A signal amplification technology based on HCR-modified porous membrane for electrochemical biosensor

Abstract

The present invention discloses a signal amplification technology based on HCR modified porous membrane for electrochemical biosensor, and an electrochemical detection method for biomacromolecules and chemical substances based on HCR technology to realize signal amplification, and verifies the biological detection application of the signal amplification technology and sensor, belonging to the technical field of electrochemical biosensor. Taking the detection of aflatoxin AFB1 as an example, the nucleic acid chain coupled with the hydrophilic polymer is formed into an aptamer in the pore of the porous membrane by HCR technology, and the hydrophilic polymer is polymerized based on the structure of the aptamer to form a hydrogel, which is aggregated in the pore of the porous membrane. Due to the combination of the ligand and the aptamer, the hydrogel structure will disintegrate, release the pore flux, and reduce the charge transfer resistance, and the degree of disintegration of the hydrogel is positively correlated with the concentration of the analyte. The concentration of the analyte is converted into electrochemical performance to realize signal amplification, thereby realizing low detection limit, high specificity and high sensitivity detection of biomacromolecules and chemical substances.

Description

Technical Field

[0001] The present invention belongs to the field of biosensor technology, and specifically relates to a signal amplification technology based on HCR modified porous membrane and an electrochemical biosensor construction method for application in the detection of biomacromolecules and chemical substances. Background Art

[0002] Rapid detection of pathogenic factors and abnormally expressed substances in the early stage of the disease is crucial to promote general public health and achieve effective clinical results as early as possible. Taking the pathogenic factor aflatoxin (AF) as an example, aflatoxin has strong acute toxicity, chronic toxicity and carcinogenicity, and is classified as a Class I carcinogen. Aflatoxin B1 (AFB1) is the most carcinogenic in the entire AF family and is widely distributed in food, posing a great threat to people's health. Traditional detection methods require centralized laboratories, cumbersome pretreatment and expensive large equipment. In recent years, convenient detection methods such as enzyme-linked immunosorbent assay, fluorescence method, and mass method have gradually occupied a place in the detection field. Although these methods have high selectivity and convenience, the abundance of pathogenic factors and abnormally expressed substances in the early stage of the disease is extremely low and the types of interferences are numerous and complex, making it difficult to achieve high sensitivity and high specificity rapid detection with extremely low detection limits. Electrochemical biosensor detection technology is considered to be a very promising strategy due to its low cost, easy miniaturization, rapid response and high sensitivity.

[0003] In recent years, electrochemical biosensors based on specific biomarkers have been widely used in the detection of various substances due to their high sensitivity, good selectivity, low cost, and fast response. However, existing electrochemical biosensors face the problems of poor stability and reproducibility after applying voltage, as well as unsatisfactory signals at extremely low abundance. These problems are also key factors limiting the development of electrochemical biosensors. Therefore, the development of low detection limit, high sensitivity, rapid, accurate, and stable electrochemical detection technology and analysis methods for biomarkers is of great significance and practical needs for disease diagnosis. Summary of the invention

[0004] In view of the problems of low sensitivity, poor stability and reproducibility, and extremely low detection limit of signal amplification in the above-mentioned existing detection technologies, the present invention proposes a signal amplification technology based on HCR modified porous membrane for use in electrochemical biosensors, which achieves high-sensitivity and high-reproducibility rapid detection of biological macromolecules and chemical substances by changing the pore flux to cause changes in electrical signals.

[0005] In order to solve the above problems, the present invention adopts the following technical solutions:

[0006] A signal amplification technology based on HCR-modified porous membrane is used for electrochemical biosensors. The porous membrane is modified by loading a charged adsorbent in the pores, and then a hydrogel designed to contain DNA probes is accumulated in the pores through HCR technology to construct a hydrogel-modified porous membrane and an electrochemical biosensor to achieve stable low-abundance signal amplification.

[0007] According to the above scheme, the inner wall of the nuclear pore membrane pore is amidated with polyaniline, the DNA chain 1 is captured, and the remaining active sites in the pore are blocked with bovine serum albumin (BSA) to obtain a modified nuclear pore membrane loaded with amplification sites.

[0008] According to the above scheme, the obtained product is co-incubated with DNA chain 2 to make the bases of DNA chain 2 and DNA chain 1 complementary, and the DNA chain 2 that is not bound to DNA chain 1 is eluted to obtain a modified nuclear pore membrane-1 / 2; DNA chain 3 and DNA chain 5 are coupled with hyaluronic acid (HA) respectively to obtain HA-3 and HA-5; HA-3 is co-incubated with DNA chain 4 to obtain a HA-3 / 4 copolymer; the modified nuclear pore membrane-1 / 2, HA-3 / 4, and HA-5 are mixed and incubated, and the HA-coupled DNA chain is hybridized to the DNA chain 1 in the pore by using HCR amplification technology to obtain a hydrogel-modified porous membrane containing a probe.

[0009] The hydrogel-modified porous membrane described in the above scheme can specifically bind to the target. Since the aptamer and the target are easier to bind, the spatial configuration of the aptamer-hydrogel is changed, which leads to the disintegration of the hydrogel, the increase of the pore flux and the decrease of the impedance. The degree of disintegration of the hydrogel is positively correlated with the target content in the test solution, and the change of the degree of disintegration of the hydrogel will lead to the change of the electrical signal, thereby realizing a low detection limit, high sensitivity and stable rapid detection of the target.

[0010] According to the above scheme, the porous membrane is a PET nuclear pore membrane with a thickness of 1 to 100 μm, a pore size of 0.01 to 10 μm, and a distribution density of 5×10 4 ~2×10 12 Pieces / cm 2 .

[0011] According to the above scheme, when the target is AFB1, the sequence of the DNA chain is shown in the following table.

[0012] name sequence serial number AFB1apt GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA SEQ ID NO.1 DNA strand 1 <![CDATA[NH2-(CH2)6-TTTTTTTTAGCTAAGCTGTGGG]]> SEQ ID NO.2 DNA strand 2 ATGTGATATGGGATGTGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACAGCTTAGCT SEQ ID NO.3 DNA strand 3 <![CDATA[NH2-(CH2)6-TGCTCTAGATCTGGTA]]> SEQ ID NO.4 DNA strand 4 ACTACCCATATCACATAGCTGAGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACATACCAGATCTAGAGC SEQ ID NO.5 DNA strand 5 <![CDATA[NH2-(CH2)6-TTTTTTTTGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACAGGATGTAGATAGATGATCAGCT]]> SEQ ID NO.6

[0013] Note: The bold part represents the aptamer sequence.

[0014] The preparation method of the electrochemical biosensor based on HCR-modified porous membrane signal amplification, taking the detection of AFB1 as an example, the main steps are as follows:

[0015] 1. Fix the nuclear pore membrane in the middle of the filter head of the peristaltic pump, and use the peristaltic pump to flow 1-5g / L aniline and ammonium persulfate solution through the pores for 15-60min; after the reaction is completed, rinse the surface of the nuclear pore membrane with deionized water for 3 times to obtain a pore-activated nuclear pore membrane, and store it in a dry state at room temperature.

[0016] 2. Soak the pore-activated nuclear pore membrane in a solution of DNA chain 1, incubate it at 0-15°C for 6-12 hours, wash the surface three times with PBS solution to remove the loosely bound DNA chain 1; then incubate it in a 0.5-5g / L BSA aqueous solution for 30-60 minutes to close the site, and then wash the surface with deionized water to obtain a modified nuclear pore membrane.

[0017] 3. Hybridize the DNA chain 1 attached to the channel with the added DNA chain 2 through base complementary pairing at a ratio of 1:1.2 for 6-12 hours, wash several times to remove the unhybridized downstream reaction initiation element DNA chain 2, and store the obtained product at 4°C for subsequent use.

[0018] 4. The solution of amino-modified DNA chain 3 and DNA chain 5 was heated at 95°C for 5 min and cooled at 0°C for 2 min to avoid the formation of DNA aggregates; a 1-5% hyaluronic acid (HA) solution was activated with a mixed solution of 1-5 g / L EDC and 0.5-2 g / L NHS for 30-60 min; then, a 10-500 μM DNA chain 3 or DNA chain 5 was coupled with HA overnight to obtain polymers HA-3 and HA-5, which were removed from the mixture by three ultrafiltration purification processes; DNA chain 3 was then quantified by UV spectroscopy and incubated with an equal concentration of DNA chain 4 at 37°C for 3-6 h to produce a copolymer HA-3 / 4; wherein the aptamer was designed as a part of DNA chains 4 and 5 with a hairpin structure. Thus, the DNA was given a specific recognition function in the hydrogel.

[0019] 5. The product obtained in step 4 was mixed with HA-3 / 4 and HA-5 at a ratio of 2:2:1 and incubated at 42°C for 3-12 hours; then, the product was purified three times to remove unreacted substances, and finally a DNA hydrogel-modified nuclear pore membrane was obtained for AFB1 detection.

[0020] The present invention also provides a detection method for an electrochemical biosensor based on a HCR-modified porous membrane, the main steps of which are:

[0021] 1. The obtained hydrogel-modified nucleopore membrane was used as the diaphragm of a double-tank electrolytic cell and fixed in the middle of a water tank electrolytic cell. A buffer solution with a pH value greater than 4.7 was added as an electrolyte to the electrolytic cells on both sides to obtain an electrochemical biosensor for detecting AFB1.

[0022] 2. Perform IV and EIS tests on the above-mentioned sensor to obtain substrate electrochemical data, and then replace the diaphragm with a hydrogel-modified nuclear pore membrane that has been incubated for 30-120 min at different target concentrations for testing. Draw a quantitative curve of target concentration-electrochemical properties based on the data obtained from the electrochemical test.

[0023] 3. After incubating the hydrogel-modified nuclear pore membrane in the test solution for 30-120 minutes, perform an electrochemical test, substitute the obtained data into the quantitative curve obtained in the above steps, and calculate the concentration of the test substance in the solution.

[0024] The technical principle of the present invention is: the present invention provides a signal amplification technology based on HCR modified porous membrane for electrochemical biosensors; taking the detection of AFB1 as an example, the present invention first amidates the pores and loads DNA chains, closes the remaining active sites, and modifies the porous membrane; then assembles the aptamer probe and the hydrogel in the pores of the porous membrane through the HCR technology; since the binding of the ligand and the aptamer will cause the hydrogel structure to disintegrate, the pore flux of the porous membrane will increase, the impedance will decrease, and the electrochemical signal will change, and the content of the analyte is positively correlated with the degree of disintegration of the hydrogel; the concentration of the analyte is converted into electrochemical performance for amplification, thereby realizing low detection limit, high specificity, and high sensitivity detection of biological macromolecules and chemical substances; in addition, the detection target of the present invention is not limited to AFB1, and other biological macromolecules and chemical substances that can bind to the probe in the hydrogel to disintegrate the hydrogel and further affect the exposed area of ​​the conductive layer should also be regarded as the protection scope of the present invention.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1. The signal amplification technology based on HCR modified porous membrane described in the present invention has the function of disintegrating the hydrogel as the target and does not directly participate in the electrochemical test process. The goal of the electrochemical test is the electrical signal that changes due to the disintegration of the hydrogel. Compared with the method that directly participates in the electrochemical test, this method does not involve reactions that occur in other electrochemical tests, and there is no need to consider whether the molecule to be tested is stable after applying voltage in the test environment, which further improves the accuracy, stability and reproducibility of the test process.

[0027] 2. The present invention utilizes HCR technology to amplify DNA chains, and based on this, cross-links the hydrophilic polymers coupled to the DNA chains to form hydrogels, and uses HCR as a means of preparing test precursors rather than a means of amplifying targets. Compared with directly amplifying the test object, this method further improves the controllability and yield of HCR technology, while avoiding the influence of interfering substances on HCR in actual detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The figure is a flow chart of the modification of the electrochemical biosensor membrane used in the present invention.

[0029] Figure 2 FIG. 1 is a schematic diagram of an electrochemical biosensor device used in the present invention.

[0030] Figure 3 1 is the IV curve of the hydrogel-modified nuclear pore membrane in Example 2 under different modification states.

[0031] Figure 4 1 is the EIS curve of the hydrogel-modified nuclear pore membrane in Example 2 under different modification states.

[0032] Figure 5 This is the IV standard curve of the AFB1 electrochemical biosensor based on the present invention in Example 2.

[0033] Figure 6 This is the ∆I-lgC quantification curve of the AFB1 electrochemical biosensor based on the present invention in Example 2.

[0034] Figure 7 This is a reproducibility test of the AFB1 electrochemical biosensor based on the present invention in Example 3.

[0035] Figure 8 This is a detection stability test of the AFB1 electrochemical biosensor based on the present invention in Example 4.

[0036] Fig. 9 This is a stability test of the AFB1 electrochemical biosensor based on the present invention in Example 5.

[0037] Fig.10 This is the specific detection of the AFB1 electrochemical biosensor based on the present invention in Example 6.

[0038] Fig.11 This is a reproducibility test of the chitosan-modified nuclear pore membrane electrochemical biosensor based on the present invention in Example 7. DETAILED DESCRIPTION

[0039] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0040] Example 1 Construction of Hyaluronic Acid Hydrogel-Modified Porous Membrane

[0041] 1. Let a 2 g / L mixed solution of aniline and ammonium persulfate flow through the pores for 30 min. After the reaction is completed, rinse the surface of the nuclear pore membrane with deionized water for 3 times to obtain a nuclear pore membrane with polyamide pores, which is then dried and stored at room temperature.

[0042] 2. The polyamide-modified nuclear pore membrane was immersed in the DNA chain 1 solution and incubated at 10°C for 6 hours. The loosely bound DNA chain 1 was removed by rinsing with PBS solution three times. The membrane was then incubated in a 5 g / L BSA aqueous solution for 30 minutes to seal the site. Afterwards, the membrane was rinsed with deionized water to obtain a modified nuclear pore membrane.

[0043] 3. DNA chain 2 was added at a ratio of 1.2:1.0 and hybridized with DNA chain 1 attached to the channel through base complementary pairing for 8 hours. The unhybridized downstream reaction initiation element DNA chain 2 was washed several times to remove it. The obtained product was stored at 4°C for subsequent use.

[0044] 4. The solution of amino-modified DNA chain 3 and DNA chain 5 was heated at 95°C for 5 minutes and cooled at 0°C for 2 minutes to avoid the formation of DNA aggregates, and a 5% hyaluronic acid (HA) solution was activated with a mixed solution of 5 g / L EDC and 2 g / L NHS for 30 minutes; then, a coupling reaction was carried out overnight with a concentration of 200 μM DNA chain 3 or DNA chain 5 and HA to obtain polymers HA-3 and HA-5, and HA-3 and HA-5 were removed from the mixture through three ultrafiltration purification processes; DNA chain 3 was then quantified by UV spectroscopy and incubated with an equal concentration of DNA chain 4 at 37°C for 6 hours to produce a copolymer HA-3 / 4; wherein the probe was designed to be a part of DNA chains 4 and 5 with a hairpin structure, thereby giving DNA a specific recognition function in the hydrogel.

[0045] 5. The product obtained in step 4 was mixed with HA-3 / 4 and HA-5 at a ratio of 2:2:1 and incubated at 42°C for 6 h. Subsequently, the product was purified three times to remove unreacted substances, and finally a DNA hydrogel-modified nuclear pore membrane was obtained for AFB1 detection.

[0046] In the process of constructing hydrogel-modified nuclear pore membrane, the schematic diagram of the pore cross section is as follows Figure 1 shown.

[0047] Example 2 Construction and detection method of AFB1 electrochemical biosensor based on the present invention

[0048] 1. The hydrogel-modified nucleopore membrane obtained in Example 1 was used as the diaphragm of the double-tank electrolytic cell and fixed in the middle of the water tank electrolytic cell. 0.01M PBS buffer solution was added to the electrolytic cells on both sides as the electrolyte to obtain an electrochemical biosensor for detecting AFB1, as shown in the schematic diagram. Figure 2 Its electrochemical properties were characterized, and the results are shown in the figure. Figure 3 are the IV curves under different modification states. Figure 4 The EIS curves under different modification states.

[0049] 2. Perform IV and EIS tests on the above sensor to obtain substrate electrochemical data, and then replace the diaphragm with DNA hydrogel-modified nuclear pore membrane after incubation for 30 minutes at different target concentrations for testing. Figure 5 IV curves for different target concentrations.

[0050] 3. Perform mathematical processing on the IV curve to obtain Figure 6 As shown, the AFB1 quantification curve with lgC as the horizontal axis and △I as the vertical axis is used for the quantitative detection of AFB1.

[0051] Example 3 Reproducibility of the AFB1 electrochemical biosensor based on the present invention

[0052] 1. Perform IV test on the electrochemical biosensor of AFB1 assembled in step 1 of Example 2 at room temperature.

[0053] 2. Perform an IV test on the sensor every hour, record its peak current and draw a spectrum.

[0054] 3. The results are as follows Figure 7 As shown, even if the hydrogel-modified nucleopore membrane is placed in the test solution for a long time, the test current only changes slightly, indicating that the sensor has good reproducibility.

[0055] Example 4 Detection stability of the AFB1 electrochemical biosensor based on the present invention

[0056] 1. The electrochemical biosensor of AFB1 assembled in Example 2 was subjected to a constant voltage test, wherein the voltage was 1 V and the duration was 2 hours.

[0057] 2. Test results such as Figure 8 As shown, after 2 hours of testing, the current change rate was only 5%, indicating that the AFB1 electrochemical sensor has good detection stability and can support longer detection time.

[0058] Example 5 Stability of the AFB1 electrochemical biosensor based on the present invention

[0059] 1. Perform IV test on the electrochemical biosensor of AFB1 assembled in step 1 of Example 2 at room temperature.

[0060] 2. After the test is completed, record the peak current, then remove the diaphragm, rinse the surface with deionized water and dry it at room temperature. After the surface is dry, store it in a 4°C refrigerator for subsequent testing.

[0061] 3. Repeat the above steps once a day for 14 days. Fig. 9 As shown, it shows that the sensor has good stability.

[0062] Example 6 Specific detection of AFB1 based on the electrochemical biosensor of the present invention

[0063] 1. The hydrogel-modified nuclear pore membrane obtained by incubating at different target concentrations in the second step of Example 2 was replaced with a hydrogel-modified nuclear pore membrane obtained by incubating in a 3 pM AFB1 solution and a hydrogel-modified nuclear pore membrane obtained by incubating in aflatoxin solutions of other configurations with a concentration of 1 pM, and the electrochemical properties of these hydrogel-modified nuclear pore membranes were tested.

[0064] 2. Test results such as Fig.10 As shown, it can be clearly seen from the figure that the electrochemical sensors constructed by the methods of Example 1 and Example 2 have good selectivity.

[0065] Example 7 Construction of chitosan hydrogel-modified nuclear pore membrane

[0066] 1. Based on the experimental scheme of Example 1, the 5% hyaluronic acid in step 4 was replaced with 5 g / L chitosan solution, and finally a hydrogel-modified nuclear pore membrane with chitosan as raw material was obtained.

[0067] 2. The hydrogel-modified nuclear pore membrane obtained in the previous step was tested for reproducibility using the test method of Example 3. The results are as follows: Fig.11 As shown, the hydrogel-modified nucleopore membrane constructed by simply replacing hyaluronic acid with chitosan can be used as a substitute for Example 1 to obtain the electrochemical biosensor prepared by this method.

[0068] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent substitutions for some of the technical features therein; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A signal amplification method based on HCR modified porous membrane, characterized in that: Polyaniline is used for polyamidation in the pores of the porous membrane to achieve DNA capture, and then the DNA chains coupled with the hydrophilic polymer are accumulated in the pores of the porous membrane through the HCR technology to form a hydrogel, which blocks the nanopores to a certain extent. The binding of the ligand and the aptamer will cause the hydrogel structure to disintegrate, releasing the pore flux and significantly reducing the charge transfer resistance. The content of the analyte is positively correlated with the degree of hydrogel disintegration, thereby realizing a signal amplification method based on HCR modified porous membranes.

2. The signal amplification method based on HCR modified porous membrane according to claim 1, characterized in that: When AFB1 is used as a ligand and the nuclear pore membrane is used as a porous membrane, the specific implementation steps are as follows: Step 1, polyaniline is loaded into the nuclear pore membrane to capture the DNA chain 1, and then BSA is used to block the remaining active sites in the pore to obtain a modified porous membrane; Step 2, incubating the modified porous membrane with DNA chain 2 to make the bases of DNA chain 2 complementary to those of DNA chain 1, and eluting the DNA chain 2 that is not bound to DNA chain 1; Step 3, coupling reaction of DNA chain 3 and DNA chain 5 with hydrophilic polymers to obtain HA-3 and HA-5 respectively; Step 4, co-incubating HA-3 with DNA chain 4 to obtain HA-3 / 4 copolymer; Step 5, the products of step 2 and step 4 are mixed and incubated with HA-5, and the DNA chain is hybridized to the inner wall of the pore to form an aptamer by using HCR amplification technology, and the HA coupled with the aptamer is polymerized to obtain a hydrogel, thereby obtaining a hydrogel-modified porous membrane; Step 6, soaking the hydrogel-modified porous membrane in ligand solutions of different concentrations and incubating them to allow the ligand to bind to the aptamer and the hydrogel to disintegrate. After the reaction is complete, the hydrogel is fixed in a double-tank electrolytic cell as a diaphragm, and an electrolyte solution is added to the electrolytic cell. The electrochemical performance of the porous membrane after the hydrogel disintegration is tested to obtain a quantitative relationship between the electrochemical properties of the modified porous membrane and the concentration of the analyte; Step 7: Repeat the steps in step 6 for the solution to be tested, measure its electrochemical properties, and substitute them into the quantitative equation to obtain the concentration of the sample to be tested.

3. The signal amplification method based on HCR modified porous membrane according to claim 1, characterized in that: The hydrogel for blocking the pores is constructed based on HCR technology, so that the hydrophilic polymer coupled with the DNA chain participates in HCR amplification, and then the hydrophilic polymer forms a hydrogel and accumulates in the pores to obtain a hydrogel-modified porous membrane.

4. The signal amplification method based on HCR modified porous membrane according to claim 1, characterized in that: The electrochemical test achieves electrochemical signal amplification based on the disintegration of the hydrogel. The binding of the ligand and the aptamer causes the nucleic acid chain structure to change, causing the hydrogel to disintegrate. The electrical signal before and after the hydrogel disintegration is then tested to obtain the concentration of the substance to be tested.

5. The signal amplification method based on HCR modified porous membrane according to claim 2, characterized in that: When the target is AFB1, the sequences of DNA chains 1-5 described in steps 2 to 5 are shown in SEQ ID NOs. 2-6.

Images