A colorectal cancer LncRNA diagnostic marker, diagnostic kit and application

Abstract

The present invention provides a colorectal cancer LncRNA diagnostic marker, a diagnostic kit and an application, and belongs to the technical field of tumor molecular biology. The present invention extracts RNA from colorectal cancer tissue and then performs reverse transcription, and then uses a primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNAMSTRG.40707.1 to perform fluorescent quantitative PCR amplification to detect the expression of LncRNA MSTRG.40707.1 in colorectal cancer tissue. The LncRNA MSTRG.40707.1 of the present invention is upregulated in both colorectal cancer tissues and cells, and the AUC value obtained in the ROC curve verification of colorectal cancer is 0.974, which can be used for auxiliary diagnosis of colorectal cancer patients.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor molecular biology, and in particular to a colorectal cancer LncRNA diagnostic marker, a diagnostic kit and an application thereof. Background Art

[0002] Colorectal cancer (CRC) is a malignant tumor that originates in the colon or rectum. It is initially caused by the unlimited proliferation of epithelial cells in the intestinal lining and gradually becomes cancerous over time.

[0003] According to global statistics in 2020, more than 1.8 million people are diagnosed with colorectal cancer each year, and its mortality rate ranks second among all cancers. It is one of the most common cancers and is showing an increasing trend year by year. Colorectal cancer is generally most common in people over 50 years old, but the incidence of colorectal cancer in young people is currently increasing year by year, and the situation is very serious.

[0004] At present, the treatment of colorectal cancer is mainly surgery, supplemented by chemotherapy, radiotherapy and targeted therapy. Early colorectal cancer can generally be cured by surgical resection. Early detection, diagnosis and treatment of colorectal cancer are crucial to improving the five-year survival rate of the disease. The main challenge facing colorectal cancer is that the early screening rate is less than 15%. On the one hand, there are no obvious symptoms in the early stage of the disease, which has not attracted enough attention; on the other hand, there is a lack of effective diagnostic markers, which seriously hinders the early diagnosis and screening of the disease.

[0005] Long non-coding RNA (LncRNA) is a small RNA fragment formed by the transcription process of genes. Its size is generally more than 200 bp. It is found in almost all species and in large quantities. LncRNA does not have the structure of mature RNA, so it does not have the ability to encode functional proteins. Since LncRNA can interact with a variety of molecules in the body, it has attracted much attention. LncRNA participates in the regulation of multiple biological processes such as gene expression and translation, including RNA transcription, signal transduction, protein translation and epigenetic modification. It is involved in the regulation of various phenotypes of tumor cells, such as cell proliferation, apoptosis, invasion and EMT. In addition, LncRNA is also related to tumor chemotherapy resistance and cell stemness regulation. Therefore, exploring the function and mechanism of LncRNA in the diagnosis, prognosis, etiology and metastasis of colorectal cancer is of positive significance for finding new diagnostic and prognostic markers and therapeutic targets.

[0006] Due to the functions and properties of LncRNA itself, it has the potential to become a marker for the diagnosis and screening of colorectal cancer, and there is currently no mature LncRNA detection kit and method system for clinical use. Therefore, the field is currently in urgent need of developing new biomarkers to assist in the diagnosis of colorectal cancer patients. Summary of the invention

[0007] The purpose of the present invention is to provide a colorectal cancer LncRNA diagnostic marker, a diagnostic kit and an application thereof, which can be used for auxiliary diagnosis of colorectal cancer patients.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1, and the sequence of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 is shown in SEQ ID NO.1.

[0010] The present invention also provides a primer pair for amplifying the above-mentioned colorectal cancer LncRNA diagnostic marker LncRNAMSTRG.40707.1, wherein the primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNAMSTRG.40707.1 comprises an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3.

[0011] The present invention also provides a colorectal cancer diagnostic kit, characterized in that the colorectal cancer diagnostic kit consists of a 10 μM / μL primer pair for amplifying a colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1, TBGreenMix, reverse transcription polymerase Mix, a stabilizer, and an ammonia-ammonium chloride buffer.

[0012] Preferably, the composition of the TB Green Mix is: 100 μM dNTP, 2 mM MgCl2, 100 nM fluorescent probe, 100 U / μL Taq DNA polymerase; the composition of the reverse transcriptase polymerase Mix is: 100 U / μL reverse transcriptase, 30 U / μL RNase inhibitor.

[0013] The present invention also provides an application of a colorectal cancer diagnosis kit in the preparation of a product for early diagnosis of colorectal cancer.

[0014] The beneficial effects of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 described in the present invention compared with the prior art are as follows:

[0015] (1) The colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 of the present invention is upregulated in both colorectal cancer tissues and cells. The AUC value obtained in the ROC curve verification of colorectal cancer is 0.974, which can be used for auxiliary diagnosis of colorectal cancer patients.

[0016] (2) Knockdown of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 inhibited the proliferation of colorectal cancer cells HCT116, while overexpression promoted the proliferation of colorectal cancer cells HCT116. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0018] Figure 1 The expression of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in colorectal cancer tissues in Example 1;

[0019] Figure 2 This is the ROC curve of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in Example 1;

[0020] Figure 3 The expression of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in HT29, HCT116 and SW620 cells in Example 2;

[0021] Figure 4 Example 3 shows the effect of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 on the proliferation of colorectal cancer cells HCT116;

[0022] Figure 5 The test results of the colorectal cancer diagnosis kit in Example 4;

[0023] Figure 6 This is a diagram of the overexpression vector structure of Example 3. DETAILED DESCRIPTION

[0024] The embodiments of the present invention are described in detail below, and the embodiments are intended to explain the present invention and should not be construed as limiting the present invention. If specific techniques or conditions are not specified in the embodiments, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. If the manufacturers of reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0025] The present invention extracts RNA from colorectal cancer tissue and performs reverse transcription, and then uses a primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 to perform fluorescent quantitative PCR amplification to detect the expression of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in the colorectal cancer tissue, so as to perform auxiliary diagnosis on colorectal cancer patients.

[0026] The sequence SEQ ID NO.1 of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 of the present invention is:

[0027]

[0028] Example 1

[0029] Example 1 of the present invention detected the expression of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in colorectal cancer (CRC) tissue and adjacent tissues thereof, and the specific method was as follows:

[0030] (1) Extraction of total RNA:

[0031] A. Take 50 mg of CRC tissue sample and adjacent tissue sample respectively, place them in a sterile enzyme-free mortar, add liquid nitrogen and grind until the tissue blocks are completely broken, then add 1 mL of TRIZOL reagent. Add TRIZOL directly to the cell sample and mix with a pipette until the precipitate completely disappears.

[0032] B. Mix the ground CRC tissue and paracancerous tissue with TRIZOL solution respectively, and transfer the mixture to a 2 mL sterile enzyme-free centrifuge tube. Let it stand at room temperature for 10 min to allow the CRC tissue and paracancerous tissue to be fully mixed with TRIZOL reagent.

[0033] C. Continue to add chloroform (add 200 μL chloroform per mL TRIZOL), gently shake the centrifuge tube to fully mix the chloroform and TRIZOL, and let it stand for 5 minutes. After centrifugation at 3000 rpm for 15 minutes, collect the upper transparent layer and gently transfer the upper transparent liquid to a new sterile nuclease-free centrifuge tube. Avoid mixing the middle and lower sediments in this process.

[0034] D. Add isopropanol solution (1:1 with transparent liquid) to the centrifuge tube, mix well and centrifuge, discard the supernatant. Wash the precipitate with 75% ethanol (1 mL / tube), shake and mix well and centrifuge (4°C, 7500 rpm, 5 min), discard the ethanol and place on dry absorbent paper or in a ventilated place to allow the RNA to dry naturally at room temperature.

[0035] E. RNA dissolution and storage: Add an appropriate amount of RNase-free water and place in a 65℃ metal bath to fully dissolve the RNA for 5 minutes, mix well and place on ice. Determine the concentration of the dissolved RNA and then dispense it into sterile enzyme-free centrifuge tubes, or store it in a -80℃ refrigerator, or directly perform reverse transcription for subsequent experiments.

[0036] (2) Reverse transcription to synthesize cDNA:

[0037] The total RNA concentration was quantified using Nanotrop2000. 1 μg of RNA from colorectal cancer tissue and adjacent tissue was taken and added to PCR tubes, 5 μL of PrimeScriptRT MasterMix (TAKARA, Cat#RR036A), and ddH2O (Tiangen Biotech) was added to a total volume of 20 μL. The PCR conditions for cDNA synthesis were as follows: 37°C for 15 min; 85°C for 5 s; and 4°C for storage. Reverse transcription was performed using a 96well ABI Cycler PCR amplification instrument. The cDNA obtained by reverse transcription was stored at -80°C for long-term storage or at -20°C for future use.

[0038] (3) PCR amplification reaction:

[0039] The cDNA amplified in step (2) was used for detection. The reaction system was: 2 μL cDNA, 0.8 μL upstream primer (SEQ ID NO.2, synthesized by Sangon Biotech (Shanghai) Co., Ltd.), 0.8 μL downstream primer (SEQ ID NO.3, synthesized by Sangon Biotech (Shanghai) Co., Ltd.), 6.4 μL ddH2O, 10 μL fluorescent quantitative PCR amplification Mix (TB Green dye), total volume 20 μL;

[0040] SEQ ID NO.2: TGCCAAATGTGAACCCTTGCCTAC;

[0041] SEQ ID NO. 3: AGTCCTTTGTTCTACTCCCTGTCAG.

[0042] Real-time PCR reaction conditions: pre-denaturation at 95°C for 5 minutes; then 40 cycles of incubation at 95°C for 10 seconds and 60°C for 10 seconds. The amplification reaction was performed on a real-time fluorescence quantitative PCR instrument LightCyler480. The β-actin internal reference was amplified while amplifying the target gene, and the relative expression of the gene was calculated by the 2-△△CT method.

[0043] Take different samples and repeat 110 times, each sample is repeated three times, the results are as follows Figure 1 shown.

[0044] Depend on Figure 1 It is known that in Figure 1 Among the 110 pairs of tissues, the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 was significantly upregulated in colorectal cancer tissues (7.804±0.356) compared with colorectal cancer adjacent tissues, which was upregulated by more than 7 times.

[0045] (4) ROC curve analysis

[0046] The △CT values ​​in colorectal cancer tissues and adjacent normal control tissues were obtained by fluorescence quantitative PCR, and the ROC curve was drawn. Figure 2 As shown, the area under the curve AUC is 0.974, indicating that the detection target can be used as a specific marker for detecting the LncRNA, and the detection sensitivity and specificity can reach more than 90%.

[0047] Those skilled in the art know that the area under the ROC curve is between 1.0 and 0.5. When AUC>0.5, the closer the AUC is to 1, the better the diagnostic effect. AUC has a lower accuracy when it is 0.5-0.7, a certain accuracy when it is 0.7-0.9, and a higher accuracy when it is above 0.9. This value is greater than 0.9, which means that the detection target can be used as a specific marker for this detection.

[0048] Example 2

[0049] Example 2 of the present invention detected the expression of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 in colorectal cancer cancer cell lines HT29, HCT116 and SW620, and the specific steps were as follows:

[0050] (1) Cell culture: After morphologically normal colorectal cancer cells HT29, HCT116, SW620 and normal colon epithelial cells NCM460 were cultured to an appropriate density (80-90%), the culture medium was discarded and 2 mL of room temperature PBS buffer was added for washing once; 1 mL of trypsin was added to each bottle to digest the adherent cells; when the cells began to disperse, complete culture medium was used to terminate the digestion, and the cells were transferred to a centrifuge tube and centrifuged for 5 min (at a speed of 1000 rpm); the supernatant was discarded and complete culture medium was added for subculture.

[0051] (2) Collecting cells: Digest the cells with good growth status and a cell density of 80% with trypsin for 3 min (1 mL / bottle), then add complete culture medium to terminate digestion, mix well and transfer to a 15 mL centrifuge tube and centrifuge for 5 min (1000 rpm), discard the supernatant and wash once with PBS, collect the cell pellet and add Trizol reagent.

[0052] (3) RNA extraction: The cell precipitate obtained in step (2) was lysed with Trizol reagent and then extracted with chloroform to extract RNA from total cells in the same manner as the total RNA extraction method in Example 1.

[0053] (4) cDNA synthesis: The RNA extracted in step (3) is used to synthesize cDNA using a reverse transcription kit, and the method is the same as the reverse transcription cDNA synthesis method in Example 1.

[0054] (5) Quantitative PCR detection: Using the cDNA synthesized in step (4) as a template, using the upstream primer (SEQ ID NO.2) and downstream primer (SEQ ID NO.3) of LncRNA MSTRG.40707.1, quantitative PCR amplification was performed using TB Green reagent, and the amplification method and conditions were the same as those in the PCR amplification reaction in Example 1.

[0055] HT29, HCT116, SW620 and normal colon epithelial NCM460 cell samples were taken respectively, and each sample was repeated three times. The results are shown in Figure 3 shown.

[0056] Depend on Figure 3 It can be seen that compared with the normal control group cells, the LncRNA diagnostic marker LncRNAMSTRG.40707.1 in colorectal cancer cells was significantly upregulated in all three colorectal cancer cells.

[0057] Example 3

[0058] Example 3 of the present invention detects the effect of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 on the proliferation of colorectal cancer cells HCT116 by knocking down and overexpressing the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1. The specific method is as follows:

[0059] (1) Based on the sequence information of LncRNA MSTRG.40707.1 (SEQ ID NO.1), its interference sequence (SEQ ID NO.4, synthesized by Jima Biotech Co., Ltd. (Shanghai)) was designed and synthesized. The overexpression vector was constructed by Hanheng Biotech Co., Ltd. The vector structure framework was PGMLV-CMV-MCS-EF1-ZsGreen1-T2A-Puro, see vector structure Figure 6 .

[0060] SEQ ID NO.4: GGCUCUUAUCACUUCAGAAUAAtt.

[0061] (2) Cell culture: Normally growing colon cancer cells HCT116 were inoculated into 96-well plates at a density of 30%. After overnight culture, plasmid transfection was performed when the cell growth exceeded 50%.

[0062] (3) Plasmid transfection: The synthetic LncRNA MSTRG.40707.1 interference sequence and overexpression vector were taken at a working concentration of 10 ng / μL, and Lipo 3000 was added as a transfection reagent (Lipo3000 and P3000 were prepared in a 1:1 ratio, 1 μL was added to each well, and 25 μL of opti-MEM was added to each well).

[0063] (4) Detect the OD value at 450 nm at 0 h, 24 h, 48 h and 72 h after transfection. Repeat the test three times for each sample and calculate the results. Figure 4 shown.

[0064] Depend on Figure 4 It can be seen that knockdown of the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 inhibits the proliferation of colorectal cancer cells HCT116, while overexpression promotes the proliferation of colorectal cancer cells HCT116.

[0065] Example 4

[0066] Example 4 of the present invention uses a colorectal cancer diagnosis kit to detect colorectal cancer tissue, and the specific method is:

[0067] (1) Extraction of total RNA:

[0068] A. Take 50 mg of CRC tissue sample and adjacent tissue sample respectively, place them in a sterile enzyme-free mortar, add liquid nitrogen and grind until the tissue blocks are completely broken, then add 1 mL of TRIZOL reagent. Add TRIZOL directly to the cell sample and mix with a pipette until the precipitate completely disappears.

[0069] B. Mix the ground CRC tissue and paracancerous tissue with TRIZOL solution respectively, and transfer the mixture to a 2 mL sterile enzyme-free centrifuge tube. Let it stand at room temperature for 10 min to allow the CRC tissue and paracancerous tissue to be fully mixed with TRIZOL reagent.

[0070] C. Continue to add chloroform (add 200 μL chloroform per mL TRIZOL), gently shake the centrifuge tube to fully mix the chloroform and TRIZOL, and let it stand for 5 minutes. After centrifugation at 3000 rpm for 15 minutes, collect the upper transparent layer and gently transfer the upper transparent liquid to a new sterile nuclease-free centrifuge tube. Avoid mixing the middle and lower sediments in this process.

[0071] D. Add isopropanol solution (1:1 with transparent liquid) to the centrifuge tube, mix well and centrifuge, discard the supernatant. Wash the precipitate with 75% ethanol (1 mL / tube), shake and mix well and centrifuge (4°C, 7500 rpm, 5 min), discard the ethanol and place on dry absorbent paper or in a ventilated place to allow the RNA to dry naturally at room temperature.

[0072] E. RNA dissolution and storage: Add an appropriate amount of RNase-free water and place in a 65℃ metal bath to fully dissolve the RNA for 5 minutes, mix well and place on ice. Determine the concentration of the dissolved RNA and then dispense it into sterile enzyme-free centrifuge tubes, or store it in a -80℃ refrigerator, or directly perform reverse transcription for subsequent experiments.

[0073] (2) Colorectal cancer detection:

[0074] Take the total RNA from step (1) and amplify it according to the following RT-qPCR system or procedure:

[0075] RT-qPCR reaction system:

[0076] 2×Mix 10μL, RNA sample 1μL (concentration 500ng / μL), where Mix is ​​reverse transcription polymerase Mix and TBGreen Mix mixed in a 1:1 ratio, then add Random Primer (final concentration 1μM), LncRNA MSTRG.40707.1 primer pair (final concentration 10μM), β-actin primer (final concentration 10μM), stabilizer accounts for 20%, ammonia-ammonium chloride buffer is adjusted to pH 8.0, and ddH2O is supplemented to 20μL.

[0077] Random Primer is a random sequence consisting of 6-10 nucleotides, synthesized by bioengineering.

[0078] β-actin primer sequence:

[0079] Upstream (SEQ ID NO. 5): 5′-CACCATTGGCAATGAGCGGTTCC-3′;

[0080] Downstream (SEQ ID NO. 6): 5'-AGGTCTTTGCGGATGTCCACGT-3'.

[0081] Reaction procedure:

[0082] 37°C for 15 minutes, pre-denaturation at 95°C for 5 minutes; then, perform 40 cycles of incubation at 95°C for 10 seconds and at 60°C for 10 seconds.

[0083] The CT values ​​of LncRNA MSTRG.40707.1 in 10 colorectal cancer tissue specimens and adjacent adjacent cancer control specimens were tested. Each sample was repeated 3 times, using 2 -△△CT The calculation result is as follows Figure 5 shown.

[0084] Depend on Figure 5 It can be seen that the one-step kit is used to detect the expression of LncRNA MSTRG.40707.1 in colorectal cancer tissues, and the test results are relatively stable, which is consistent with the test results in Example 1, that is, the expression of LncRNA MSTRG.40707.1 in colorectal cancer is upregulated compared with the adjacent cancer control group (7.53±1.23). Compared with the traditional method in Example 1, the advantage of the one-step detection kit is that the experiments after obtaining RNA are carried out under closed conditions, avoiding cumbersome operations and possible contamination, and the test results are equivalent to those in Example 1.

[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A colorectal cancer LncRNA diagnostic marker LncRNAMSTRG.40707.1, characterized in that: The sequence of the colorectal cancer LncRNA diagnostic marker is shown in SEQ ID NO.

1.

2. A primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 according to claim 1, characterized in that: The primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNAMSTRG.40707.1 includes an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.

3.

3. A colorectal cancer diagnostic kit, characterized in that: The colorectal cancer diagnostic kit consists of 10 μM / μL of the primer pair for amplifying the colorectal cancer LncRNA diagnostic marker LncRNA MSTRG.40707.1 according to claim 2, TB GreenMix, reverse transcription polymerase Mix, a stabilizer, and an ammonia-ammonium chloride buffer.

4. A colorectal cancer diagnosis kit according to claim 3, characterized in that: The composition of the TB Green Mix is: 100 μM dNTP, 2 mM MgCl2, 100 nM fluorescent probe, 100 U / μL Taq DNA polymerase; the composition of the reverse transcriptase polymerase Mix is: 100 U / μL reverse transcriptase, 30 U / μL RNase inhibitor.

5. Use of the colorectal cancer diagnosis kit according to claim 3 or 4 in the preparation of a product for early diagnosis of colorectal cancer.

Images