Sheep anti-f17 escherichia coli infection key lncrna and application thereof

Abstract

The application discloses a sheep anti-F17 E. coli infection key lncRNA, and a nucleotide sequence of the lncRNA is shown as SEQ ID NO:1. The application obtains small intestinal tissue differential lncRNA through sequencing, further screens the differential lncRNA through functional enrichment, randomly detects differential expression lncRNA through RT-qPCR to verify the accuracy of the sequencing result, overexpresses the most differential LOC105604616 in the small intestinal cell to detect the expression level of the LOC105604616 in the F17 E. coli infection / non-infection group, and it is found that the LOC105604616 can improve the anti-F17 E. coli infection ability of the sheep small intestinal epithelial cell, and further found that the LOC105604616 can be used as a marker, so that the anti-F17 E. coli infection ability of the sheep can be judged.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a goat anti-F17 Escherichia coli infection key lncRNA and application thereof. BACKGROUND

[0002] Lamb diarrhea is one of the most common diseases in intensive farms, which has existed for a long time in various countries in the world and has caused huge economic losses. F17 Escherichia coli is one of the main pathogenic bacteria causing lamb diarrhea, which has the characteristics of high detection rate and high mortality rate. However, the research on the immune regulation and anti-disease mechanism of sheep against F17 Escherichia coli infection is still insufficient. At present, the main means to prevent and treat lamb diarrhea is the use of antibiotics such as oxytetracycline and gentamicin, but the excessive use and abuse of veterinary drugs lead to the increasing drug resistance of Escherichia coli, and a large amount of drug residues also pose a threat to animal and human health, so disease-resistant breeding has become a better method to solve the problem of antibiotic residues.

[0003] As a non-coding RNA, lncRNA can play a regulatory role through transcription, post-transcription and epigenetic pathways, participate in the regulation of livestock diseases, and mediate bacterial immune responses. Therefore, based on the results of distinguishing resistant and susceptible individuals of lambs by F17 Escherichia coli infection in the previous stage, this study carries out whole transcriptome sequencing, screens differential expression lncRNA, and verifies its biological function at the cellular level to identify key lncRNA as a marker for sheep against F17 Escherichia coli infection, which provides a basis for future disease-resistant breeding of sheep. SUMMARY

[0004] The present application provides a goat anti-F17 Escherichia coli infection key lncRNA, primers and application thereof to overcome the shortcomings of the prior art.

[0005] One of the purposes of the present application is to provide a goat anti-F17 Escherichia coli infection key lncRNA, and the nucleotide sequence of the lncRNA is shown in SEQ ID NO: 1.

[0006] The second purpose of the present application is to provide a screening and function verification method of a goat anti-F17 Escherichia coli infection key lncRNA.

[0007] The third purpose of the present application is to provide a primer of a goat anti-F17 Escherichia coli infection key lncRNA as a marker and application thereof.

[0008] The application provides a sheep anti-F17 E. coli infection key lncRNA and an application thereof.

[0009] In order to achieve the above-mentioned purpose, the application adopts the following technical solutions.

[0010] The application provides a screening method of a sheep anti-F17 E. coli infection key lncRNA, including the following steps.

[0011] (1) analyzing the differentially expressed lncRNAs in the F17 E. coli antagonistic group and the susceptible group;

[0012] (2) differentially expressed lncRNA target gene prediction and biological function enrichment analysis through GO and KEGG databases;

[0013] (3) randomly selecting six differentially expressed lncRNAs, detecting the expression levels of the lncRNAs in the sheep F17 E. coli susceptible group / small intestinal tissue of the antagonistic group through RT-qPCR, comparing the detection results with the sequencing results, and determining whether the expression trends are consistent;

[0014] (4) constructing an overexpression vector of the most significant differentially expressed lncRNA LOC105604616, transfecting small intestinal cells, inoculating the experimental group and the control group with the same amount of F17 E. coli, and performing colony counting and pilus gene RT-qPCR detection 2-3 hours later, so as to verify the influence of LOC105604616 on the anti-F17 E. coli infection of the sheep small intestinal epithelial cells.

[0015] Specifically, the application provides a screening method of a sheep anti-F17 E. coli infection key lncRNA, the method is whole transcriptome sequencing, the sequencing object is sheep small intestinal tissue, the sequencing platform is an illumina sequencing platform, and the method includes the following steps.

[0016] (1) extracting the small intestinal tissue RNA of the antagonistic group and the susceptible group, performing quality identification on the RNA, establishing a cDNA library after the RNA quality identification is qualified, performing sequencing to obtain Raw Reads, and obtaining Clean Reads after filtration;

[0017] (2) Using Hisat2 software to align the Clean Reads and the sheep Oar_v4.0 reference genome, the aligned reads are assembled using StringTie software, and the assembled transcripts are analyzed according to the structure and non-coding function characteristics of IncRNA, and the preliminary screening conditions are as follows: ① The transcript with length ≥200nt and exon number ≥2; ② The transcripts with reads coverage <5 in all samples are screened out; ③ The known mRNA and other non-coding RNA are screened out by comparing with the annotation file of the species using Cuffcompare; ④ The remaining lncRNA is classified using cuffcompare;

[0018] (3) The expression amount is standardized using FPKM method (Fragments Per kb Per Million Reads), and the DEseq software is used to analyze the differential expression of lncRNAs between F17 E. coli susceptible group and antagonistic group, and the default condition of differential expression lncRNA is P value≤0.05 and | log2FoldChange |≥1, and 190 differential expression lncRNAs are found;

[0019] (4) The differential expression lncRNAs are used for co-location (position correlation) and co-expression (expression correlation) to predict target genes, and the KOBAS (KO-Based Annotation System) program is used for GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis of target genes of differential expression lncRNA, and the lncRNAs with large difference and related to bacterial immunity are screened as candidate lncRNAs;

[0020] (5) Six lncRNAs with large differential expression are randomly selected, and the expression level is detected in the sheep F17 E. coli susceptible group / antagonistic group small intestine tissue by RT-qPCR, and compared with the sequencing result, it is found that the expression trend is consistent, and the sequencing result is accurate.

[0021] The application provides a sheep anti-F17 E. coli infection marker, and the marker is a most significant differential lncRNA-LOC105604616, and the sequence is shown as SEQ ID NO:1.

[0022] The application provides a primer of a sheep anti-F17 E. coli infection marker, and the sequence of the primer is shown as SEQ ID NO:2 and 3.

[0023] The application provides application of the marker primer in detection of sheep anti-F17 E. coli infection ability, and comprises the following steps:

[0024] (1) taking sheep small intestine tissue RNA as a template, reverse transcribing into cDNA, and performing fluorescent quantitative PCR amplification by using a primer with the sequence of SEQ ID NO: 2;

[0025] (2) adopting 2^ -△△Ct The quantitative results were calculated according to LOC105604616 expression level, and determining the strength of the sheep anti-F17 E. coli infection ability.

[0026] The application has the advantages that the difference lncRNA of sheep anti-F17 E. coli infection is screened through whole transcriptome sequencing of sheep small intestine cells, the difference level of candidate lncRNA in F17 E. coli antagonistic / susceptible group sheep small intestine tissue and F17 E. coli infected / control group sheep small intestine epithelial cells is detected by combining RT-qPCR technology, the most significant LOC105604616 is selected as the candidate lncRNA, and it is found by cell experiment verification that the LOC105604616 can improve the anti-F17 E. coli infection ability of sheep small intestine epithelial cells, and it is indicated that the sheep individual with the expression amount of LOC105604616 has stronger resistance to F17 E. coli infection. Therefore, the specific primer of LOC105604616 is designed, the individual small intestine tissue in a sheep group is randomly collected, RT-qPCR detection is performed, and the resistance ability of the sheep group to F17 E. coli infection is determined according to the expression amount, which provides a good foundation for future sheep disease-resistant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is a lncRNA differential expression clustering analysis heat map in the application.

[0028] Figure 2 It is a GO and KEGG enrichment analysis diagram of lncRNA target genes in the application. In the diagram, A is GO enrichment analysis of cis-target genes; B is GO enrichment analysis of trans-target genes; C is KEGG enrichment analysis of cis-target genes; and D is KEGG enrichment analysis of trans-target genes.

[0029] Figure 3 It is a result diagram of RT-qPCR verification sequencing data accuracy analysis in the application. In the diagram, A is the RT-qPCR result; and B is the sequencing result.

[0030] Figure 4 It is an expression situation diagram of lncRNA in F17 E. coli infected / control group sheep small intestine epithelial cells in the application.

[0031] Figure 5 Validation diagram of pcDNA3.1(+)-LOC105604616 recombinant vector in the application. In the diagram, A is a schematic diagram of gel electrophoresis identification result of pcDNA3.1(+)-LOC105604616 vector after double enzyme digestion; B is a schematic diagram of RT-qPCR detection of pcDNA3.1(+)-LOC105604616 overexpression vector efficiency.

[0032] Figure 6 Colony counting result diagram of F17 E. coli infected overexpression LOC105604616 cells in the application.

[0033] Figure 7 RT-qPCR result diagram of F17 E. coli infected overexpression LOC105604616 cells in the application. DETAILED DESCRIPTION

[0034] The technical solutions of the application will be further described in detail below in combination with examples: the examples are implemented on the premise of the technical solutions of the application, and detailed implementation modes and specific operation processes are given, but the protection scope of the application is not limited to the following examples.

[0035] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0036] The reagents and materials involved in the following examples can be obtained by the public from domestic and foreign commercial channels or other free channels unless otherwise specified, which will not be described one by one here.

[0037] Example 1: Screening of goat anti-F17 E. coli infection differential lncRNA

[0038] (1) Six healthy lambs in the high-dose challenge group of F17 E. coli were selected as the F17 E. coli antagonistic group, and six severe diarrhea lambs in the low-dose challenge group were selected as the F17 E. coli susceptible group, and small intestinal tissue samples (100 mg) were collected as sequencing samples;

[0039] (2) The TRIZol Universal (Tiangen Biochemical Technology Co., Ltd., Beijing) method was used to extract the RNA of the antagonistic group and the susceptible group, and quality detection was performed.

[0040] ① The tissue was cut into a mortar and ground into powder with a pestle, and liquid nitrogen was added constantly to keep cold. The sample powder was collected into a 1.5 mL enzyme-free centrifuge tube, and 1 mL of lysis solution TRIZol was added; or the small intestinal epithelial cells were collected: the culture medium was discarded, and PBS was washed for 3 times, 1 mL of lysis solution TRIZol was added every 10 cm3, and it was blown thoroughly;

[0041] ②4℃, after lysis for 10 min, transfer to 1.5 mL enzyme-free centrifuge tube;

[0042] ③Add 200 μL chloroform, shake vigorously for 15-20 s, and stand on ice for 5-10 min;

[0043] ④Use a 4℃ pre-cooled centrifuge at 12000 rpm for 15 min, and transfer the upper aqueous phase liquid to a new 1.5 mL enzyme-free centrifuge tube. Add an equal volume of isopropanol (-20℃ pre-cooled), mix well by inverting, and stand at room temperature for 5-10 min;

[0044] ⑤4℃, 12000 rpm, centrifuge for 10 min, discard the supernatant, and leave the white precipitate;

[0045] ⑥Add 1 mL of 75% ethanol (0.1% DEPC, -20℃ pre-cooled), invert for 20 s;

[0046] ⑦4℃, 12000 rpm, centrifuge for 5 min, discard the supernatant;

[0047] ⑧4℃, 12000 rpm, centrifuge for 5 min, discard the supernatant;

[0048] ⑨Use a spectrophotometer to measure the concentration and quality of RNA, and check the degradation of RNA by 1.5% agarose gel electrophoresis, and store at -80℃.

[0049] (3) Construction and sequencing of cDNA library

[0050] Using the ribosomal RNA-removed sample RNA as a template, first-strand cDNA was synthesized using random primers, and second-strand cDNA was synthesized through DNA polymerase I and dNTPs (dATP, dGTP, dCTP, dUTP). After double-stranded cDNA purification, end repair, and A tailing, AMPureXP beads were used to screen cDNA of appropriate length. Finally, USER degrades cDNA second strand, and the library is obtained by PCR amplification. After quality inspection, use the Illumina HiSeqTM2500 platform for PE150 (sequencing read length of 150 bp) sequencing (Beijing Nuowozhiyuan Technology Co., Ltd.).

[0051] (4) Differential lncRNA determination and screening

[0052] The Clean Reads and sheep Oar_v4.0 reference genome were aligned by using Hisat2 software, and the successfully aligned reads were assembled by using StringTie software. The assembled transcripts were analyzed according to the structure and non-coding function characteristics of IncRNA. The preliminary screening conditions were as follows: ① the transcript with a length of ≥200 nt and an exon number of ≥2; ② the transcript with a reads coverage of <5 in all samples was screened out; ③ the known mRNA and other non-coding RNA were screened out by using Cuffcompare to compare with the annotation file of the species; and ④ the remaining lncRNA was classified by using cuffcompare.

[0053] The expression amount was standardized by using FPKM method (Fragments Per kb Per Million Reads), the differential expression of lncRNAs between F17 Escherichia coli susceptible group and antagonistic group was analyzed by using DEseq software, the default condition of differentially expressed lncRNA was P value≤0.05 and | log2FoldChange |≥1, and 190 differentially expressed lncRNAs were found.

[0054] The target genes of differentially expressed lncRNAs were predicted by using co-location (position correlation) and co-expression (expression correlation), the target genes of differentially expressed lncRNA were subjected to GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis by using KOBAS (KO-Based Annotation System) program (the results are shown in Figure 2 ), and the lncRNAs with large differences and related to bacterial immunity were screened out as candidate lncRNAs. The clustering analysis results of differentially expressed lncRNA are shown in Figure 1 .

[0055] Example 2 Verification of whole transcriptome sequencing results

[0056] (1) Primer design. Six differentially expressed lncRNAs were randomly selected, and the RT-qPCR primers of differentially expressed lncRNA were designed by using Oligo7 software. GAPDH was used as an internal reference gene in the RT-qPCR reaction. All primers were synthesized by Beijing Genesee Biotechnology Co., Ltd. The primer information is as follows:

[0057] LOC105604616

[0058] F: TCCTAGGTTGACCGCAGGTA

[0059] R: ATTCCTGACCCCAGGAAGGT

[0060] LOC105603287

[0061] F: TGTCTCCCGCAGAGGGG

[0062] R: GTGACCGTGGTGCTGTAGAA

[0063] LOC106990937

[0064] F: CACATCTTCCGAGGGACGTT

[0065] R: GCATGAAGAACTCATGGTGGC

[0066] TCONS_00223467

[0067] F: CGGGGTTGTGTTCATGGGA

[0068] R: CGGGGTTGTGTTCATGGGA

[0069] TCONS_00241897

[0070] F: AGACACCACACAACAACCTCA

[0071] R: CCTCTTCTCCAGCATCAGC

[0072] TCONS_00136972

[0073] F: AGCTTCTCGTTGCCCGCCA

[0074] R: TCGCCAGTCGTCGTCCACCT

[0075] (2) cDNA synthesis. The first strand of cDNA was synthesized by PCR using the lncRNA cDNA synthesis kit (Tiangen), and stored at -20°C for use.

[0076] gDNA removal reaction system (20 μL):

[0077] Total RNA 10ng-2μg 5×g DNA Buffer 2μL RNase-Free ddH2O Make up to 10 μL

[0078] Reverse transcription reaction system (20 μL):

[0079] 10×lnR RT Buffer 2μL LnR RT Enzyme Mix 1 μL LnR-RT Primer Mix 2μL RNase-Free ddH2O Make up to 10 μL

[0080] Reverse transcription PCR reaction conditions: 42°C for 15 min, 95°C for 3 min.

[0081] (3) RT-qPCR reaction. The reaction system was configured using lncRNA fluorescent quantitative detection kit (Tiangen), and the specific reaction system was as follows:

[0082] RT-qPCR reaction system (20 μL):

[0083] 2×lnR lncRNA PreMix 10 μL Forward primer 0.5μL Reverse primer 0.5μL cDNA template 2μL RNase-Free ddH2O Make up to 20 μL

[0084] RT-qPCR reaction conditions: 95℃ 3 min; 95℃ 5 s, 60℃ 15 s, 40 cycles.

[0085] (4) The expression of differential lncRNA is shown in Table 1, wherein A is the RT-qPCR result; and B is the sequencing result. After comparison, the differential expression trend of lncRNA in lncRNA-Seq and RT-qPCR is similar, indicating that the sequencing data has good repeatability and accuracy. Figure 3

[0086] Example 3 Determination of key lncRNA of sheep anti-F17 E. coli infection

[0087] (1) Resuscitation and culture of sheep small intestinal epithelial cells. The frozen tube containing sheep small intestinal epithelial cells was taken out from liquid nitrogen and quickly placed in a 37℃ constant temperature water bath for thawing. The cells were transferred to a sterile 2 mL centrifuge tube, and an equal volume of complete culture medium (containing 10% FBS and 1% double-antibiotic DMEM / F12) was added, and then mixed gently by blowing. Centrifugation was performed at 1200 rpm for 10 min, and the supernatant was discarded. 1 mL of complete culture medium was added, and the cells were mixed evenly by blowing. Then, the cells were transferred to a culture bottle, and 4 mL of complete culture medium was added. The culture bottle was placed in a 37℃ constant temperature incubator (5% CO2) for culture.

[0088] (2) Cell passage. When the cells grew to 80%-90% of the bottom of the culture bottle, the cell passage was performed. The culture medium in the culture bottle was discarded, and the PBS buffer (1×PBS solution containing 10% penicillin and streptomycin) was gently washed and discarded for 3 times. 1 mL of trypsin was added to digest the cells, and the cells were placed in a 37℃ constant temperature incubator (5% CO2) for 5 min. An equal volume of complete culture medium was added to terminate the digestion, and the cells were mixed gently by blowing. The cell suspension was transferred to a 2 mL centrifuge tube, and 100 μL of cell suspension was added to the bottom of a six-well plate. The six-well plate was gently shaken to evenly distribute the cells, and then the plate was placed in the incubator for further culture.

[0089] ​(3) Resuscitation and culture of F17 E. coli. Liquid / solid LB medium (1% peptone, 0.5% yeast extract, 1% sodium chloride) was prepared, the pH value was adjusted to 7.2-7.5, and high-temperature sterilization was performed for 20 min. The solid LB medium needs to add 1.5% agar before sterilization, and pour into the flat plate culture dish under sterile conditions until solidification; F17 E. coli (glycerol bacteria) was transferred from -80°C to ice bath in an ice box; the inoculum ring was used to pick the strain and inoculate into the flat plate culture dish, 37°C, culture for 12 h. After picking the bacteria, the F17 E. coli (glycerol bacteria) should be returned to -80°C as soon as possible; use a sterilized gun head to pick a complete single colony in the flat plate culture dish and add it to a 2 mL sterilized centrifuge tube containing LB medium. Culture at 37°C, 200 r / min in a shaking bed.

[0090] (4) F17 E. coli infection of sheep small intestinal epithelial cells test. In the early stage, an in vitro model of F17 E. coli infection of sheep small intestinal epithelial cells was preliminarily established, and the optimal infection time and multiplicity of infection (MOI) of F17 E. coli infection of sheep small intestinal epithelial cells were determined. Starve the cells: when the sheep small intestinal epithelial cells in the culture bottle grow to 80%-90%, they are digested and inoculated into a 6-well culture plate (~1x105 per well) during the inoculation process. DMEM / F12 medium without FBS and antibiotics is used. Place the 6-well culture plate in a 37°C constant temperature incubator (5% CO2) for 8 h of starvation treatment. Divide the cells into an infection group and a control group, add F17 E. coli bacterial solution to the infection group at a multiplicity of infection MOI=100:1, and add the same volume of DMEM / F12 medium without FBS and antibiotics to the control group, and incubate in a 37°C constant temperature incubator (5% CO2) for 3 h.

[0091] The expression of differentially expressed lncRNA in F17 E. coli infected / sheep small intestinal epithelial cells in the control group is shown in Table 1. Figure 4 LOC105604616 has the most significant differential expression between the two groups, and the expression amount is high, indicating that it may be related to the regulation mechanism of anti-F17 E. coli infection. Therefore, LOC105604616 is used as a candidate lncRNA for subsequent functional verification.

[0092] Example 4: Verification of the effect of LOC105604616 on the anti-F17 E. coli infection of sheep small intestinal epithelial cells

[0093] (1) Construction of LOC105604616 overexpression vector

[0094] Amplification of lncRNA fragment. According to the full-length sequence of LOC105604616 obtained by sequencing, an amplification primer with enzyme cutting sites Not I and Xho I was designed, and the specific primer information was as follows:

[0095] Upstream primer F: atttGCGGCCGCTCGCCTGGCGTTTACGCC

[0096] Downstream primer R: ccgCTCGAGTCAGGCACATTCGATGAATTTATT

[0097] PCR reaction system (50 μL):

[0098] 2×PrimeSTAR Max Premix 25 μL Upstream primer 2μL Downstream primer 2μL DNA template <400 ng [CDATA[DdH2O]] Make up to 50 μL

[0099] PCR reaction condition: 98℃ 10s, 58℃ 5s, 72℃ 5s, 34 cycles.

[0100] Purification and recovery of DNA fragment. The product in the previous step was purified and recovered using an agarose gel DNA recovery kit (Tiangen).

[0101] Double enzyme cutting of DNA fragment and vector. The purified and recovered DNA fragment and pcDNA3.1(+) vector were double enzyme cut using QuickCut™ Xho I and QuickCut™ Not I (TaKara), and the reaction system and condition were as follows:

[0102] Double enzyme cutting reaction system (50 μL):

[0103] 10×QuickCut Buffer 5μL XhoⅠ 1 μL NotⅠ 1 μL DNA fragment / vector <500 ng ddH2O Make up to 50 μL

[0104] PCR reaction condition: 37℃ 30min, 85℃ 30s.

[0105] Purification and recovery of linear fragment. The product was purified and recovered using an agarose gel DNA recovery kit (Tiangen).

[0106] Connection of target fragment and vector. The reaction system (10 μL) of connecting the target fragment and the vector was connected using Solution I (TaKara):

[0107] The reaction system and condition were as follows:

[0108] Solution Ⅰ 5μL carrier 1 μL (approximately 20 ng) Destination fragment 4 μL (approximately 80 ng)

[0109] Reaction condition: 16℃ overnight.

[0110] Transformation of recombinant plasmid. Add 10 μL ligation product to ice-thawed DH5α competent cells (Genview), mix gently, and incubate in ice bath for 30 min; immediately transfer to ice for 5 min after 42℃ heat shock for 45-60 s; add 500 μL SOC medium, and shake in a 37℃, 180 r / min shaker for 1 h; take 100 μL bacterial solution and spread on an LB plate containing kanamycin (K+); and incubate in a 37℃ constant temperature incubator for 12-16 h.

[0111] Extraction and identification of recombinant plasmid. Select an intact single colony and transfer to a sterile centrifuge tube containing LB medium containing kanamycin (K+). Shake in a 37℃, 180 r / min shaker for 12-16 h. Use an endotoxin-free plasmid extraction (medium) kit (Tiangen) to extract the plasmid, and refer to the instructions on the Tiangen website for specific steps. Finally, send the extracted plasmid to Genview Biotech (Beijing) Co., Ltd. for identification, and perform double enzyme digestion identification with QuickCut™ Xho I and QuickCut™ Not I (TaKara), and the results are shown in Fig. 1A. The sizes of the target fragment and the vector fragment both show obvious bands, indicating that the vector construction is successful. Figure 5

[0112] Detect the transfection efficiency of the overexpression vector by RT-qPCR, and the results are shown in Fig. 2B. The mRNA expression of LOC105604616 significantly increases after overexpression (P<0.01), indicating that the transfection efficiency of the overexpression vector is high and can be used for subsequent experiments. Figure 5 P <0.01), indicating that the transfection efficiency of the overexpression vector is high and can be used for subsequent experiments.

[0113] (2) Effect of LOC105604616 overexpression on the resistance of sheep small intestinal epithelial cells to F17 E. coli infection

[0114] F17 E. coli colony counting test. Discard the culture medium in the 6-well plate, and wash with PBS for 3 times. Add 300 μL Triton X-100 (0.5%) lysis solution to each well, and lyse in a 37℃ constant temperature incubator for 30 min. Transfer the lysis product to a 1.5 mL sterile centrifuge tube, wash the residual part in the well with 200 μL lysis solution for 2 times and transfer to the centrifuge tube, mix well after shaking, and then perform dilution by 2 times. Spread the dilution solutions with dilution gradients of 2×10 4 , 2×10 5 , and 2×10 6 on LB plate culture dishes, and invert in a 37℃ constant temperature incubator overnight. The next day, count the colonies in the culture dishes. The results of colony counting are shown in Fig. 3. Figure 6 ​​As shown in Figure 6, the number of F17 E. coli adhered to the cells in the pcDNA3.1(+) transfection group (empty vector group) was significantly higher than that in the LOC105604616-pcDNA3.1(+) transfection group (overexpression group) (P<0.01).

[0115] Extraction of genomic DNA. The whole genome DNA (including cells and F17 E. coli adhered thereto) was extracted using a genomic DNA extraction kit (Tiangen), the concentration and quality of the DNA were measured using a spectrophotometer, and the DNA was stored at -20°C for later use.

[0116] Detection of the expression level of the F17 E. coli pilus gene. The expression level of the F17 E. coli pilus gene was detected by RT-qPCR, the extracted genomic DNA was used as a template, the GAPDH gene was used as an internal reference gene, and the F17 E. coli pilus gene primers F17b-A and F17b-G were designed, and the specific primer information is as follows:

[0117] F17b-A F: CAACTAACGGGATGTACAGTTTC

[0118] R: CTGATAAGCGATGGTGTAATTAAC

[0119] F17b-G F: CGTGGGAAATTATCTATCAACG

[0120] R: TGTTGATATTCCGTTAACCGTAC

[0121] RT-qPCR reaction system (20 μL system):

[0122] 2×TSINGKE Master qPCR Mix (SYBR Green I) 10 μL 10 µM upstream primer 0.8μL 10 µM downstream primer 0.8μL Template DNA 1 μL 50x ROX Reference Dye I / II b ]] 0.4μL ddH2O Make up to 20 μL

[0123] The RT-qPCR reaction conditions were as follows: 95°C for 1 min; 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0124] The expression level of the F17 E. coli pilus gene was detected by RT-qPCR, and the results are shown in Figure 6. Figure 7 As shown in Figure 6, the expression level of F17 E. coli in the pcDNA3.1(+) transfection group (empty vector group) was significantly higher than that in the LOC105604616-pcDNA3.1(+) transfection group (overexpression group) (P<0.01). In combination with the above experimental results, it is indicated that LOC105604616 can significantly improve the ability of sheep small intestinal epithelial cells to resist F17 E. coli infection, and further indicates that sheep individuals with high LOC105604616 expression have stronger resistance to F17 E. coli infection.

[0125] Example 5 Application of LOC105604616 in detecting the ability of sheep to resist F17 E. coli infection

[0126] (1) RNA extraction of the sample to be detected. Randomly select detection individuals in the sheep to be detected, collect small intestinal tissues, and extract RNA, and the specific method is shown in Example 1.

[0127] (2) The expression level of LOC105604616 in the sample to be detected is detected by fluorescence quantification. The primers of LOC105604616 provided by the present application are used to detect the expression level of the cDNA reverse transcribed from the RNA in (1) by fluorescence quantification, and the specific method is shown in Examples 2 and 3.

[0128] (3) The results of fluorescence quantification are analyzed. The expression level of LOC105604616 in each sample is obtained by using the 2^-△△Ct method, and the expression level data of the susceptible group and the antagonistic group are combined to determine the ability of each sample corresponding to the sheep individual to resist F17 E. coli infection.

[0129] The present application obtains the differential lncRNA of small intestinal tissues by sequencing, further screens the differential lncRNA by functional enrichment, randomly detects the differential expression lncRNA by RT-qPCR to verify the accuracy of the sequencing results, overexpresses the most significant differential LOC105604616 in small intestinal cells to detect the expression level of the LOC105604616 in the F17 E. coli infection / non-infection group, and verifies that the LOC105604616 can improve the ability of sheep small intestinal epithelial cells to resist F17 E. coli infection, and further finds that the LOC105604616 can be used as a marker, so that the ability of sheep to resist F17 E. coli infection can be determined.

[0130] The above is only a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, any person skilled in the art can understand and think of the transformation or replacement within the technical range disclosed by the present application, which should be covered in the inclusive scope of the present application, therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. A key lncRNA for sheep resistance to F17 Escherichia coli infection, characterized by: The nucleotide sequence of the lncRNA is shown in SEQ ID NO:

1.

2. The primer for the key lncRNA of sheep anti-F17 Escherichia coli infection according to claim 1, characterized in that: The RT-qPCR primers of LOC105604616 are shown in SEQ ID NOs: 2 and 3.

3. Use of a primer for a key lncRNA of sheep anti-F17 Escherichia coli infection as claimed in claim 2 in the preparation of a reagent for detecting sheep anti-F17 Escherichia coli infection ability.

Images