free water and buffer (5 mL 1M lithium chloride solution, 10 mL PBS buffer), and then use 100 μl of 0.5M NaCl, 100 μl of 0.1M NaCl, and 100 μl of ultrapure water to sequentially elute the bound mRNA at a concentration gradient. Use Nano Drop 2000 to measure the eluate in the centrifuge tube. The content of mRNA in the eluate is about 3% of the total RNA, which confirms that the prepared affinity chromatography medium can be used to purify mRNA in the RNA sample to be tested.

[0067] Example 4

[0068] This example provides a method for separating and purifying mRNA, which uses the NaVALID Pro purifier 10 system to perform affinity chromatography of the IVT transcription crude product using the 6FF-BVS-OdT-Cys affinity chromatography medium, including the following steps: purifier 10 system to perform affinity chromatography of the IVT transcription crude product using the 6FF-BVS-OdT-Cys affinity chromatography medium, including the following steps:

[0069] 1. Load 0.1 mL of the above-mentioned affinity chromatography medium 6FF-BVS-OdT-Cys into the chromatography column in the NaVALID Pro, wherein the oligo(dT) density is 0.25 μmol / mL.

[0070] 2. Wash the chromatography system with 25 CV of ultrapure water, and equilibrate the chromatography column with 50 CV of buffer (50 mM PBS buffer, 1.0 M NaCl, 1 mM EDTA, pH 7.0).

[0071] 3. The nucleic acid sample to be separated is firefly luciferase mRNA, which consists of 2103 nucleotides (nt) and contains a co-transcriptionally added 80 nt poly(A) tail. Then, pump the sample solution (5 mL 1M lithium chloride solution, 10 mL buffer) with a nucleic acid sample concentration of 10 nmol / mL into the chromatography column at flow rates of 0.2, 0.6, 1.0, and 5.0 mL / min, respectively. purifier 10 system, the bound mRNA was eluted with a stepwise concentration gradient of 0.5 M NaCl, 0.1 M NaCl, ultrapure water, respectively, and then the column was cleaned in-line with 0.1 M NaOH. The mRNA fraction was collected and the content was determined. The loading capacity of the affinity chromatography medium for mRNA was 1.07, 1.05, 1.02, 0.63 mg / mL at the flow rate of 0.2, 0.6, 1.0, 5.0 mL / min, respectively. It was proved that the affinity chromatography medium could effectively purify mRNA containing poly(A) at the flow rate of 0.2-5.0 mL / min.

[0072] Example 5

[0073] This example provides a method for isolating and purifying mRNA, which utilizes purifier 10 system to isolate and purify mRNA from IVT transcription crude product by affinity chromatography medium 6FF-BVS-OdT-Cys, including the following operation steps:

[0074] 1. Load 0.1 mL of the above affinity chromatography medium 6FF-BVS-OdT-Cys with oligo(dT) density of 0.25 pmol / mL into the pressure column in NaVALID Pro.

[0075] 2. Wash the chromatography system with 5 CV of ultrapure water, and equilibrate the chromatography column with 25 CV of buffer (50 mM Tris buffer, 0.1 M Na2SO4, pH 7.4).

[0076] 3. The nucleic acid sample to be separated is firefly luciferase mRNA, which consists of 2103 nucleotides (nt) and contains a co-transcriptionally added 80 nt poly(A) tail. Then, the sample solution (5 mL of 1 M lithium chloride solution, 10 mL of buffer) with a concentration of 50 pg / mL was pumped into the purifier 10 system at a flow rate of 1.0 mL / min, and then the system flow rate was adjusted to 0.2 mL / min. After 10 min, the bound mRNA was eluted with a stepwise concentration gradient of 0.5 M NaCl, 0.1 M NaCl, ultrapure water, respectively, and then the column was cleaned in-line with 0.1 M NaOH. The mRNA fraction was collected and the content was determined. The loading capacity of the affinity chromatography medium for mRNA was 4.05 mg / mL.

[0077] Example 6

[0078] This example provides a method for isolating and purifying mRNA, which utilizes Example 6

[0079] 1. Load 0.1 mL of the affinity chromatography media 6FF-BVS-OdT-Cys described above into a pressure chromatography column in a NaVALID Pro, wherein the oligo(dT) density is 0.05 pmol / mL, respectively.

[0080] 2. Wash the chromatography system with 10 CV of ultrapure water and equilibrate the column with 30 CV of buffer (50 mM PBS buffer, 1.0 M NaCl, 1 M EDTA, pH 6.8).

[0081] 3. The nucleic acid sample to be separated is firefly luciferase mRNA, consisting of 2103 nucleotides (nt) and containing a co-transcriptionally added 80 nt poly(A) tail. Subsequently, the sample is pumped into the purifier 10 system at a flow rate of 1.0 mL / min with a sample concentration of 10 nmol / mL (5 mL of 1 M lithium chloride solution, 10 mL of buffer) and the system flow rate is subsequently changed to 0.5 mL / min. After 10 min, the bound mRNA is eluted with a stepwise concentration gradient of 0.5 M NaCl, 0.1 M NaCl, ultrapure water, respectively, and the column is then cleaned in-line with 0.1 M NaOH. The mRNA fractions are collected and the content is determined. The loading of the affinity chromatography media with mRNA is 3.03 mg / mL.

[0082] Example 7

[0083] This example provides a method for the isolation and purification of mRNA using the purifier 10 system for the separation and purification of mRNA from IVT transcription crude product using affinity chromatography media 6FF-BVS-OdT-Cys, comprising the following steps:

[0084] 1. Load 0.1 mL of the affinity chromatography media 6FF-BVS-OdT-Cys described above into a pressure chromatography column in a NaVALID Pro, wherein the oligo(dT) density is 0.10 pmol / mL.

[0085] 2. Wash the chromatography system with 20 CV of ultrapure water and equilibrate the column with 50 CV of buffer (50 mM PBS buffer, 1 M NaCl, 1 mM EDTA, pH 7.0).

[0086] 3. The nucleic acid sample to be separated is total RNA sample obtained after cell lysis, containing various mRNAs, then the buffer (10 mM Tris buffer, 1.0 M NaCl, 1 mM EDTA, pH 7.0) with a nucleic acid sample concentration of 20 μg / mL is pumped into purifier 10 system, 10 min later, the bound mRNA is eluted with 0.5 M NaCl, 0.1 M NaCl, ultrapure water in turn, and then the column is cleaned on-line with 0.1 M NaOH. The mRNA component is collected and the content is determined. The loading capacity of the affinity chromatography medium for mRNA is 1.20 mg / mL.

[0087] Example 8

[0088] The IVT transcription crude product of firefly luciferase mRNA and the eluate of firefly luciferase mRNA purified by the affinity chromatography medium prepared in Example 4 are analyzed by capillary electrophoresis, respectively, and the experimental results are shown in Figure 2 The main peak position detected in the eluate after purification by the affinity chromatography medium is basically the same as that before purification, and the impurity peak is obviously reduced, proving that the desired mRNA is purified.

Claims

1. A method for isolating and purifying mRNA, characterized in that, Includes the following steps: (1) Sample preparation: Extract the nucleic acid sample to be separated and adjust it to a suitable concentration for purification; (2) Selection of affinity chromatography medium: Select a suitable affinity chromatography medium based on the characteristics of the target mRNA; (3) Buffer preparation: Prepare a salt-containing buffer solution and adjust the pH and salt concentration according to the type of nucleic acid; (4) Chromatographic system setup: Load the affinity chromatography medium obtained in step (2) into the chromatographic column and select the elution conditions; (5) Sample loading: The nucleic acid sample obtained in step (1) is dissolved in the injection solution and loaded into the chromatographic column to capture mRNA using the affinity chromatography medium; (6) Elution and collection: Eluent is pumped in for stepwise gradient elution, and the purified mRNA is collected; The affinity chromatography medium mentioned in step (2) is 6FF-BVS-Odt-Cys. The 6FF-BVS-Odt-Cys medium is obtained by using agarose gel 6FF as the matrix, bis(ethylene sulfone)methane (BVS) as the linker arm to connect oligonucleotide probes oligo(dT), and finally blocking with cysteine. The density of oligo(dT) in the affinity chromatography medium is 0.05-0.25 μmol / mL. The injection solution is a mixture of lithium chloride solution and the salt-containing buffer prepared in step 3) at a volume ratio of 1:1 to 1:20, which synergistically promotes the binding of mRNA to the affinity chromatography medium. The concentration of lithium chloride solution is 0.5 to 5 M. The gradient elution described in step (6) specifically involves eluting with a stepwise concentration gradient of 0.5 M NaCl aqueous solution, 0.1 M NaCl aqueous solution, and ultrapure water, with the flow rate controlled at 0.2 - 0.5 mL / min, the pressure at 0.01 - 0.30 MPa, and the temperature at room temperature. When an absorption peak is detected at the UV absorption wavelength of 260 nm, mRNA is collected until the absorption peak returns to the baseline and collection is stopped.

2. The method according to claim 1, characterized in that, The nucleic acid samples to be separated in step (1) include total RNA samples obtained by using RNA extraction reagent and centrifugation and precipitation; or target RNA samples obtained by using in vitro transcription (IVT) technology, using a specific DNA template and RNA polymerase, and adding a poly(A) tail of 1-80 nt in length; the concentration of the nucleic acid samples to be separated is adjusted to 10-900 ng / μL.

3. The method according to claim 1, characterized in that, The salt-containing buffer solution mentioned in step (3) includes phosphate buffer and Tris buffer; the salt in the buffer solution is one or a combination of two or more of sodium chloride, sodium sulfate, sodium oxalate, sodium acetate, sodium citrate and ammonium sulfate; the salt concentration in the salt-containing buffer solution is 0.01 M - 1.0 M; the pH range of the buffer solution is 6.8 - 7.

4.

4. The method according to claim 1, characterized in that, In step (4), the chromatographic system selected is the ÄKTApurifier 10 system, and the automatic control software selected is the UNICORN software to set the flow rate, pressure and temperature parameters of the chromatographic column in the chromatographic system.

5. The method according to claim 1, characterized in that, Before loading the nucleic acid sample in step (5), the chromatographic system is washed and equilibrated with washing buffer and equilibration buffer in sequence. The washing buffer is ultrapure water, and the washing volume is 5-25 column volumes. The equilibration buffer is a salt-containing buffer, and the equilibration volume is 25-50 column volumes.

6. The method according to claim 1, characterized in that, In step (5), the loading of the nucleic acid sample to be separated is completed by an automated injector or a manual syringe; the concentration of the nucleic acid sample in the injection solution is 1-50 μg / mL or 5-10 nmol / mL.

7. The method according to claim 1, characterized in that, In step (5), the flow rate of the injection process is controlled at 0.2-1.0 mL / min. First, the flow rate is controlled at 0.8-1.0 mL / min. Rapid injection allows the mRNA in the sample to quickly bind to the oligo(dT) probe in the affinity chromatography medium. Then, the flow rate is adjusted to 0.2-0.5 mL / min so that all unbound oligo(dT) probes are bound.

Images