A targeted engineered extracellular vesicle-loaded injectable hydrogel and its preparation method and application

Abstract

The present invention relates to an injectable hydrogel loaded with targeted engineered extracellular vesicles, as well as its preparation method and application, and belongs to biomedical engineering. The present invention provides an injectable hydrogel loaded with targeted engineered extracellular vesicles, wherein the injectable hydrogel is a GelMA hydrogel loaded with ischemia-targeted miR222-engineered extracellular vesicles; the ischemia-targeted miR222-engineered extracellular vesicles overexpress miR222 and are surface-modified with a targeting polypeptide. The injectable hydrogel loaded with targeted engineered extracellular vesicles can be minimally invasively injected into the pericardial cavity to form a cardiac patch and improve cardiac ischemia-reperfusion injury.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical engineering technology, and particularly relates to an injectable hydrogel loaded with targeted engineered extracellular vesicles, and a preparation method and application thereof. Background Art

[0002] The prevalence and mortality rates of cardiovascular disease (CVD) have been rising year after year. Although CVD patients have experienced improvement with conservative medication and surgical treatment, rehospitalization and mortality rates remain high. Various heart diseases, including acute myocardial infarction (MI), pathological myocardial hypertrophy, ischemia-reperfusion injury (IRI), and heart failure (HF), continue to pose a high risk, posing a serious threat to human life and becoming a major public health concern for the entire society.

[0003] Coronary ischemia and hypoxia lead to cardiomyocyte (CM) cell death, inducing cardiac dysfunction. Clinically, thrombolysis, percutaneous coronary intervention, and transplantation can restore coronary ischemia-reperfusion injury. However, these approaches can easily cause significant cardiac trauma, resulting in secondary damage and the potential for recurrence of cardiac dysfunction. Once perfusion occurs, pressure overload (Piezo1) and high levels of reactive oxygen species (ROS) cause secondary damage to CMs due to the loss of mechanical protection within the cardiac microenvironment.

[0004] Regenerative cardiac therapy, which combines biocompatible materials and biological tissues with nucleic acids, proteins, and living cells, is considered an ideal strategy for providing personalized, precise treatment for severe ischemia-reperfusion injury. Biofunctional hydrogels are widely used for cardiac regeneration and repair, and injectable hydrogels have the potential to treat cardiovascular disease in a minimally invasive manner. However, injectable hydrogels currently suffer from shortcomings such as insufficient gel stability, poor biocompatibility, and uncontrollable mechanical properties, making them difficult to achieve in vivo treatment and repair of organs such as the heart. Summary of the Invention

[0005] The present invention aims to provide an injectable hydrogel loaded with targeted engineered extracellular vesicles. This injectable hydrogel, characterized by high stability, excellent biocompatibility, and controllable mechanical properties, can be minimally invasively injected into the pericardial cavity to form a cardiac patch and improve cardiac ischemia-reperfusion injury.

[0006] The present invention provides an injectable hydrogel loaded with targeted engineered extracellular vesicles, wherein the injectable hydrogel loaded with targeted engineered extracellular vesicles is a GelMA hydrogel loaded with ischemia-targeted miR222 engineered extracellular vesicles; the ischemia-targeted miR222 engineered extracellular vesicles overexpress miR222 and are surface-modified with a targeting polypeptide; the amino acid sequence of the targeting polypeptide is shown in SEQ ID NO.1.

[0007] Preferably, the average Young's modulus of the targeted engineered extracellular vesicle-loaded injectable hydrogel is 5-30 kPa (14-18 kPa).

[0008] The present invention also provides a method for preparing the targeted engineered extracellular vesicle-loaded injectable hydrogel according to the above technical solution, comprising the following steps:

[0009] GelMA precursor was prepared using type A gelatin and methacrylic anhydride as raw materials;

[0010] Human umbilical cord mesenchymal stem cells (HUC-MSCs) are used as raw materials to extract and obtain HUC-MSC-derived extracellular vesicles (EVs); the miR222 gene is transferred into the HUC-MSC-derived EVs to obtain miR222-engineered EVs; a targeting peptide is mixed with a DOPE-NHS solution to obtain a peptide linker, which is then concentrated and mixed with the miR222-engineered EVs to obtain targeted engineered EVs;

[0011] The GelMA precursor, photoinitiator and targeted engineered extracellular vesicles are mixed and loaded to obtain an injectable hydrogel loaded with targeted engineered extracellular vesicles.

[0012] Preferably, the preparation of the GelMA precursor comprises the following steps: dissolving type A gelatin in PBS to obtain a gelatin solution, and adding methacrylic anhydride dropwise to the gelatin solution to react to obtain the GelMA precursor.

[0013] Preferably, the mass ratio of type A gelatin to the volume ratio of methacrylic anhydride is 5 g: (0.2-5) mL.

[0014] Preferably, during the loading process, PBS is used as a solvent to prepare the reaction solution, the weight ratio of GelMA precursor to photoinitiator is (2-8):100, and each 20 μL reaction solution contains 1×10 targeted engineered extracellular vesicles. 8 ~5×10 9 indivual.

[0015] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of a drug for repairing oxidative stress damage to myocardial cells.

[0016] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of drugs for preventing myocardial cell apoptosis.

[0017] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of a drug for repairing cardiac ischemia-reperfusion injury.

[0018] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of drugs for inhibiting cardiac fibrosis.

[0019] The present invention provides an injectable hydrogel loaded with targeted engineered extracellular vesicles. The injectable hydrogel loaded with targeted engineered extracellular vesicles of the present invention has high stability, good biocompatibility, and controllable mechanical properties. It can be injected into the pericardial cavity in a minimally invasive manner to form a cardiac patch and improve cardiac ischemia-reperfusion injury. In addition, the injectable hydrogel loaded with targeted engineered extracellular vesicles (TeEVs) of the present invention can regulate the release rate of targeted engineered extracellular vesicles in the hydrogel, thereby achieving the ability to continuously repair ischemia-reperfusion injury. The beneficial technical effects of the targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention include: (1) using fully biodegradable gelatin and natural extracellular vesicles as raw materials, there is no need to introduce other refractory compounds or inorganic materials for structural modification, nor is there any need to add other toxic molecules or reagents, and it has good biocompatibility and body adaptability; (2) the injectable hydrogel system prepared using simply synthesized GelMA hydrogel and extracellular vesicles is simple to operate, low in cost, and less time-consuming, and is easy to achieve large-scale production for cardiac treatment; (3) the injectable hydrogel is injected into the pericardial cavity in a minimally invasive manner, using the pericardial cavity as a natural heart patch molding mold, thereby achieving rapid and efficient treatment purposes. The TeEV-loaded GelMA hydrogel prepared by the present invention has good biocompatibility and body adaptability, and can have broad application prospects in multiple fields such as biomedical engineering and regenerative medicine.

[0020] In addition, the targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention is simple and convenient to use, has a significant therapeutic effect, and can be used to repair cardiac ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 For the Gelatin and GelMA provided by the present invention 1 H NMR spectrum;

[0023] Figure 2 The infrared spectra of Gelatin and GelMA provided by the present invention;

[0024] Figure 3 Transmission electron micrographs of engineered EVs (eEVs) and targeted engineered EVs (TeEVs) provided by the present invention;

[0025] Figure 4 This is a release rate curve of TeEVs in hydrogel provided by the present invention;

[0026] Figure 5 The cellular phagocytosis diagram of eEV and TeEV provided by the present invention;

[0027] Figure 6 The tunel staining diagram of NRCMs provided by the present invention;

[0028] Figure 7 The in vivo Masson staining image of the myocardium provided by the present invention;

[0029] Figure 8 This is an analysis chart of myocardial in vivo pathological related indicators provided by the present invention. DETAILED DESCRIPTION

[0030] The present invention provides an injectable hydrogel loaded with targeted engineered extracellular vesicles, wherein the injectable hydrogel loaded with targeted engineered extracellular vesicles (TeEV) is a GelMA hydrogel loaded with ischemia-targeted miR222 engineered extracellular vesicles; the ischemia-targeted miR222 engineered extracellular vesicles overexpress miR222, the sequence of which is: AGCUACAUCUGGCUACUGGGU (SEQ ID NO.2), and is surface-modified with a targeting polypeptide (cardiac targeting peptide (CTP)); the amino acid sequence of the targeting polypeptide is as shown in SEQ ID NO.1: Cys-Ser-Thr-Ser-Met-Leu-Lys-Ala-Cys. TeEV is encapsulated in a mechanical hydrogel and can be injected through a minimally invasive manner to obtain a TeEV-loaded cardiac patch, thereby improving cardiac ischemia-reperfusion injury. TeEV precisely targets myocardial cells through injectable cardiac patches and rescues cell apoptosis caused by oxygen-glucose deprivation reperfusion stress (OGDR) overload through efficient internalization. In addition, TeEV is continuously delivered to the myocardial infarction area to alleviate long-term cardiac dysfunction after cardiac remodeling.

[0031] In the present invention, the average Young's modulus of the targeted engineered extracellular vesicle-loaded injectable hydrogel is preferably 5 to 30 kPa, more preferably 14 to 18 kPa.

[0032] The present invention also provides a method for preparing the targeted engineered extracellular vesicle-loaded injectable hydrogel according to the above technical solution, comprising the following steps:

[0033] GelMA precursor was prepared using type A gelatin and methacrylic anhydride as raw materials;

[0034] Human umbilical cord mesenchymal stem cells (HUC-MSCs) are used as raw materials to extract and obtain HUC-MSC-derived extracellular vesicles (EVs); the miR222 gene is transferred into the HUC-MSC-derived EVs to obtain miR222-engineered EVs; a targeting peptide is mixed with a DOPE-NHS solution to obtain a peptide linker, which is then concentrated and mixed with the miR222-engineered EVs to obtain targeted engineered EVs;

[0035] The GelMA precursor, photoinitiator and targeted engineered extracellular vesicles are mixed and loaded to obtain an injectable hydrogel loaded with targeted engineered extracellular vesicles.

[0036] The present invention uses type A gelatin and methacrylic anhydride as raw materials to prepare a GelMA precursor. In the present invention, the preparation of the GelMA precursor preferably includes the following steps: dissolving type A gelatin in PBS to obtain a gelatin solution, and adding methacrylic anhydride dropwise to the gelatin solution to react to obtain a GelMA precursor. In the present invention, type A gelatin is dissolved in PBS, preferably stirred at 40 to 60°C, more preferably at 50°C, and the stirring speed is preferably 300 to 500 rpm, more preferably 400 rpm. Under these conditions, a uniform gelatin solution is obtained. In the present invention, the concentration of type A gelatin in the gelatin solution is preferably 2.0 to 10.0 wt%. After obtaining the gelatin solution, the present invention adds methacrylic anhydride dropwise to the gelatin solution for reaction. In the present invention, the volume ratio of the mass of type A gelatin to methacrylic anhydride is preferably 5 g: (0.2 to 5) mL. By changing the grafting rate of the methacryloyl group, the hardness and adhesion of the GELMA hydrogel can be controlled, thereby synthesizing an injectable mechanical hydrogel. The surface morphology of the GelMA hydrogel is a micro- / nano-graded porous structure. By varying the methacrylic anhydride content (e.g., 0.2 mL, 1 mL, and 5 mL), its structural morphology changes accordingly, thereby altering the hydrogel's mechanical properties (Young's modulus: 5-30 kPa). When the volume ratio of type A gelatin to methacrylic anhydride is preferably 5 g:1 mL, the grafting rate of methacrylic groups is 52%, and the hydrogel's Young's modulus is 14-18 kPa. In the present invention, the dropwise addition is preferably performed at 50°C and 400-600 rpm, with the dropwise addition rate preferably being 0.5 mL / min. In the present invention, the reaction is preferably carried out in the dark with stirring at 50°C (preferably at 300-500 rpm) for 3 hours. After stirring, the reaction is preferably diluted with 5 volumes of PBS. After dilution, the formulation is preferably dialyzed to remove residual MA monomers. After dialysis, the reaction is preferably filtered, sterilized, and freeze-dried to obtain a porous, sponge-like GelMA precursor.

[0037] The present invention uses human umbilical cord mesenchymal stem cells as raw materials to extract and obtain HUC-MSC-derived extracellular vesicles; the miR222 gene is transferred into the HUC-MSC-derived extracellular vesicles to obtain miR222-engineered extracellular vesicles; the targeting polypeptide is mixed with a DOPE-NHS solution to obtain a peptide linker, which is then concentrated and mixed with the miR222-engineered extracellular vesicles to obtain targeted engineered extracellular vesicles. The present invention does not specifically limit the culture method of human umbilical cord mesenchymal stem cells, and conventional methods can be used for culture, such as in a solution containing 10% UltraGRO TM Serum Hyclone TMCultured in MEMα modified culture medium at 37°C and 5% CO2 in an incubator. The present invention has no special restrictions on the method for extracting extracellular vesicles. Conventional differential centrifugation enrichment method can be used for collection. Specifically, preferably (1) centrifuge at 300g for 10 minutes at 4°C to collect the supernatant; (2) centrifuge at 2000g for 10 minutes at 4°C to collect the supernatant; (3) centrifuge at 10000g for 30 minutes at 4°C to collect the supernatant; (4) centrifuge at 100000g for 70 minutes at 4°C to collect the precipitate. The present invention has no special restrictions on the transformation method. Conventional gene transformation methods, such as electroporation, can be used. The present invention has no special restrictions on electroporation methods. Conventional conditions can be used to introduce genes by electroporation. In the present invention, the amino acid sequence of the targeting polypeptide is preferably as shown in SEQ ID NO.1: Cys-Ser-Thr-Ser-Met-Leu-Lys-Ala-Cys. The present invention preferably mixes the targeting peptide with a DOPE-NHS solution to prepare a peptide linker, which is then concentrated and mixed with extracellular vesicles to form targeted engineered extracellular vesicles (TeEVs). More preferably, the present invention mixes 200 μL of a 3 μM targeting peptide with 50 μL of a 120 nM DOPE-NHS solution for 1 hour to prepare a peptide linker, which is then concentrated and mixed with 1×10 9 The extracellular vesicles were mixed at 4°C for 1 hour to form targeted engineered extracellular vesicles.

[0038] After obtaining the GelMA precursor and the targeted engineered extracellular vesicles, the present invention mixes the GelMA precursor, the photoinitiator and the targeted engineered extracellular vesicles for loading to obtain an injectable hydrogel loaded with targeted engineered extracellular vesicles. In the present invention, during the loading process, PBS is preferably used as a solvent to prepare the reaction solution, and the weight ratio of the GelMA precursor to the photoinitiator in the reaction solution is preferably (2 to 8):100, more preferably 5:100, and each 20 μL reaction solution preferably contains 1×10 targeted engineered extracellular vesicles. 8 ~5×10 9 More preferably, 1×10 9 More preferably, the mass percentage of the GelMA precursor in the reaction solution is preferably 10%, and the mass percentage of the photoinitiator is preferably 0.5%.

[0039] The present invention does not specifically limit the source of the raw materials used in the preparation of the injectable hydrogel loaded with targeted engineered extracellular vesicles; conventional commercially available products or commissioned synthesis can be used. The GelMA hydrogel precursor described in the present invention is prepared by reacting type A gelatin with methacrylic anhydride. The hydrogel is loaded with targeted engineered extracellular vesicles, and the mechanical properties of the hydrogel are controlled by the methacrylic anhydride content. The GelMA hydrogel synthesized in the present invention exhibits excellent stability and long-term storage, with no significant changes in structure or function after storage for more than six months.

[0040] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution, or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution, in the preparation of a medicament for repairing oxidative stress damage to cardiomyocytes. Cardiomyocytes damaged by oxidative stress have a high ability to take up the targeted engineered extracellular vesicles in the targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention.

[0041] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution, or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution, in the preparation of a drug for preventing cardiomyocyte apoptosis. In situ injection of the targeted engineered extracellular vesicle-loaded injectable hydrogel can rapidly release the targeted engineered extracellular vesicles during the initial phase, and the targeted engineered extracellular vesicles are targeted for endocytosis into damaged cardiomyocytes, thereby enhancing the cardiomyocytes' resistance to apoptosis.

[0042] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of a drug for repairing cardiac ischemia-reperfusion injury. The targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention can achieve sustained release, as well as chronic cardiac ischemia-reperfusion repair. Specifically, the targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention can significantly improve cardiac IRI remodeling through left ventricular ejection fraction (EF) and shortening fraction (FS), reduce the level of cardiac fibrosis, inhibit pathological gene expression, improve cardiac IRI remodeling, and prevent the expression of inflammatory factors, and reverse the inflammatory response in IR remodeling. Implanting GEL-TeEV to form a patch through in situ minimally invasive injection can inhibit the process of cardiac fibrosis and protect pathological cardiac IRI remodeling, thereby improving cardiac function.

[0043] The present invention also provides the use of the targeted engineered extracellular vesicle-loaded injectable hydrogel described in the above technical solution or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method described in the above technical solution in the preparation of drugs for inhibiting cardiac fibrosis.

[0044] The targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention can be used for the treatment of cardiac ischemia-reperfusion injury. The targeted engineered extracellular vesicle-loaded injectable hydrogel of the present invention can be used to synthesize a cardiac patch by injection. The synthesis process of the present invention is simple and low-cost. At the same time, the prepared cardiac patch has good biocompatibility and can be widely used in technical fields such as cardiac microfluidic systems and biomedical engineering. Specifically, a photoinitiator triggers photocrosslinking to prepare a GelMA hydrogel. The GelMA precursor and the photoinitiator are uniformly dissolved in PBS containing TeEV and crosslinked under 405 nm ultraviolet light to form a TeEV-loaded injectable hydrogel cardiac patch for improving cardiac ischemia-reperfusion injury. The present invention preferably applies the targeted engineered extracellular vesicle-loaded injectable hydrogel to the pericardial cavity through an injection drop coating process using a 20 μL syringe, preferably drop coating to the damaged heart area, thereby improving cardiac function, accurately targeting myocardial cells to alleviate acute ischemia-reperfusion injury and reverse long-term cardiac dysfunction after cardiac remodeling.

[0045] To further illustrate the present invention, a targeted engineered extracellular vesicle-loaded injectable hydrogel, its preparation method, and application provided by the present invention are described in detail below with reference to the accompanying drawings and examples. However, these should not be construed as limiting the scope of protection of the present invention.

[0046] Example 1

[0047] A method for preparing an injectable hydrogel precursor, the specific preparation method is as follows:

[0048] First, a methacryloyl group was introduced into the type A gelatin chain to design and synthesize a viscoelastic GelMA precursor. Specifically, 5g of type A gelatin powder (9000-70-8, Sigma-Aldrich) was completely dissolved in 90mL of phosphate buffered saline (PBS, pH=7.6) and stirred at 400rpm at 50°C to prepare a uniform gelatin solution. Then, 0.2mL of methacrylic anhydride (760-93-0, Aladdin) was added to the above gelatin solution and stirred at 400rpm at 50°C, with the drop rate set to 0.5mL / min to synthesize the GelMA precursor. The mixed solution was reacted in the dark for 3h, stirred at 50°C, and further diluted with 5 times the volume of PBS. Subsequently, the residual molecular monomers of MA were removed by dialyzing using a dialysis tube cellulose membrane (molecular weight of 14kD) for 5 days, and ultrapure water was replaced 3 times a day. The filtrate was filtered through a 0.22 μm filter membrane, and the GelMA precursor solution was sterilized and freeze-dried for 3 days to obtain a porous sponge-like GelMA precursor.

[0049] The average grafting rate of methacrylic acid groups in type A gelatin prepared in Example 1 was 25%. In addition, after adding a photoinitiator to induce curing of the hydrogel precursor, the average Young's modulus of GelMA prepared in Example 1 was 5 kPa, specifically, the Young's modulus ranged from 3 to 8 kPa.

[0050] Example 2

[0051] A method for preparing an injectable hydrogel precursor, the specific preparation method is as follows:

[0052] First, methacryloyl groups were introduced into the type A gelatin chain to design and synthesize the viscoelastic GelMA precursor. Specifically, 5g of type A gelatin powder (9000-70-8, Sigma-Aldrich) was completely dissolved in 90mL of phosphate buffered saline (PBS, pH=7.6) and stirred at 400rpm at 50°C to prepare a uniform gelatin solution. Then, 1mL of methacrylic anhydride was added to the above gelatin solution and stirred at 400rpm at 50°C with a drop rate of 0.5mL / min to synthesize the GelMA precursor. The mixed solution was reacted in the dark for 3h, stirred at 50°C, and further diluted with 5 times the volume of PBS. Subsequently, the residual molecular monomers of MA were removed by dialyzing using a dialysis tube cellulose membrane (molecular weight of 14kD) for 5 days, and ultrapure water was replaced 3 times a day. The filtrate was filtered through a 0.22 μm filter membrane, and the GelMA precursor solution was sterilized and freeze-dried for 3 days to obtain a porous sponge-like GelMA precursor.

[0053] The GelMA precursor was successfully prepared by 1H-NMR analysis, Figure 1 The existence of the grafted conjugated structure of methacryloyl was confirmed. For the synthesized GelMA precursor, the proton peak δ value of methacrylate vinyl increased at 5.4ppm and 5.7ppm, while the proton peak of methylene lysine decreased at 2.9ppm, indicating that the modification of methacrylic acid groups in type A gelatin chains increased, with an average grafting rate of 52%. Infrared spectroscopy was used to characterize type A gelatin and GelMA precursor ( Figure 2 The GelMA spectrum shows the typical characteristic peaks of gelatin chains, with OH and NH contraction vibration peaks at 3292 cm -1 The NH contraction peak is at 1544 cm -1 The CN contraction peak and NH bending peak are at 1237 cm -1 In particular, in the GelMA spectrum, around 1631 cm -1 The characteristic peak at is the C=C contraction peak of the methacrylate group. In addition, after adding a photoinitiator to induce the curing of the hydrogel precursor, the average Young's modulus of the GelMA hydrogel prepared in Example 2 is 15 kPa, specifically, the Young's modulus ranges from 14 to 18 kPa.

[0054] Example 3

[0055] A method for preparing an injectable hydrogel precursor, the specific preparation method is as follows:

[0056] First, methacryloyl groups were introduced into the type A gelatin chain to design and synthesize a viscoelastic GelMA precursor. Specifically, 5g of type A gelatin powder was completely dissolved in 90mL of phosphate buffered saline (PBS, pH = 7.6) and stirred at 400rpm at 50°C to prepare a uniform gelatin solution. Then, 5mL of methacrylic anhydride was added to the above gelatin solution and stirred at 400rpm at 50°C with a drop rate of 0.5mL / min to synthesize the GelMA precursor. The mixed solution was reacted in the dark for 3h, stirred at 50°C, and further diluted with 5 times the volume of PBS. Subsequently, the solution was dialyzed for 5 days using a dialysis tubing cellulose membrane (molecular weight 14kD), and ultrapure water was replaced 3 times a day to remove residual molecular monomers of MA. The filtrate was filtered with a 0.22μm filter membrane, the GelMA precursor solution was sterilized, and freeze-dried for 3 days to obtain a porous sponge-like GelMA precursor.

[0057] The grafting rate of methacrylic acid groups in type A gelatin prepared in Example 3 was 91%. In addition, after adding a photoinitiator to induce curing of the hydrogel precursor, the average Young's modulus of the GelMA hydrogel prepared in Example 3 was 30 kPa, and specifically, the Young's modulus ranged from 25 to 35 kPa.

[0058] Example 4

[0059] A method for preparing engineered extracellular vesicles targeting cardiac ischemia-reperfusion, the specific implementation method is as follows:

[0060] Human umbilical cord mesenchymal stem cells (HUC-MSCs) were cultured in a 10% UltraGRO TM Serum Hyclone TM The cells were cultured in MEMα-modified medium (SH30265.01 Hyclone) at 37°C in a 5% CO2 incubator. The supernatant of HUC-MSCs was collected to obtain EVs by a four-step differential centrifugation enrichment method using an Optima XPN-100 ultracentrifuge: (1) centrifugation at 300g for 10 min at 4°C to collect the supernatant; (2) centrifugation at 2000g for 10 min at 4°C to collect the supernatant; (3) centrifugation at 10,000g for 30 min at 4°C to collect the supernatant; and (4) centrifugation at 100,000g for 70 min at 4°C to collect the precipitate. The deposited extracellular vesicles were used for further experiments. The miR222 gene was transferred into HUC-MSC-derived extracellular vesicles by electroporation to establish miR222-engineered extracellular vesicles. In addition, ischemia-targeting peptides (sequence code: Cys-Ser-Thr-Ser-Met-Leu-Lys-Ala-Cys, commissioned by Qiangyao Biotechnology Co., Ltd. for synthesis) were combined with miR222-engineered extracellular vesicles to form ischemia-targeted miR222-engineered EVs (TeEVs). Specifically, 200 μL of 3 μM targeting peptides were mixed with 50 μL of 120 nM DOPE-NHS solution for 1 hour to prepare peptide linkers, which were then concentrated and mixed with 1×10 9 The extracellular vesicles were mixed at 4°C for 1 h to form targeted engineered extracellular vesicles (TeEVs).

[0061] EVs secreted by HUC-MSCs were isolated by differential centrifugation and engineered to overexpress miR222 by electroporation. These EVs were then targeted with a cardiac ischemia-targeting peptide (CSTSMLKAC) to form ischemia-targeted miR222-engineered EVs. The miR222-engineered EVs overexpressed miR222 RNA at a 150-fold higher level than control EVs. Transmission electron microscopy (TEM) was used to observe the spherical structure and size of the eEV and TeEV nanoparticles, and their sizes were calculated to be approximately 80 to 130 nm ( Figure 3 By introducing the CSTSMLKAC peptide targeting cardiac ischemia into miR222-engineered EVs, TeEVs were successfully designed and prepared.

[0062] Example 5

[0063] The method of the cardiac ischemia-reperfusion injury model is as follows:

[0064] The method for constructing a cardiac ischemia-reperfusion injury model includes the following specific steps: first, the heart is ischemic for 30 minutes and then reperfused with blood for 3 weeks to construct an ischemia-reperfusion injury (IRI) model (abbreviated as IRI or IRI+3W).

[0065] The method for using TeEV to repair cardiac ischemia-reperfusion injury, the specific implementation scheme is as follows:

[0066] TeEV-based cardiac ischemia-reperfusion injury repair, specifically, 20 μL sterile PBS containing 1 × 10 9 TeEVs. 20 μL of 1×10 9 TeEV-PBS solution was injected into the damaged heart area to treat cardiac ischemia-reperfusion injury. This corresponds to the TeEV group described below.

[0067] The method for using injectable hydrogel to repair cardiac ischemia-reperfusion injury, the specific implementation scheme is as follows:

[0068] The GelMA hydrogel prepared based on Example 2 was used to repair cardiac ischemic reperfusion injury. A photoinitiator was introduced into the GelMA precursor, and the GelMA hydrogel was prepared by photocrosslinking synthesis. Specifically, 10% (weight fraction) of GelMA precursor and 0.5% photoinitiator (LAP405 nm) were evenly dissolved in 20 μL of sterile PBS. 20 μL of the hydrogel solution was injected into the damaged heart area by in situ injection and crosslinked under 405 nm ultraviolet light for 20 seconds to form a hydrogel heart patch, which corresponds to the GEL group mentioned later.

[0069] The preparation method of TeEV-loaded injectable hydrogel for treating cardiac ischemia-reperfusion injury is as follows:

[0070] The preparation of TeEV-loaded GelMA hydrogel was used for the repair of cardiac ischemic reperfusion injury. A photoinitiator was introduced into the GelMA precursor, and the GelMA hydrogel was prepared by photocrosslinking synthesis. Specifically, the TeEV prepared in Example 4 was added to sterile PBS to obtain TeEV sterile PBS, and then 10% (weight percentage) of the GelMA precursor prepared in Example 2 and 0.5% photoinitiator (LAP 405nm) were uniformly dissolved in 20 μL of TeEV sterile PBS. By in situ injection, 20 μL of 1×10 9 The TeEV hydrogel solution was injected into the damaged heart area and cross-linked under 405nm UV light for 20s to form a TeEV-loaded hydrogel heart patch.

[0071] TeEV was loaded into GelMA hydrogel (obtaining GEL-TeEV hydrogel), and the mechanical properties, TeEV release rate and biocompatibility of GEL-TeEV hydrogel were investigated. The average Young's modulus of the GEL-TeEV sample was tested by atomic force microscopy to be approximately 14 to 18 kPa, which was the same as the result of the hydrogel sample in Example 2, indicating that the addition of TeEV did not affect the mechanical properties of the cross-linked GelMA hydrogel. The hydrogel loaded with TeEV was prepared into a cylinder with a diameter of 8 mm and a height of 3 mm, and placed in 1 mL of PBS solution. 20 uL of PBS supernatant was taken, and the TeEV content in the supernatant was calculated using a nanoparticle tracer analyzer to determine its sustained release performance in the hydrogel. The TeEV release curve increased with increasing release time, and the TeEV release amount accumulated to 70% within 72 h. Subsequently, a stable and controlled release of TeEV could be achieved within 3 weeks ( Figure 4 ). Due to the in situ injection cross-linking properties of the GelMA precursor and TeEVs in the pericardial cavity by photoinitiator, the cardiomyocytes will be covered under the GelMA hydrogel to simulate the in vivo cellular microenvironment. The biocompatibility of the cross-linked hydrogel was studied. The cells were cultured in a 24-well plate, GEL-TeEV was added and solidified, and the cells in the synthetic hydrogel showed high survival ability and excellent biocompatibility (survival rate of more than 90%) through CCK-8 detection. Based on the adjustable mechanical properties, controllable release rate and biocompatibility of the hydrogel, a TeEV-loaded mechanical hydrogel was prepared and used as an injectable cardiac patch in the pericardial cavity, thereby achieving protection of cardiac function and repair of cardiac damage.

[0072] Myocardial cell oxidative stress injury assay

[0073] The targeted uptake ability of TeEVs in neonatal rat cardiomyocytes (NRCMs) was evaluated by fluorescence labeling assay. The uptake results showed that more red targeted engineered extracellular vesicles (ETVs) were observed in the miR222EV+CTP (TeEV) group compared with the PBS and non-targeted miR222 EV (eEV) groups. Figure 5 Under OGD / R conditions, the red fluorescence in the TeEV group cells was enhanced, indicating excellent targeted uptake ability.

[0074] In order to verify the targeted repair ability of GEL-TeEV in damaged NRCMs, Tunel staining was used to monitor its ability to rescue NRCMs from apoptosis under OGD / R stress ( Figure 6). Compared with PBS and GEL controls under OGD / R stress conditions, the number of Tunel-positive cells was significantly reduced after treatment with TeEV and GEL-TeEV. In addition, the proportion of Tunel-positive cells was calculated to consider the quantitative results, and the results showed a decrease in apoptosis levels, revealing that TeEV and GEL-TeEV have the ability to alleviate cell apoptosis after NRCMs are damaged by OGDDR, and GEL-TeEV can achieve slow release of TeEV in the hydrogel to achieve the purpose of long-term treatment. Apoptosis-related proteins such as Bax, Bcl2, cleaved Caspase3 and Caspase3 were analyzed by Western blotting (WB) and showed reduced expression levels. This result indicates that the in situ injected GEL-TeEV hydrogel can quickly release TeEV in the early stage and be targeted and internalized into damaged NRCMs to achieve high uptake capacity and anti-apoptotic ability in NRCMs under OGD / R stress. In addition, TeEV in GEL-TeEV can be slowly released within 3 weeks, thereby treating NRCMs under long-term OGD / R stress.

[0075] These results indicate that TeEV-loaded injectable hydrogels can repair cardiomyocyte oxidative stress damage (OGDR). Moreover, TeEV in the hydrogel can achieve long-term therapeutic effects for up to 3 weeks.

[0076] In vivo cardiac ischemia-reperfusion repair assay

[0077] Targeted engineered extracellular vesicles were encapsulated in GelMA hydrogels and injected to achieve the purpose of sustained release of TeEV and repair of chronic cardiac ischemia-reperfusion. An ischemia-reperfusion injury (IRI) model was established by 30 minutes of cardiac ischemia followed by reperfusion of blood. GEL-TeEV hydrogel was injected to repair the heart that had been subjected to long-term reperfusion for 3 weeks (IRI+GEL-TeEV). In addition, the ischemia-reperfusion injury group was injected with PBS as a control group (IRI+PBS), and two other control groups were set up, IRI+GEL and IRI+TeEV. The ischemia-reperfusion injury group was injected with GEL as the IRI+GEL control group, and the ischemia-reperfusion injury group was injected with TeEV as the IRI+TeEV control group. Cardiac ultrasound showed that compared with the left ventricular ejection fraction (EF, 36.51±3.07%) and shortening fraction (FS, 21.81±2.20%) of the IRI+PBS control group, the EF (67.46±4.15%) and FS (45.36±3.89%) of GEL-TeEVs were significantly improved, thereby improving cardiac IRI remodeling. Masson staining was used to evaluate the level of cardiac fibrosis after GEL-TeEV treatment ( Figure 7). Moreover, the experiment was conducted on the group that did not undergo cardiac ischemia-reperfusion injury and was regarded as a sham operation (Sham) group. Compared with the sham operation group (1.05±0.68%), the fibrosis area in the IRI model (19.28±2.63%) was significantly increased, the cardiac fibrosis levels in the GEL group (17.03±3.32%) and the TeEV group (10.56±1.23%) were reduced, and the fibrosis level in the GEL-TeEV injection transplantation (6.63±1.24%) was significantly reduced. In the IRI 3W+PBS model, the pathological cardiac genes of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP) and β-MHC were significantly increased, while the GEL group and TeEV group could improve the expression of pathological-related genes, but the ability to repair the heart was limited, and the pathology-mediated gene expression was significantly inhibited by GEL-TeEV therapy to improve cardiac IRI remodeling, thereby achieving repair of the pathological heart ( Figure 8 ). Therefore, GEL-TeEV patches implanted via in situ minimally invasive injection can inhibit the progression of cardiac fibrosis and protect pathological cardiac IRI remodeling, thereby improving cardiac function.

[0078] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creative work, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A targeted engineered extracellular vesicle-loaded injectable hydrogel, characterized in that: The injectable hydrogel loaded with targeted engineered extracellular vesicles is a GelMA hydrogel loaded with ischemia-targeted miR222 engineered extracellular vesicles; the ischemia-targeted miR222 engineered extracellular vesicles overexpress miR222, the nucleotide sequence of which is shown in SEQ ID NO. 2, and is surface-modified with a targeting polypeptide; the amino acid sequence of which is shown in SEQ ID NO. 1; The method for preparing the targeted engineered extracellular vesicle-loaded injectable hydrogel comprises the following steps: GelMA precursor was prepared using type A gelatin and methacrylic anhydride as raw materials; Human umbilical cord mesenchymal stem cells (HUC-MSCs) are used as raw materials to extract and obtain HUC-MSC-derived extracellular vesicles (EVs); the miR222 gene is transferred into the HUC-MSC-derived EVs to obtain miR222-engineered EVs; a targeting peptide is mixed with a DOPE-NHS solution to obtain a peptide linker, which is then concentrated and mixed with the miR222-engineered EVs to obtain targeted engineered EVs; The GelMA precursor, photoinitiator and targeted engineered extracellular vesicles are mixed and loaded to obtain an injectable hydrogel loaded with targeted engineered extracellular vesicles.

2. The injectable hydrogel according to claim 1, characterized in that The average Young's modulus of the targeted engineered extracellular vesicle-loaded injectable hydrogel is 5-30 kPa.

3. The method for preparing the targeted engineered extracellular vesicle-loaded injectable hydrogel according to claim 1 or 2, comprising the following steps: GelMA precursor was prepared using type A gelatin and methacrylic anhydride as raw materials; Human umbilical cord mesenchymal stem cells (HUC-MSCs) are used as raw materials to extract and obtain HUC-MSC-derived extracellular vesicles (EVs); the miR222 gene is transferred into the HUC-MSC-derived EVs to obtain miR222-engineered EVs; a targeting peptide is mixed with a DOPE-NHS solution to obtain a peptide linker, which is then concentrated and mixed with the miR222-engineered EVs to obtain targeted engineered EVs; The GelMA precursor, photoinitiator and targeted engineered extracellular vesicles are mixed and loaded to obtain an injectable hydrogel loaded with targeted engineered extracellular vesicles.

4. The preparation method according to claim 3, characterized in that The preparation of GelMA precursor includes the following steps: Type A gelatin was dissolved in PBS to obtain a gelatin solution, and methacrylic anhydride was added dropwise to the gelatin solution to react and obtain a GelMA precursor.

5. The preparation method according to claim 3 or 4, characterized in that The mass ratio of type A gelatin to the volume of methacrylic anhydride is 5g:(0.2~5)mL.

6. The preparation method according to claim 3, characterized in that During the loading process, PBS was used as a solvent to prepare the reaction solution, the weight ratio of GelMA precursor to photoinitiator was (2-8):100, and each 20 μL reaction solution contained 1×10 targeted engineered extracellular vesicles. 8 ~5×10 9 indivual.

7. Use of the targeted engineered extracellular vesicle-loaded injectable hydrogel according to claim 1 or 2 or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method according to any one of claims 3 to 6 in the preparation of a medicament for repairing cardiac ischemia-reperfusion injury.

8. Use of the targeted engineered extracellular vesicle-loaded injectable hydrogel according to claim 1 or 2 or the targeted engineered extracellular vesicle-loaded injectable hydrogel prepared by the preparation method according to any one of claims 3 to 6 in the preparation of a drug for inhibiting cardiac fibrosis.

Images