Molecular markers associated with growth traits in goat FSHB gene and their application

Abstract

The present invention belongs to the technical field of molecular marker-assisted selection of goats, and specifically relates to a molecular marker associated with growth traits in the FSHB gene of goats and its application. The molecular marker is located at g.21921903C>T on chromosome 15 in the goat genome CaprahircusARS1.2, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The mutation site is at the 34th base in the sequence. The SNP site mutation of the present invention can significantly affect the growth traits of goats, and provides a new molecular marker for goat growth trait detection or molecular marker-assisted breeding. The present invention also provides a SNP detection material associated with goat growth traits, including related primers and a kit. The present invention provides a new method for marker-assisted selection of goats, and the detection method has a high detection rate and is time-saving.

Description

Technical Field

[0001] The invention belongs to the technical field of goat molecular marker assisted selection, and particularly relates to a molecular marker associated with growth traits in a goat FSHB gene and an application thereof. Background Art

[0002] my country is not only a major producer and consumer of sheep products, but also a major exporter of wool and cashmere products. The number of sheep on hand, the number of sheep slaughtered, the meat production and the cashmere production all rank first in the world. According to the "National List of Livestock and Poultry Genetic Resources Varieties", there are 78 local goat breeds in my country. Growth traits such as weight and body size are important economic traits that affect the goat industry, especially cashmere and meat sheep. Compared with foreign excellent breeds, although my country's local germplasm resources have advantages such as higher reproductive performance, tolerance to roughage, and strong adaptability, they are relatively lagging behind in growth performance such as meat production and body size. Since most growth traits in animals are quantitative traits with low heritability, the improvement work cycle of traditional breeding is long and difficult, and it is difficult to improve these traits quickly and effectively. Molecular breeding combines modern molecular biological detection methods with statistical analysis to find molecular markers that are closely linked to the target trait phenotype, so as to achieve the purpose of selecting excellent traits more simply, efficiently and accurately in breeding work. It has the characteristics of being fast, accurate and not affected by environmental conditions.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by single nucleotide variation at the genome level. It includes base transversion, conversion, insertion and deletion. When SNP is located in the coding region, it mainly affects the phenotype of livestock by affecting the expression products of transcription and translation; when SNP is located in the non-coding region, it may regulate gene expression by affecting regulatory sequences. SNP is a genetic polymorphism marker that is widely distributed on the genome, exists in large numbers and has a high marker density. It also has the characteristics of high genetic stability, good reproducibility and accuracy of genetic analysis, and easy to combine sequencing for rapid and high-throughput genotyping. Applying SNP to MAS (marker assisted selection) breeding is also an important direction of livestock genetic breeding.

[0004] Follicle stimulating hormone beta subunit (FSHB) is one of the two subunits of follicle stimulating hormone and the main dependent of follicle stimulating hormone in its biological function. In mammals, the formation and development of follicles are closely related to FSHB. FSHB can affect the number of follicles, stimulate follicle maturation, and induce ovulation. Research on FSHB mainly focuses on its impact on animal reproductive performance, but there is no research on goat FSHB gene as a molecular marker for growth traits. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a molecular marker in a goat FSHB gene in detecting goat growth traits, which can assist in breeding goats with excellent growth traits.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides an application of a molecular marker in a goat FSHB gene in detecting goat growth traits, wherein the molecular marker is a C>T base mutation at a g.21921903 site in the goat genome ARS1.2.

[0008] The present invention provides an application of a molecular marker in a goat FSHB gene in detecting goat growth traits, wherein the molecular marker is a C>T base mutation at the 34 bp position of the 5' end of a sequence shown in SEQ ID NO: 1 in the goat genome.

[0009] The present invention also provides a method for detecting growth traits of goats, which detects the base type at the g.21921903 site in the goat genome ARS1.2 or the 34th bp in the sequence shown in SEQ ID NO:1. The March weight, March body height, March body oblique length and March chest circumference of goats with TT genotype are all higher than those of CC genotype and CT genotype.

[0010] The present invention also provides a substance for detecting single nucleotide polymorphism of a goat SNP site, including a PCR primer for amplifying a genomic DNA fragment including the SNP site or a kit containing the primer.

[0011] The present invention also provides a molecular marker associated with goat growth traits in the FSHB gene, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a C>T base mutation at the 34th bp in the SEQ ID NO.1.

[0012] The above-mentioned substance for detecting single nucleotide polymorphism of goat SNP site or molecular marker associated with goat growth traits is used in goat genetic breeding, and the genetic breeding is to improve the growth traits of offspring goats.

[0013] The present invention provides a genetic breeding method for improving the growth traits of goats, determining the single nucleotide polymorphism of the above-mentioned SNP site of the breeding goats in the core group of goats, and making corresponding selections according to the single nucleotide polymorphism of the SNP site of the goats: the breeding of the breeding goats selects the individuals whose base at the 34th bp in the sequence shown in SEQ ID NO.1 is TT type, and eliminates the CC type and CT type individuals. The method can increase the frequency of the gene T at the site generation by generation, thereby improving the three-month weight, three-month body height, three-month body oblique length and three-month chest circumference performance of the offspring goats.

[0014] Preferably, the goat growth traits are goat weight in March, body height in March, body oblique length in March and chest circumference in March.

[0015] Beneficial effects of the present invention:

[0016] The present invention discovers a molecular marker associated with growth traits in the FSHB gene of goats, wherein the molecular marker contains a SNP site of g.21921903C>T; and the haplotype composed of the SNP site can be used as a molecular marker for growth traits of goats.

[0017] The present invention verifies the effects of the above-mentioned SNP molecular markers on the goat's March weight, March body height, March body oblique length and March chest circumference, and can be applied to the genetic improvement of breeding sheep to improve their growth performance, thereby improving the growth performance of offspring and further increasing the market competitiveness of breeding enterprises.

[0018] The present invention provides a new molecular marker for molecular marker-assisted breeding of goat growth traits, realizes early selection of goat growth traits and shortens the breeding process; the detection method is fast and accurate and is not affected by breeding environment conditions. DETAILED DESCRIPTION

[0019] The present invention provides an application of a molecular marker in a goat FSHB gene in detecting growth traits of goats.

[0020] The present invention performs whole genome resequencing on goat genomic DNA and analyzes the correlation between the locus of the FSHB gene and the growth trait to obtain a molecular marker g.21921903C>T associated with the growth trait, which is located on chromosome 15 of the goat genome Capra hircus ARS1.2.

[0021] The embodiment of the present invention performs whole genome resequencing on 500 black-headed goats (the offspring of Macheng black goats and Boer goats), of which 466 are sequenced at a low depth of 1X and 34 are sequenced at a high depth of 15X, with the purpose of using high-depth sequencing results (less) to perform genotype filling on low-depth sequencing results (more) to reduce sequencing costs. Then, the resequencing data is compared with the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy is used to detect genetic variations and fill genotypes on all autosomes of the 500 samples to obtain all SNP sites on the FSHB gene. Finally, the SNP sites are associated with March weight, March body height, March body oblique length, and March chest circumference, and molecular markers significantly associated with goat growth traits are screened: g.21921903C>T.

[0022] g. Molecular marker of 21921903C>T site: The nucleotide sequence of this fragment is shown in SEQ ID NO:1, and there is a C>T base mutation at the 34th bp in the sequence;

[0023] CGTCGACAGATGCCTTTTCAGAGTCGTAGGTGTNAATGGTTCACCACTCAATGAAGACGTTAAGCGTCTAAAAATTCCTAGATCTCTTGTTTAAATCTCGAAAAATTGAAGATAGTATATCCCTTAGACACGAAAAGTTGGACCGAAGAATTTATGTGACATTAGTTACAATCGTTC (SEQ ID NO. 1).

[0024] The results of GWAS analysis showed that the molecular marker of the g.21921903C>T locus was significantly correlated with the growth traits of goats. The March weight, March body height, March body length and March chest circumference of individuals with genotype TT were significantly higher than those of individuals with CC and CT genotypes, indicating that T is an allele that is beneficial to the improvement of growth traits and is of great significance to goat breeding.

[0025] The molecular markers screened by the present invention can be applied to the genotype of genes related to goat growth traits or the association analysis related to goat growth traits, providing a new molecular marker resource for molecular marker-assisted selection of goat growth traits.

[0026] The present invention does not limit the breed of goats, and preferably the goat breeds include Dongbao black-headed goats, Macheng black goats, Boer goats, Yichang white goats and Matou goats.

[0027] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention. Example 1

[0028] Goat whole genome resequencing

[0029] 1. Blood Collection and Leukocyte Separation

[0030] Collect 5 mL of goat venous blood in an EDTA anticoagulant tube, place the anticoagulant tube in an ice box with ice packs, bring it back to the laboratory and store it in a 4°C refrigerator, and extract white blood cells. The specific steps are as follows:

[0031] (1) Take 2 mL of blood into a 10 mL centrifuge tube;

[0032] (2) Add ultrapure water to the 9-10 mL mark, invert 20 times, and let stand for 10 minutes;

[0033] (3) Place the centrifuge tube in a centrifuge and centrifuge at 5000 rpm for 10 min. Discard the supernatant (try to pour out the supernatant as much as possible and do not pour out the white blood cells at the bottom);

[0034] (4) Repeat steps (2) and (3);

[0035] (5) Store the separated white blood cells in a -80℃ refrigerator for future use.

[0036] 2. Genomic DNA Extraction and Whole-Genome Resequencing

[0037] The blood / cell genomic DNA kit (Beijing Tianmo Technology Development Co., Ltd.) was used to extract DNA from leukocytes. The specific method is described in the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Novogene Technology Co., Ltd. for secondary quality inspection and library construction, and the whole genome resequencing of PE150 was performed on the BGI platform. The original data was obtained in FASTQ format. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of approximately 19.72X and a total data size of 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of approximately 1.65X and a total data size of 1.6T. Example 2

[0038] Genome alignment, genetic variation detection, and genotype filling

[0039] 1. Raw sequencing data analysis and genome alignment

[0040] The high-depth sequencing data and low-depth sequencing data were quality controlled using the same process.

[0041] (1) Use Fastp software to filter the raw data. The filtering criteria are as follows: remove reads with a base quality value lower than 20 and a ratio of more than 30%; remove reads with n bases greater than 5%. After quality control in the above steps, clean reads are obtained.

[0042] (2) Use BWA software to align clean reads to the goat reference genome Capra_hircus.ARS1.2).

[0043] (3) Use Samtools software to sort the aligned BAM files.

[0044] (4) Use Picard to mark duplicate reads.

[0045] (5) Samtools software builds the index.

[0046] 2. Detection of variant sites and filling of genotypes

[0047] (1) CTTKHaploytypeCaller generates a gvcf file for each sample according to the autosome number.

[0048] (2) CTTKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0049] (3) CTTKGenotypeGVCFs performs population SNP calling by chromosome.

[0050] (4) CTTKMergeVcfs merges autosomal population vcf files.

[0051] (5) CTTKSelectVariants screens SNPs in the population vcf file.

[0052] (6) CTTKVariantFiltration marks false positive SNP sites.

[0053] (7) Use the grep command to filter the marked SNP sites.

[0054] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0055] (9) Beagle software was used to fill in missing sites.

[0056] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and type genetic variations in population genomes.

[0057] (11) Beagle was used for genotype filling, and 26,131,221 high-quality SNPs were finally obtained. Example 3

[0058] Detection of polymorphic distribution of molecular markers of the present invention in goat populations

[0059] The genotype frequency and allele frequency of the SNP loci of the FSHB gene after typing in black-headed sheep were calculated. The specific formula and method are as follows:

[0060] Genotype frequency = number of individuals with the genotype / total number of samples in the test population;

[0061] Allele frequency = homozygous genotype frequency of the allele + heterozygous genotype frequency of the gene / 2.

[0062] SPSS software was used to perform differential analysis on the distribution of different genotypes at SNP sites. Hardy-Weinberg equilibrium is an ideal situation in which a population (not affected by specific interference factors, such as non-random mating, selection, migration, mutation or limited population size) has a constant gene frequency and a stable equilibrium state after many generations.

[0063] p² represents the frequency of homozygous alleles (such as Y), q2 represents the frequency of homozygous alleles (such as y), and 2pq represents the frequency of heterozygotes (such as Yy). If a population reaches genetic equilibrium, its genotype frequency should meet 2 (p + q) = p² + 2p2q2 + q2 = 1. Based on the theoretical value, the actual value can be calculated to perform a chi-square test to determine whether each gene in the population is in Hardy-Weinberg equilibrium:

[0064] χ2 =∑(Oi-Ei)² / Ei

[0065] Among them, O represents the observed value of gene frequency, E represents the expected value of gene frequency, and χ2 is the obtained chi-square test value. Compare the calculated chi-square value with the corresponding chi-square table. If the p-value range is greater than 0.05, it means that this site conforms to the Hardy-Weinberg equilibrium. If it is less than 0.05, this site deviates from the Hardy-Weinberg equilibrium.

[0066] The test results are shown in Table 1: The SNP loci showed three genotypes in the goat population, g.21921903C>T was dominated by homozygous CC, and allele T was the dominant allele. And the chi-square test found that this polymorphic locus did not conform to the Hardy-Weinberg law (P>0.05).

[0067] Table 1 Genetic information parameters of FSHB gene SNPs in goat population

[0068] Example 4

[0069] Association analysis and application of molecular markers and growth traits of the present invention

[0070] In order to determine the association analysis between the FSHB gene g.21921903C>T locus and goat growth traits, the SAS self-programming language was used to calculate the fixed linear model. The fixed effects of subsequent analysis were determined by multivariate regression and analysis of variance on the traits. Several models with all possible combinations of fixed effects were tested, and the significance of each effect was systematically evaluated, and each non-significant effect was removed from the model in a step-by-step manner. The final model is as follows:

[0071] Yikjlm=μ+Ii+Ak+Bj+Cl+Dm+Eikjlm

[0072] Y is the trait value, I is the genotype fixed effect, A is the ram fixed effect, B is the litter fixed effect, C is the sex fixed effect, D is the animal random effect, μ is the mean of a single trait, and E is the random error.

[0073] (3) Additive dominant effect value SAS statistical software was used to analyze the genetic effect of genotype on ewe growth traits using linear models, and the GLM program was used to analyze the association between markers and traits. The statistical model for gene effect analysis: except for the individual ewe as a random effect, all other factors were fixed effects. The model used is as follows:

[0074] Model 1: Y = overall mean + genotype + farm environment effect + residual

[0075] Model 2: Y = overall mean + additive effect + dominant effect + farm environment effect + residual

[0076] Among them, Y is the phenotypic value of the trait, additive effect = (homozygous 1-homozygous 2) / 2, with 1, 0, and -1 representing homozygous 1, heterozygous, and homozygous 2 respectively; dominant effect = heterozygous - (homozygous 1+homozygous 2) / 2, with 1, -1, and 1 representing homozygous 1, heterozygous, and homozygous 2 respectively.

[0077] The statistical analysis results are shown in Table 2: The weight, height, body length and chest circumference of the TT genotype in the g.21921903C>T locus in March were significantly higher than those of the CC genotype and TC genotype (P<0.05). The results show that screening ewes with the TT genotype in the g.21921903C>T locus can improve the growth traits of goats.

[0078] Table 2 Association analysis between FSHB gene polymorphisms and goat growth traits

[0079]

[0080]

[0081]

[0082]

[0083] Note: The values ​​in the table are expressed as mean ± standard error. Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences (P>0.05).

[0084] It can be seen from the above examples that the goat FSHB gene g.21921903C>T site described in the present invention can be used as a new molecular marker for genetic improvement of goat growth traits, can be used to detect goat growth traits, and is helpful for the screening of excellent growth traits.

[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of a reagent for detecting molecular markers in the FSHB gene of black-headed goats in detecting growth traits of black-headed goats, characterized in that: The molecular marker is a C>T base mutation at the g.21921903 site in the ARS1.2 of the black-headed goat genome, or a C>T base mutation at the 34 bp at the 5' end of the sequence shown in SEQ ID NO.1; the growth traits of the black-headed goat are the black-headed goat's weight in March, body height in March, body oblique length in March and chest circumference in March; the black-headed goat's weight in March, body height in March, body oblique length in March and chest circumference in March of the TT genotype of the molecular marker are all higher than those of the CC genotype and the CT genotype.

2. A method for detecting growth traits of goats, characterized in that: The base type at the g.21921903 site in the ARS1.2 of the goat genome or at the 34th bp in the sequence shown in SEQ ID NO.1 was detected. The March weight, March body height, March body oblique length and March chest circumference of the TT genotype goats were all higher than those of the CC genotype and CT genotype goats; the goats were black-headed goats.

3. Application of a reagent for detecting molecular markers in the FSHB gene of black-headed goats in genetic breeding of black-headed goats, characterized in that: The genetic breeding is to improve the growth traits of offspring black-headed goats; the molecular marker is a C>T base mutation at the g.21921903 site in the ARS1.2 of the black-headed goat genome, or a C>T base mutation at the 34 bp at the 5' end of the sequence shown in SEQ ID NO.1; The growth traits of the offspring black-headed goats are the black-headed goats' weight in March, body height in March, body oblique length in March and chest circumference in March; the black-headed goats with the C>T base mutation at the g.21921903 site in the ARS1.2 of the black-headed goat genome or the C>T base mutation at the 34 bp at the 5' end of the sequence shown in SEQ ID NO.1 are selected to be TT-type black-headed goats, and the black-headed goats with CC genotype and CT genotype are eliminated.

4. A genetic breeding method for improving goat growth traits, characterized in that: Make corresponding selections based on the SNP sites of goats: for the successive breeding of breeding goats, select individuals with TT type base at the g.21921903 site in the ARS1.2 of the black-headed goat genome or at the 34th bp in the sequence shown in SEQ ID NO.1, and eliminate CC type and CT type individuals; the growth traits of the goats are the goat's weight in March, body height in March, body oblique length in March and chest circumference in March; the goats are black-headed goats.

Images