Bordetella pertussis nucleic acid detection kit
By using primer and probe combinations targeting the ptxP and IS481 gene fragments and employing real-time quantitative PCR, the sensitivity and specificity issues in the detection of Bordetella pertussis have been resolved, enabling rapid and accurate detection of Bordetella pertussis, suitable for disease screening and clinical diagnosis.
Patent Information
- Application Number
- CN202411401073.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-09
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-10-09
AI Technical Summary
Existing technologies for detecting Bordetella pertussis suffer from low sensitivity and poor specificity, easily leading to false positives and making it difficult to make rapid and accurate diagnoses in the early stages of the disease.
A primer-probe combination targeting the ptxP and IS481 gene fragments was used, with β-globin as an internal reference gene, and detection was performed using real-time quantitative PCR. Specific fluorescent groups and quenching groups were used for signal detection.
It achieves high sensitivity and specificity for the detection of Bordetella pertussis, with a detection limit of 1.0 CFU/mL, shortening the detection time, avoiding false positive results, and is suitable for disease screening and clinical diagnosis.
Smart Images

Figure BDA0005075283780000051 
Figure BDA0005075283780000061 
Figure BDA0005075283780000062
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to a nucleic acid detection kit for Bordetella pertussis. Background Technology
[0002] Pertussis is a severe acute respiratory infectious disease caused by Bordetella pertussis. Currently, bacteriological, serological, and PCR techniques are mainly used to detect Bordetella pertussis.
[0003] Bacteriological testing methods are time-consuming and have low sensitivity (only 12%–60%), affected by patient age, vaccination status, and disease course. Serological testing is not sensitive within two weeks of onset, easily leading to missed diagnoses and missed optimal treatment periods, and is not suitable for infants (with maternal antibodies) or those vaccinated against pertussis within one year. Furthermore, isolating and culturing Bordetella pertussis is difficult and time-consuming, all of which contribute to the limited clinical application of these two methods. Besides Bordetella pertussis infection, Bordetella parapertussis, Bordetella bronchiseptica, and Bordetella cholerae can all cause spasmodic cough, similar to pertussis symptoms, making differentiation difficult. Nucleic acid amplification methods are quick, sensitive, and specific, enabling rapid diagnosis of pertussis in the early stages of the disease, and have become the best laboratory diagnostic method.
[0004] The target gene sequence for Bordetella pertussis, widely used both domestically and internationally for diagnosis, is the IS481 (insertion sequence). This gene exists in 50–238 copies within the pathogen and exhibits extremely high detection sensitivity. However, this target gene is also present in both Bordetella bronchiseptica and Bordetella hominis, easily leading to false positives and misdiagnosis. Therefore, a sensitive and specific molecular diagnostic method is urgently needed for the differential diagnosis of Bordetella pertussis. Summary of the Invention
[0005] In view of this, the technical problem to be solved by the present invention is to provide a nucleic acid detection kit for Bordetella pertussis.
[0006] The present invention provides a primer-probe combination whose targeting fragment includes a ptxP gene fragment having a nucleotide sequence as shown in SEQ ID NO:27.
[0007] Furthermore, the targeting fragment also includes the IS481 gene fragment, which has the nucleotide sequence shown in SEQ ID NO:29.
[0008] The present invention has screened and optimized the target region of the primer-probe combination;
[0009] In embodiments of the present invention, the screening of gene combinations targeting fragments and the screening of specific gene-targeting fragments are included. In a specific embodiment of the present invention, the targeting fragments were screened, and the results showed that using the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:27 to detect pertussis has high detection sensitivity and a detection limit of 1.0 CFU / mL. Other targeting fragments targeting the ptxP gene have low sensitivity and poor detection specificity. Combining the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:27 with the IS481 gene fragment shown in SEQ ID NO:29 as a targeting fragment results in more accurate detection, lower false positives, and more stable detection results compared to combinations of other gene segments as targeting fragments.
[0010] This invention combines the IS481 gene fragment shown in SEQ ID NO:29 and the ptxP gene fragment shown in SEQ ID NO:27 as target regions for the detection of pertussis, resulting in highly specific and accurate detection results.
[0011] Furthermore,
[0012] The primer-probe combination described in this invention includes a primer-probe combination targeting the ptxP gene fragment and / or a primer-probe combination targeting the IS481 gene fragment.
[0013] The primer-probe combination targeting the ptxP gene fragment (SEQ ID NO:27) includes an upstream primer with the nucleotide sequence shown in SEQ ID NO:7, a downstream primer with the nucleotide sequence shown in SEQ ID NO:8, and a probe with the nucleotide sequence shown in SEQ ID NO:9.
[0014] The primer-probe combination targeting the IS481 gene fragment (SEQ ID NO:29) includes an upstream primer with the nucleotide sequence shown in SEQ ID NO:13, a downstream primer with the nucleotide sequence shown in SEQ ID NO:14, and a probe with the nucleotide sequence shown in SEQ ID NO:15.
[0015] In a specific embodiment of the present invention, β-globin is used as an internal reference gene, and the primer-probe combination of the present invention further includes a primer set and probe targeting the internal reference gene;
[0016] The primer set and probe for targeting the internal reference gene include: an upstream primer with a nucleotide sequence as shown in SEQ ID NO:32, a downstream primer with a nucleotide sequence as shown in SEQ ID NO:33, and a probe with a nucleotide sequence as shown in SEQ ID NO:34.
[0017] Furthermore,
[0018] In the aforementioned primer-probe combination,
[0019] Each probe has a fluorescent group coupled at its 5' end and a fluorescence quencher group coupled at its 3' end.
[0020] The fluorescent group is selected from any one of FAM, HEX, VIC, CY5 or ROX;
[0021] The fluorescence quenching group is selected from any one of BHQ1, MGB, MGB, BHQ2 or TAMRA.
[0022] This invention screened the primer-probe combinations. In some embodiments of this invention, an upstream primer targeting the IS481 gene fragment with the nucleotide sequence shown in SEQ ID NO:13, a downstream primer targeting the IS481 gene fragment with the nucleotide sequence shown in SEQ ID NO:14, and a probe targeting the IS481 gene fragment with the nucleotide sequence shown in SEQ ID NO:15 were used. Additionally, an upstream primer targeting the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:7, a downstream primer targeting the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:8, and a probe targeting the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:9 were used. Experimental results show that the primer-probe combinations described in this invention have better detection effects on clinically positive pertussis samples.
[0023] This invention provides the application of the aforementioned primer-probe combination in the preparation of pertussis detection products.
[0024] The present invention provides a kit for detecting pertussis, comprising at least one of PCR reaction solution 1 and / or PCR reaction solution 2 and the primer-probe combination described in the present invention.
[0025] Furthermore, the kit described in this invention also includes: template DNA, dNTPs, DNA polymerase, uracil glycosylase, positive reference, negative reference, or blank control.
[0026] In the reagent kit described in this invention,
[0027] The PCR reaction solution 1 comprises 1M-3M betaine, 1vt%-3vt% formamide, 10mM-20mM ammonium sulfate, 0.05vt%-0.2vt% Tween-20, 10mM-30mM tetramethylammonium chloride, and 8vt%-12vt% polyethylene glycol;
[0028] The PCR reaction solution 2 includes 2mM to 6mM magnesium chloride solution and 2mM to 6mM manganese acetate solution;
[0029] The concentration of the template DNA used is 10 ng / μL to 100 ng / μL;
[0030] The concentration of the dNTPs used is 0.02 mM to 0.06 mM;
[0031] The concentration of the DNA polymerase used is 0.1 U / μL to 0.3 U / μL;
[0032] The concentration of the uracil glycosylation enzyme used is 0.05 U / μL to 0.15 U / μL;
[0033] The concentration of the primers used is 0.6 μmol to 1 μmol.
[0034] The concentration of the probe used is 0.2 μmol to 0.6 μmol.
[0035] Furthermore,
[0036] In a specific embodiment of the present invention
[0037] The PCR reaction solution 1 comprises 2M betaine, 2vt% formamide, 15mM ammonium sulfate, 0.15vt% Tween-20, 20mM tetramethylammonium chloride and 10vt% polyethylene glycol; in a specific embodiment of the present invention, the amount of PCR reaction solution 1 added to the reaction system is 15μl / 50μl.
[0038] The PCR reaction solution 2 includes 4 mM magnesium chloride and 4 mM manganese acetate; in a specific embodiment of the present invention, the amount of PCR reaction solution 2 added to the reaction system is 15 μl / 50 μl.
[0039] The concentration of the template DNA used is 10 ng / μL to 100 ng / μL;
[0040] The concentration of the dNTPs used was 0.04 mM;
[0041] The concentration of the DNA polymerase used is 0.2 U / μL;
[0042] The concentration of the uracil glycosylation enzyme used is 0.1 U / μL.
[0043] The concentration of the primers used was 0.8 μmol / L;
[0044] The concentration of the probe used was 0.4 μmol / L.
[0045] The positive reference sample was a culture of Bordetella pertussis.
[0046] The negative reference material is a clinical sample negative for Bordetella pertussis.
[0047] The blank control was nuclease-free water.
[0048] This invention provides a method for detecting pertussis for non-diagnostic purposes, comprising detecting a sample using at least one of the following methods A) to B):
[0049] A) The primer-probe combination described in this invention;
[0050] B) The reagent kit described in this invention.
[0051] The non-diagnostic pertussis detection method of the present invention includes the following steps: after obtaining the nucleic acid of the sample, determining whether the patient has pertussis based on the detection results.
[0052] Furthermore,
[0053] The criteria for the determination are as follows:
[0054] If the Ct of the internal reference gene is ≤35 and the Ct of the ptxP gene is ≤38, it is determined to be positive for Bordetella pertussis.
[0055] Ct≤35 for the internal reference gene, Ct>38 or No CT for the ptxP gene, and Ct≤38 for the IS481 gene are judged as negative for Bordetella pertussis and positive for Bordetella hominis / Bordetella bronchiseptica.
[0056] If the Ct of the internal reference gene is ≤35, the Ct of the ptxP gene is >38 or No CT, and the Ct of the IS481 gene is >38 or No CT, it is determined to be negative for Bordetella pertussis / Bordetella hominis / Bordetella bronchiseptica.
[0057] If the internal reference gene has a Ct > 35 or no CT, the sample is invalid and resampling for testing is recommended.
[0058] The detection procedure is as follows: 50℃, 2 min; 95℃, 2 min; 95℃, 10 sec, 45 cycles; 60℃, 22 sec, collecting fluorescence signals.
[0059] Furthermore, the samples described in this invention include nasopharyngeal swabs, saliva, blood, nasopharyngeal / oropharyngeal saline solution or aspirate, deep cough sputum, bronchoalveolar lavage fluid, alveolar lavage fluid and / or deep throat saliva, etc., and this invention does not limit them;
[0060] The internal reference gene is a human endogenous substance (β-globin), so there is no need to perform internal reference nucleic acid extraction. The internal reference is included with the sample and no additional processing is required.
[0061] The non-diagnostic pertussis detection method described in this invention can be used for research purposes as a medium in the development of other pertussis detection reagents, kits, detection technologies and / or equipment. This invention does not limit its use in this regard.
[0062] This invention uses ptxP alone or in combination with IS481 to identify Bordetella pertussis, showing no cross-reactivity with pathogens causing pertussis-like symptoms. It also boasts advantages such as high sensitivity and specificity, completing PCR amplification in just 50 minutes, with a detection limit as low as 1 CFU / mL. Suitable for disease screening and clinical diagnosis, it can significantly shorten testing time, improve testing efficiency, and avoid false positive results, making it of great significance in disease monitoring, screening, clinical diagnosis, and symptomatic treatment. Attached Figure Description
[0063] Figure 1 The PCR amplification curves during ion concentration screening are shown.
[0064] Figure 2 Evaluation of the specificity of the reagent kit;
[0065] Figure 3 This demonstrates the stability evaluation of the reagent kit. Detailed Implementation
[0066] This invention provides a nucleic acid detection kit for Bordetella pertussis. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0067] Internal reference gene human β-globin target segment: cacctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggttacaagacaggtttaaggagaccaa tagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccacccttaggctgctggtggtctacccttggacccggaggttctttgagtcct(SEQ ID NO:31);
[0068] upstream primer for internal reference gene: gccctgggcaggttggtat (SEQ ID NO:32);
[0069] Downstream primer for internal reference gene: tctccacatgcccagttt (SEQ ID NO:33);
[0070] Internal reference gene probe: caggitttaaggagacca (SEQ ID NO:34);
[0071] Real-time quantitative PCR: A method for measuring the total amount of product after each polymerase chain reaction (PCR) cycle using fluorescent chemicals in DNA amplification reactions. It is a method for quantitative analysis of specific DNA sequences in the sample using internal or external controls.
[0072] Limit of detection: This kit can reliably detect the lowest concentration of a specific nucleic acid fragment in a sample with 95% accuracy.
[0073] Copy number: refers to the number of copies of a gene (which can be a plasmid) in the genome of an organism. A single copy means that there is only one copy of the gene in the organism's genome, while multiple copies mean that there are multiple copies.
[0074] CFU (colony forming units) refers to each colony formed on an agar plate after incubation at a certain temperature and time. It is a unit for counting the number of bacteria or fungi.
[0075] Serological testing: Serological reaction is performed between immune serum (diagnostic serum) containing known specific antibodies and antigens in isolated and cultured unknown pure bacteria or specimens to determine the species or type of pathogen.
[0076] Tm value: Melting temperature (Tm) refers to the temperature at which the absorbance increases to half of its maximum value. It is called the melting temperature or melting point of DNA.
[0077] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments:
[0078] Example 1: Target Segment Screening
[0079] All genomic sequences of Bordetella pertussis, Bordetella hominis, Bordetella parapertussis, and Bordetella bronchitidis were downloaded from GenBank. Multiple alignments were performed using MEGA6 software to identify differentially expressed regions in the genomes of these pathogens. The stable conserved regions IS481 and ptxP of the Bordetella pertussis genome were ultimately identified as target sequences. Specific primers and probes were designed targeting these conserved regions. During the design process, it was important to minimize the difference in Tm values between primers, with the probe's Tm value slightly higher than that of the primers. The GC content should be moderate, between 40% and 60%. The formation of secondary primer structures, primer interactions, and hairpin structures should be avoided as much as possible. Simultaneously, the primer pairs should be designed to eliminate cross-reactivity while ensuring sufficient specificity for primer amplification.
[0080] 1. Screening of the ptxP target region of Bordetella pertussis
[0081] Through gene sequence alignment and analysis, three relatively conserved ptxP target regions were screened out. Primers and probes were then designed for verification. The specific grouping is shown in Table 1.
[0082] To evaluate the specificity of the three target regions for detecting Bordetella pertussis, the three groups shown in Table 1 were used to detect Bordetella pertussis, Bordetella parapertussis, Bordetella hominis, and Bordetella bronchitidis, which are associated with human infection, respectively. The detection results are shown in Table 2.
[0083] The evaluation results in Table 2 show that target segment 1 and target segment 2 have cross-reactivity with Bordetella parapertussis and Bordetella bronchiseptica, while target segment 3 (SEQ ID NO:27) has no cross-reactivity with Bordetella parapertussis, Bordetella hominis, or Bordetella bronchiseptica, and its specificity is the best.
[0084] Table 1. Target sequence and primers / probes for PTXP
[0085]
[0086]
[0087] Table 2. Specificity of three target regions in ptxP for detecting Bordetella pertussis
[0088] experimental group Bordetella pertussis Bordetella parapertussis Bordetella hominis Bordetella bronchiseptica 1 ﹢ ﹢ - ﹢ 2 ﹢ ﹢ - ﹢ 3 ﹢ - - -
[0089] Note: "-" indicates a negative result for the pathogen; "+" indicates a positive result for the pathogen.
[0090] 2. Screening of the IS481 target region of Bordetella pertussis
[0091] By comparing and analyzing the genome sequences of Bordetella pertussis, Bordetella hominis, Bordetella parapertussis, and Bordetella bronchiseptica, as well as the IS481 gene sequence, three relatively conserved IS481 target regions were screened out. Primers and probes were then designed for verification. The specific groupings are shown in Table 3.
[0092] To evaluate the sensitivity of the three target regions for detecting Bordetella pertussis, a suspension of Bordetella pertussis at a known concentration (1×10⁻⁶) was prepared. 7 After diluting to 100 CFU / ml, 10 CFU / ml, 1 CFU / ml, 0.5 CFU / ml, and 0.25 CFU / ml respectively, the three sets of primers and probes shown in Table 3 were used for detection. The detection results are shown in Table 4.
[0093] The evaluation results in Table 4 show that the sensitivity of target segment 1 and target segment 3 in detecting Bordetella pertussis is lower than that of target segment 2. Target segment 2 (SEQ ID NO:29) has the smallest Ct value and the best sensitivity.
[0094] Table 3. IS481 target sequence and primers / probes
[0095]
[0096]
[0097] Table 4. Sensitivity of IS481 for detecting Bordetella pertussis in three target regions
[0098]
[0099] Example 2: Optimization of primers and probes for the target region
[0100] 1. Design and screening of primers and probes
[0101] Multiple primer-probe combinations were designed for both IS481 (SEQ ID NO:29) and ptxP (SEQ ID NO:27). Two representative combinations are shown in Table 5. The designed primers and probes were validated using clinically positive pertussis samples. The results are as follows:
[0102] Table 5. Primer and probe screening using IS481 and ptxP as target sequences for detection
[0103]
[0104]
[0105] The experiment involved multiple attempts. This table uses groups 1 and 2 as examples. The experimental results show that, compared with groups 2 and others, the primer and probe combination 1 of Bordetella pertussis IS481 and Bordetella pertussis ptxP combination 1 are more effective in detecting clinically positive samples of pertussis. Therefore, this kit selects the primer and probe combination 1 as the final solution.
[0106] 2. Sample processing and nucleic acid extraction
[0107] Add 1 mL of physiological saline to the collected nasopharyngeal swab sample, shake thoroughly to mix, take 200 μL of sample, and extract nucleic acid using the magnetic bead method (nucleic acid extraction and purification reagent of Zhengzhou Antu Bioengineering Co., Ltd., Yu Zheng Xie Bei 20180037).
[0108] 3. Prepare the reaction system
[0109] The extracted pertussis sclerosus clinical samples (containing internal standard genes, no additional addition) were amplified using a 50 μL reaction system. This included PCR reaction solution 1 (containing 2 M betaine, 2 vt% formamide, 15 mM ammonium sulfate, 0.15 vt% Tween-20, 20 mM tetramethylammonium chloride, and 10 vt% polyethylene glycol; all concentrations are for use), 0.04 mM dNTPs, 0.2 U / μL DNA polymerase, 0.1 U / μL uracil glycosylase, PCR reaction solution 2 (4 mM magnesium chloride solution and 4 mM manganese acetate solution; all concentrations are for use), primer concentrations of 0.8 μmol, probe concentrations of 0.4 μmol, and 15 μL of extracted nucleic acid. The remainder was brought to 50 μL with ddH2O. The above reagent components were added to PCR tubes and the following reaction was performed: Stage 1: 50℃, 2 min; Stage 2: 95℃, 2 min; Stage 3: 95℃, 10 sec; 60℃, 22 sec. The third stage consisted of 45 cycles, with fluorescence signals collected during the 60℃ stage. Finally, the results were interpreted by observing the fluorescence curves and Ct values generated during the reaction. The criteria for result interpretation were as follows:
[0110] If the Ct of the internal reference gene is ≤35 and the Ct of the ptxP gene is ≤38, it is determined to be positive for Bordetella pertussis.
[0111] Ct≤35 for the internal reference gene, Ct>38 or No CT for the ptxP gene, and Ct≤38 for the IS481 gene are judged as negative for Bordetella pertussis and positive for Bordetella hominis / Bordetella bronchiseptica.
[0112] If the Ct of the internal reference gene is ≤35, the Ct of the ptxP gene is >38 or No CT, and the Ct of the IS481 gene is >38 or No CT, it is determined to be negative for Bordetella pertussis / Bordetella hominis / Bordetella bronchiseptica.
[0113] If the internal reference gene has a Ct > 35 or no CT, the sample is invalid and resampling for testing is recommended.
[0114] The results are as follows Figure 1 As shown, this sample is positive for Bordetella pertussis.
[0115] Example 3: Optimization and Screening of PCR Reaction Solutions
[0116] 1. Screening of Tween-20 concentration in PCR reaction solution 1
[0117] Tween-20 is a nonionic surfactant that increases the stability of PCR reaction systems. It is widely used in PCR amplification systems by reducing surface tension, maintaining the homogeneity of the reaction solution, reducing DNA secondary structure, and protecting polymerase activity. This study screened different concentrations of Tween-20 to verify the effects of 0.05 VT%, 0.1 VT%, 0.15 VT%, and 0.2 VT% Tween-20 on PCR amplification efficiency. Four pertussis-positive samples and one negative sample were tested at different concentrations. The concentrations of positive clinical samples 1-4 were 1×10⁻⁴. 5 CFU / ml, 1×10 4 CFU / ml, 1×10 3 CFU / ml, 1×10 2 CFU / ml, each test was repeated 3 times. Positive samples were compared based on Ct values; a smaller Ct value indicates better amplification ability. The results are shown in Table 6.
[0118] Table 6. Screening and validation of different concentrations of Tween-20
[0119]
[0120] Validation results show that Tween-20 at concentrations ranging from 0.05% to 0.2% can accurately detect pertussis. Tween-20 at 0.15% showed the lowest Ct value, indicating the highest amplification efficiency, when detecting pertussis-positive samples.
[0121] 2. Screening of betaine concentration in PCR reaction solution 1
[0122] Betaine is a PCR enhancer suitable for amplifying templates with high GC content and complex secondary structures; however, excessive amounts can inhibit the PCR reaction. This study screened different concentrations of betaine to verify the effects of 1M, 2M, and 3M betaine on PCR amplification efficiency. Four pertussis-positive samples and one negative sample were tested at different concentrations. The concentrations of the positive clinical samples 1-4 were 1×10⁻⁴. 5CFU / ml, 1×10 4 CFU / ml, 1×10 3 CFU / ml, 1×10 2 CFU / ml, each test was repeated 3 times. Positive samples were compared based on Ct values; a smaller Ct value indicates better amplification ability. The results are shown in Table 7.
[0123] Table 7. Screening and validation of different concentrations of betaine
[0124]
[0125] The validation results showed that betaine concentrations from 1M to 3M could accurately detect pertussis. 2M betaine showed the lowest Ct value, indicating the highest amplification efficiency, when detecting pertussis-positive samples.
[0126] 3. Screening of ion concentrations in PCR reaction solution 2
[0127] The main component of PCR reaction solution 2 is Mn 2+ and Mg 2+ It was prepared by mixing in equal proportions. Experiments showed that compared to using Mg alone... 2+ Compared to PCR reaction solution 2, Mn 2+ and Mg 2+ Using equal proportions of Mn can increase the amplification height of this kit by about 20%; subsequently, equal proportions of Mn 2+ and Mg 2+ The effect of concentration on PCR reaction was investigated, comparing five levels of Mn: 2mM, 3mM, 4mM, 5mM, and 6mM. 2+ and Mg 2+ Concentrations were measured in four positive pertussis samples and one negative sample at different concentrations. The concentrations of the positive clinical samples (1-4) were 1×10⁻⁶. 5 CFU / ml, 1×10 4 CFU / ml, 1×10 3 CFU / ml, 1×10 2 CFU / ml, each test was repeated 3 times. A positive sample result should show a normal target Ct value, and a negative sample result should show a target NoCt value, which meets the expected requirements. Compare the Ct values of positive samples; a smaller Ct value indicates better amplification ability. The results are shown in Table 8.
[0128] Table 8 shows that the test results for both positive and negative samples of the five ion concentrations meet the requirements. Mn 2+ and Mg 2+ The overall mean Ct value was lowest at a concentration of 4 mM. Therefore, the Mn value of this kit was the lowest. 2+ and Mg 2+A PCR reaction solution of 4 mM was prepared by mixing the solutions in equal proportions.
[0129] Table 8. Ion Concentration Screening Results
[0130]
[0131]
[0132] Example 4: Reagent Kit Performance Evaluation
[0133] 1. Evaluation of reagent kit specificity
[0134] Table 9. Detection Specificity of the Kit
[0135] Pathogens concentration Judgment Result Bordetella pertussis <![CDATA[4.25×10 5 CFU / mL]]> Positive Bordetella hominis <![CDATA[3.6×10 7 CFU / mL]]> Negative Streptococcus pneumoniae <![CDATA[3.8×10 6 CFU / mL]]> Negative Bordetella parapertussis <![CDATA[8.0×10 7 CFU / mL]]> Negative Bordetella bronchiseptica <![CDATA[7.1×10 7 CFU / mL]]> Negative Influenza A virus <![CDATA[4.54×10 6 copies / mL]]> Negative Influenza B virus <![CDATA[4.59×10 6 copies / mL]]> Negative Mycoplasma pneumoniae <![CDATA[4.39×10 6 copies / mL]]> Negative Chlamydia pneumoniae <![CDATA[5.02×10 6 copies / mL]]> Negative Respiratory syncytial virus <![CDATA[6.22×10 6 copies / mL]]> Negative Parainfluenza virus <![CDATA[7.32×10 6 copies / mL]]> Negative Human metapneumovirus <![CDATA[3.67×10 6 copies / mL]]> Negative
[0136] To evaluate the detection specificity of the kit provided by this invention, a group of common respiratory pathogens causing symptoms such as cough were screened from clinical samples, including Mycoplasma pneumoniae, Chlamydia pneumoniae, Streptococcus pneumoniae, Influenza A virus, Influenza B virus, Respiratory syncytial virus, Parainfluenza virus, Human metapneumovirus, Bordetella pertussis, and Bordetella parapertussis, Bordetella cholerae, and Bordetella bronchiseptica (concentrations shown in Table 9). Nucleic acid was extracted from the above pathogens using the magnetic bead method, and the kit of this invention was used for detection. The results are as follows: Figure 2 As shown, only the Bordetella pertussis sample exhibited an amplification curve; all other pathogens showed no amplification or priming. Evaluation results indicate that this kit has excellent specificity and exhibits no cross-contamination or interference with common respiratory pathogens.
[0137] 2. Evaluation of reagent kit detection sensitivity
[0138] Bordetella pertussis isolated from pertussis-positive clinical samples was cultured and activated to prepare a bacterial suspension. After inactivation, colony counting was performed using a turbidimetric method. Subsequently, bacterial suspensions at concentrations of 100, 10, 1, 0.5, and 0.25 CFU / mL were prepared, and nucleic acids were extracted from these samples using a magnetic bead method. The extracted nucleic acids were then added to a PCR amplification system for reaction. The amplification results are shown in Table 10.
[0139] Table 10. Detection sensitivity of the kit
[0140]
[0141] Evaluation results show that the limit of detection for Bordetella pertussis in this kit is 1 CFU / mL.
[0142] 3. Evaluation of reagent kit stability
[0143] To evaluate the stability of the kit provided by this invention, the PCR reaction solution was placed in a 37°C incubator for 7, 14, and 21 days, and then pertussis-positive clinical samples were tested. The amplification curves were compared with those of untreated kits, as shown in the figure. Figure 3 As shown.
[0144] Evaluation results showed that the kit provided by this invention yielded negative results for all common respiratory pathogens; it also showed negative results for *Bordetella parapertussis*, *Bordetella cholerae*, and *Bordetella bronchiseptica*, which have high homology with *Bordetella pertussis*. These results demonstrate that the primers and probes used in the method established by this invention have high specificity and do not cross-react with other pathogens. Under storage conditions of 37°C, the kit could still detect *Bordetella pertussis* normally after 21 days of storage, exhibiting excellent stability.
[0145] This invention selects the ptxP gene fragment with the nucleotide sequence shown in SEQ ID NO:27 for the detection of pertussis, achieving high detection sensitivity with a detection limit of 1.0 CFU / mL. The ptxP gene fragment is combined with the IS481 gene fragment with the nucleotide sequence shown in SEQ ID NO:29, and the primer-probe combination and reagent components are optimized. The detection results show no cross-contamination with *Bordetella parapertussis*, *Bordetella bronchiseptica*, or *Bordetella hominis*, exhibiting extremely high specificity. This invention significantly improves the sensitivity and specificity of *Bordetella pertussis* detection while being simple to operate, low in cost, and requiring only 50 minutes to complete the detection. It is suitable for disease screening and clinical diagnosis, greatly shortening the detection time, improving detection efficiency, and avoiding false positive results. It has significant implications for disease monitoring, disease screening, clinical diagnosis, and symptomatic treatment.
[0146] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A primer probe combination, characterized in that The primer probe combination targeting the ptxP gene fragment comprises an upstream primer with the nucleotide sequence shown as SEQ ID NO: 7, a downstream primer with the nucleotide sequence shown as SEQ ID NO: 8, and a probe with the nucleotide sequence shown as SEQ ID NO:
9. The primer probe combination targeting the IS481 gene fragment comprises an upstream primer with the nucleotide sequence shown as SEQ ID NO: 13, a downstream primer with the nucleotide sequence shown as SEQ ID NO: 14, and a probe with the nucleotide sequence shown as SEQ ID NO:
15.
2. The primer probe combination of claim 1, wherein The primer probe combination targeting the IS481 gene fragment comprises an upstream primer with the nucleotide sequence shown as SEQ ID NO: 13, a downstream primer with the nucleotide sequence shown as SEQ ID NO: 14, and a probe with the nucleotide sequence shown as SEQ ID NO:
15. The primer probe combination targeting the IS481 gene fragment comprises an upstream primer with the nucleotide sequence shown as SEQ ID NO: 13, a downstream primer with the nucleotide sequence shown as SEQ ID NO: 14, and a probe with the nucleotide sequence shown as SEQ ID NO:
15. The primer probe combination targeting the IS481 gene fragment comprises an upstream primer with the nucleotide sequence shown as SEQ ID NO: 13, a downstream primer with the nucleotide sequence shown as SEQ ID NO: 14, and a probe with the nucleotide sequence shown as SEQ ID NO:
15.
4. The primer probe combination according to any one of claims 1 to 3, characterized in that, 5. Use of the primer probe combination according to any one of claims 1-4 in the preparation of a product for detecting pertussis. The PCR reaction solution 1 comprises 1M-3M betaine, 1vt%-3vt% formamide, 10mM-20mM ammonium sulfate, 0.05vt%-0.2vt% Tween-20, 10mM-30mM tetramethylammonium chloride, and 8vt%-12vt% polyethylene glycol. The PCR reaction solution 2 comprises 2mM-6mM magnesium chloride solution and 2mM-6mM manganese acetate solution.
6. A kit for the detection of pertussis characterized in that, The kit comprises at least one of the following A)-B) for detecting a sample: A), the primer probe combination according to any one of claims 1-4; B), the kit according to claim 6.
7. A method for detecting pertussis for non-diagnostic purposes, characterized in that,