An ORF, plasmid, and mRNA for targeted degradation of intracellular proteins, and methods of use and applications thereof

Abstract

The present invention discloses an ORF, plasmid and mRNA for targeted degradation of intracellular proteins and their use methods and applications, belonging to the field of target protein degradation technology. The method provided by the present invention can effectively and continuously degrade the target protein, with high efficiency and scalability; the specific recognition function of the target protein is realized through the antigen-antibody specific hybridization reaction, avoiding the unavoidable off-target effects of CRISPR technology, PROTACs technology, RNAi technology, etc., and it has universality and can be applied to any endogenous protein, and can distinguish different variants of a protein; the introduction of the targeting module is simple and easy to operate, and the target protein does not need to be modified in advance; mRNA drugs can be safely and efficiently delivered to cells and protected from degradation, without entering the nucleus, and can avoid the safety risks of genome integration and cell transformation; production is safe and reliable, and is produced by enzymatic in vitro transcription (IVT) reaction, without relying on the process of cell amplification, avoiding the complex production problems related to cell culture.

Description

Technical Field

[0001] The present invention relates to the technical field of target protein degradation, and in particular to an ORF, a plasmid and an mRNA for targeted degradation of intracellular proteins, and a use method and application thereof. Background Art

[0002] As the main carrier of life activities, the expression and degradation of proteins are the basis for maintaining cell functions and supporting the physiological functions of the body. They are precisely regulated by the cell's own regulatory network. Abnormal expression and misfolding of proteins in the body often lead to abnormal accumulation of the protein in the cell, which in turn leads to the occurrence and development of related diseases. For example, the pathogenesis of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease, which have received increasing attention in recent years, as well as some malignant tumors, are closely related to the abnormal accumulation of proteins. Therefore, enhancing and interfering with protein expression and function is not only the main strategy for studying gene function in basic research, but also an effective means to prevent and treat related diseases caused by protein dysfunction.

[0003] Currently, protein editing technologies mainly include the following types:

[0004] (1) Protein interference technology acting at the DNA and RNA levels

[0005] In recent years, with the emergence of gene-editing technologies like CRISPR / Cas9, protein interference methods acting directly on DNA have gained widespread application due to their ease of use and wide applicability. Methods acting at the RNA level, such as RNAi, are also widely used to knock down or even completely eliminate protein expression by affecting the stability of target protein mRNA or interfering with its translation process, thereby reducing target protein expression.

[0006] However, whether targeting the DNA or RNA level, protein depletion in cells is indirect, making the protein knockdown effect strongly dependent on the intrinsic turnover rate of proteins within the cell. This means that cells may have enough time to activate compensatory mechanisms to mask the phenotype, making it unclear whether the phenotype is a direct consequence of gene knockout. Faced with proteins of equal lifespan, such indirect protein interference methods targeting DNA and RNA completely lose their effectiveness.

[0007] (2) Technology for conditional protein inactivation at the protein level

[0008] ① Small molecule inhibitors

[0009] Small molecule inhibitors are mainly based on an occupancy-driven drug action mode, which inhibits the activity and function of target enzymes or receptors by occupying or blocking their active sites, thereby exerting therapeutic effects. However, small molecule inhibitors have inherent limitations in practical applications:

[0010] 1) Large dosage: In the actual medication process, since small molecule drugs inhibit the activity of target proteins through a space-occupying-driven mode, in order to achieve a better therapeutic effect (IC90), the protein target needs to be continuously exposed to a high concentration of drug environment for a long time, which makes the dosage of small molecule drugs large.

[0011] 2) Poor selectivity and off-target effects: Small molecule drugs are not only difficult to achieve high specificity, but also have numerous potential binding targets. Furthermore, small molecule drugs need to maintain a high-concentration drug environment throughout the body, which is likely to produce "off-target effects" and make side effects uncontrollable.

[0012] 3) The non-universality of drug development: Mechanism-based drug discovery is the mainstream approach to small molecule drug development. Designing drugs for new targets requires a comprehensive understanding of the active sites in the target protein structure, followed by de novo design and large-scale screening of highly effective drugs. This makes it difficult to develop a unified, universal approach. Furthermore, small molecules must bind to the active site of the target to be effective, which directly limits the drug's target space.

[0013] Therefore, the existence of "undruggable" targets greatly limits the potential of current small molecule drug targeted therapy.

[0014] ②Protein degradation targeting chimera (PROTAC) molecular technology

[0015] PROTAC is a bifunctional molecule that can simultaneously bind to E3 ubiquitin ligase and target protein (POI). By "hijacking" the ubiquitin-proteasome system (UPS), lysines exposed to the target protein are ubiquitinated by the E3 ubiquitinase complex, and then the proteasome degrades the POI. Unlike traditional methods, PROTAC aims to eliminate target proteins at the post-translational level rather than inhibiting their synthesis. This targeted protein degradation technology has great potential to target "undruggable" proteins, which account for approximately 85% of all human proteins. Small molecule PROTAC has achieved great success in the study of degrading a series of proteins, and more and more PROTAC applications are gradually entering the clinic.

[0016] However, due to the high cost of PROTAC chemical synthesis and its high molecular weight, its absorption and drugability are poor. In addition, if PROTAC cannot bind to the target protein after entering the body, its off-target toxicity is also worthy of attention. Therefore, PROTAC technology still has room for optimization and improvement.

[0017] ③Molecular glue technology

[0018] The chemical structure of molecular glue is much simpler than that of PROTAC, and the degradation principle is similar to that of PROTAC, except that molecular glue plays an inductive role. It can induce the enzymes in the multi-stage enzyme chain of the ubiquitin-proteasome pathway to connect with the target protein, forming a protein-small molecule-protein ternary complex, so that the target protein is ubiquitinated and ultimately degraded.

[0019] Molecular glues usually have a smaller molecular weight, less spatial interference, and better drugability, but their design is very difficult, and most of the molecular glues reported so far were discovered accidentally during research.

[0020] ④ Biomacromolecule targeted degradation system - TrimAway technology

[0021] A new protein degradation strategy, TrimAway, was reported in the journal Cell. Its principle is to introduce antibodies to the target protein into the cell by microinjection or electroporation (the variable region and constant region of the antibody serve as the targeting module and E3 enzyme recruitment module of the system, respectively) to achieve highly specific recognition of the antigen (target protein), and further use the E3 ligase TRIM21 to recognize the Fc region of the antibody and mediate the antibody-dependent intracellular neutralization effect (antibody-dependent intracellular neutralization, ADIN), so that the antigen-antibody complex is ubiquitinated and then degraded through the ubiquitin-proteasome pathway, thereby ultimately achieving specific recognition and degradation of the target protein. This technology achieves specific recognition of the target protein through antigen-antibody specific hybridization reactions, avoiding the unavoidable off-target effects of CRISPR technology, PROTACs technology, RNAi technology, etc. At the same time, because the TrimAway technology also has the characteristics of high efficiency and scalability, it can achieve complete elimination of the target protein within a dozen minutes.

[0022] However, the TrimAway method requires microinjection, electroporation, and other techniques for antibody delivery, which not only requires advanced instrumentation but also inevitably affects the physiological state of cells, limiting its widespread application in basic research. Furthermore, limitations such as the antibody delivery method and the fact that some cells lack sufficient endogenous TRIM21 to support the degradation process also preclude clinical application of this technique. Summary of the Invention

[0023] The purpose of the present invention is to provide an ORF, plasmid and mRNA for targeted degradation of intracellular proteins, as well as methods and applications of their use, to address the problems of the limited applicability of existing protein interference technologies at the DNA and RNA levels; the large dosage of small molecule drugs, their lack of universality and easy off-target effects; the high cost of PROTAC chemical synthesis, poor absorption, poor drugability and off-target toxicity; and the still-complicated introduction of targeting modules and unfriendly modes of action in protein targeted degradation technologies based on the ubiquitination pathway.

[0024] To achieve the above objectives, the present invention provides an open reading frame, which consists of a targeting module, a connecting module and a degradation module, wherein the targeting module and the degradation module are connected through the connecting module; the targeting module is selected according to the target protein and is any polypeptide or protein that specifically binds to the target protein; the connecting module is a GSSS flexible peptide.

[0025] Preferably, the targeting module is one of a single-chain antibody and a single-domain antibody.

[0026] Preferably, the degradation module is one of the full length TRIM21 protein, RING-B-Box-Coil, RIGN-Coil-PRYSPRY, and RIGN.

[0027] An mRNA comprising the above open reading frame, wherein the mRNA 5'-3' structure is: 5'cap-5'UTR-open reading frame-3'UTR-PolyA, the sequence of 3'UTR is shown as SEQ ID NO.2, and the sequence of 5'UTR is shown as SEQ ID NO.3.

[0028] A method for targeted degradation of intracellular proteins using the above mRNA, comprising the following steps:

[0029] S1. The synthesized mRNA is co-incubated with lipid nanoparticles in an acidic buffer to form drug-loaded nanoparticles encapsulating mRNA, which enter the cell through endocytosis.

[0030] S2. After the drug-loaded nanoparticles encapsulating mRNA enter the cell, they escape through the endosomes, complete translation and folding in the cytoplasm, and self-assemble into a degradation system. The targeting module in the degradation system specifically recognizes and binds to the target protein, triggering the E3 ligase function of TRIM21, achieving ubiquitination tagging of the target protein-degradation system complex, and then achieving degradation of the target protein through the ubiquitin-proteasome pathway.

[0031] Preferably, in step S1, the mRNA is dissolved in a sodium citrate buffer at a pH of 4-6 to form an mRNA solution at a concentration of 170 ng / μL; the lipid nanoparticles are LNP1273, wherein the HUO (SM-102) content is 50%, the DSPC content is 10%, the Chol content is 38.4%, and the dmg-PEG2000 content is 1.5%. The LNP1273 is dissolved in ethanol to obtain a lipid nanoparticle suspension, the volume ratio of the mRNA solution to the lipid nanoparticle suspension is 3:1, and the acidic buffer is a sodium citrate buffer at a pH of 4-6.

[0032] An application of the above-mentioned method of mRNA targeted degradation of intracellular proteins in protein degradation for non-medical purposes.

[0033] A plasmid comprising the above open reading frame.

[0034] A use of the mRNA or plasmid as described above in protein degradation for non-medical purposes.

[0035] The TRIM21 protein comprises four domains: RING, B-box, Coil, and PRYSPRY. Under normal physiological conditions, the RING is responsible for ubiquitination activity, the B-box maintains the stability of the protein's three-dimensional structure, the Coil promotes homodimerization of TRIM21 molecules, and PRYSPRY forms a three-dimensional folded structure. Through optimization experiments, the present invention discovered that the TRIM21 protein, consisting solely of the RING, B-box, and Coil domains, can achieve its intended function.

[0036] Lipid nanoparticles (LNPs) are currently the most advanced mRNA delivery vectors in clinical practice. LNPs typically consist of four components: ionizable lipids, cholesterol, auxiliary phospholipids, and PEGylated lipids. These components form nanoparticles with mRNA in an acidic buffer, encapsulating and protecting the fragile mRNA, allowing it to enter cells via endocytosis.

[0037] Therefore, the present invention provides an ORF, plasmid, and mRNA for targeted degradation of intracellular proteins, as well as methods and applications thereof, and its specific technical effects are as follows:

[0038] (1) The method provided by the present invention can effectively and continuously degrade the target protein, realizes the specific recognition function of the target protein through the antigen-antibody specific hybridization reaction, avoids the unavoidable off-target effects of CRISPR technology, PROTACs technology, RNAi technology, etc., and has universal applicability;

[0039] (2) The method provided by the present invention is simple and easy to introduce the targeting module, and does not require pre-modification of the target protein;

[0040] (3) The method provided by the present invention has the advantages of high efficiency and scalability, and can achieve complete clearance of target protein within ten minutes;

[0041] (4) The method provided by the present invention utilizes the body's own translation mechanism to produce proteins, which is highly safe. As a nucleic acid drug, mRNA drugs can be safely and efficiently delivered to specific target cells and protected from degradation. They do not need to enter the cell nucleus, which can effectively avoid the safety risks of genomic integration and cell transformation.

[0042] (5) The production of mRNA drugs is safe and reliable. They are produced through enzymatic in vitro transcription (IVT) reactions and do not rely on cell amplification processes, thus avoiding the complex production problems associated with cell culture.

[0043] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0045] Figure 1 Schematic diagram of the composition and expression strategy of the mRNA degradation system provided by the present invention;

[0046] Figure 2 This is a schematic diagram of the degradation principle of the mRNA and plasmid degradation system provided by the present invention;

[0047] Figure 3 Schematic diagram of the structure of the ORF portion of the five degradation systems constructed in Example 4 of the present invention;

[0048] Figure 4 It is T21-DP in the embodiment of the present invention K (plasmid), DP K -F T21(mRNA), T21-DP K (mRNA) Western blot results of H358 cells transfected for 48 h, Con represents untransfected empty cells;

[0049] Figure 5 It is T21-DP in the third embodiment of the present invention. K (mRNA) Western blot results at 0, 12, 24, 36, 48, 60, and 72 h after transfection;

[0050] Figure 6These are the western blot results of H358 cells transfected with the five mRNA degradation systems in Example 4 of the present invention for 48 hours;

[0051] Figure 7 Schematic diagram of the structure of the ORF portion of the recombinant plasmid in Example 5 of the present invention;

[0052] Figure 8 These are the results of laser confocal microscopy observations of 293T cells transfected with eGFP 24h and 48h in the plasmid degradation system of Example 5 of the present invention;

[0053] Figure 9 The results of flow cytometric analysis of eGFP fluorescence intensity in 293T cells transfected with the plasmid degradation system in Example 5 of the present invention at 24h and 48h;

[0054] Figure 10 These are the results of laser confocal microscopy observations of 293T cells transfected with eGFP 24h and 48h after treatment with and without MG132 treatment in Example 5 of the present invention;

[0055] Figure 11 The fluorescence intensity of eGFP was detected by a microplate reader 24 hours and 48 hours after 293T cells were transfected with the plasmid degradation system treated with MG132 and without MG132 in Example 5 of the present invention. DETAILED DESCRIPTION

[0056] The present invention provides an open reading frame (ORF), which is composed of a targeting module, a connecting module and a degradation module. The targeting module and the degradation module are connected by the connecting module. The structure is as follows Figure 1 As shown in the figure. The targeting module is selected based on the target protein and is any peptide or protein that specifically binds to the target protein, such as a single-chain antibody or single-domain antibody. The linker module is a GSSS flexible peptide. The degradation module is a portion of the TRIM21 protein, including the RING, B-box, and Coil domains of the TRIM21 protein.

[0057] The present invention provides an mRNA and plasmid comprising the above ORF, wherein the targeting module, the connection module and the degradation module are expressed as a fusion protein. The expression strategy is as follows: Figure 1 As shown. The target protein can be degraded by using mRNA and plasmid containing the above ORF. The degradation principle is as follows Figure 2 shown.

[0058] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0059] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0060] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.

[0061] Example 1

[0062] The mRNA containing the above open reading frame (ORF) is used to degrade KRAS protein, and the specific steps are as follows:

[0063] S1.1、DP K (Designed ankyrin repeat proteins), that is, the nucleic acid sequence of the designed ankyrin repeat fold protein is used as the targeting module, and the full length of TRIM21 protein is used as the degradation module, DP K The amino acid sequence is shown in SEQ ID NO. 1. The nucleotide sequence of the targeting module, the sequence of the GSSS flexible peptide, the full-length sequence of the TRIM21 protein (including the four domains of RING, B-box, Coil and PRYSPRY), 3′UTR, 5′UTR, and PolyA were sent to the company for Figure 1 The sequence shown was sequentially ligated into the PUC57 plasmid to prepare a recombinant plasmid, which has a unique BSPQI restriction site. The sequence of the 3'UTR is shown in SEQ ID NO. 2, and the sequence of the 5'UTR is shown in SEQ ID NO. 3.

[0064] SEQ ID NO.1:

[0065] MDLGKKLLEAARAGQDDEVRILMANGADVNASDRWGWTPLHLAAWWGHLEIVEVLLKRGADVSAADLHGQSPLHLAAMVGHLEIVEVLLKYGADVNAKDTMGATPLHLAARSGHLEIVEELLKNGADMNAQDKFGKTTFDISTDNGNEDLAEILQKL

[0066] SEQ ID NO.2:

[0067] CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACG CAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0068] SEQ ID NO.3: TAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC S1.2. The obtained recombinant plasmid was transformed into Escherichia coli DH5α and cultured overnight at 37°C and 200 rpm for 12-16 hours. The plasmid was extracted using a kit to obtain the PUC57 recombinant plasmid. The obtained PUC57 recombinant plasmid was digested with BSPQI enzyme according to the enzyme instructions to obtain a linearized plasmid.

[0069] S1.3. The obtained linear plasmid was transcribed in vitro using the transcription system shown in Table 1. After incubation at 37°C for 2 h, 2 μL of DNase I was added, mixed evenly, and incubated at 37°C for 30 min. The mRNA with the 5′ cap added was purified using an AG column purification kit and named T21-DP. K (mRNA), dilute the mRNA to 170 ng / μL with pH 5 citrate buffer to obtain an mRNA solution.

[0070] Table 1

[0071] Nuclease-free Water Make up to 20 μL 100mM ATP Solution 1.6μL 100mMGTPSolution 1.6μL 100mM CTP solution 1.6μL <![CDATA[100mMN 1 -Me-PseudoUTPsolution]]> 1.6μL 100mMCapAnalog 1.6μL Linear plasmid 1ug 5×ReactionBuffer 4 μL EnzymeMix 1.5 μL

[0072] S1.4. Pipette 29.4 μL of the mRNA solution obtained in step S1.3, add 9.8 μL of LNP1273 lipid nanoparticles, and incubate at room temperature for 10 minutes to obtain drug-loaded nanoparticles encapsulating mRNA.

[0073] LNP1273 lipid nanoparticles are composed of 50% HUO (SM-102), 10% DSPC, 38.4% Chol, and 1.5% dmg-PEG2000, which are dissolved in 75% ethanol to obtain a lipid nanoparticle suspension (LNP).

[0074] S1.5. T21-DP packaged via LNP K (mRNA) was transfected into H358 cells (schematic diagram of the structure is shown in Figure 3 As shown in 2), cells were collected at 48h. Add 200μL cell lysis buffer (RIPA strong lysis buffer: PMSF volume ratio of 100:1 mixture), lyse on ice for 30min, centrifuge at 4℃, 14000xg for 10min, take 182μL supernatant, take 2μL for BCA protein concentration determination, add 5× buffer 45μL to the remaining 180μL, boil for 5min, cool, and calculate the protein concentration of each tube according to the standard curve. The sample amount was 20ng for loading (the volume was filled with 1× buffer) for western blot detection, and the results are as follows Figure 4 shown.

[0075] Example 2

[0076] The recombinant plasmid containing the above ORF is used to degrade KRAS protein. The specific steps are as follows:

[0077] S2.1、DP K The nucleic acid sequence of TRIM21 was used as the targeting module, and the full length of TRIM21 protein was used as the degradation module. K The amino acid sequence of the target module, the GSSS flexible peptide sequence, and the full-length sequence of the TRIM21 protein were sent to the company for Figure 1 The sequence shown was connected to the pcDNA (3.1) plasmid to prepare the recombinant plasmid T21-DP K .

[0078] S2.2, after the obtained recombinant plasmid was transformed into E. coli DH5α, it was cultured overnight at 37°C and 200 rpm (12-16 hours). The plasmid was extracted using a kit to obtain the pcDNA (3.1) recombinant plasmid. The obtained pcDNA (3.1) recombinant plasmid was transfected into 2.5 μg T21-DP using lipo3000. K (plasmid) to H358 cells, and collect cells at 48h. Add 200μL cell lysis buffer (RIPA strong lysis buffer: PMSF volume ratio of 100:1 mixture), lyse on ice for 30min, centrifuge at 4℃, 14000xg for 10min, take 182μL supernatant, take 2μL for BCA protein concentration determination, add 5× buffer 45μL to the remaining 180μL, boil for 5min, cool, and calculate the protein concentration of each tube according to the standard curve. The sample volume is 20ng for loading (the volume is filled with 1× buffer) for western blot detection, and the results are as follows Figure 4 shown.

[0079] Comparative Example 1

[0080] The TrimAway technology was used to prepare mRNA containing the targeting module and degradation module of Example 1 to degrade KRAS protein. The specific steps were exactly the same as those of Example 1, except that the PUC57 recombinant plasmid in step S1.1 was as follows:

[0081] The nucleic acid sequence of was used as the targeting module, and the full length of TRIM21 protein was used as the degradation module. K The amino acid sequence of the targeting module, the full-length sequence of TRIM21 protein, the FC region sequence and the P2A sequence were sent to the company for Figure 3 The sequence shown in 1) was sequentially connected to the PUC57 plasmid to prepare a recombinant plasmid, and the steps were exactly the same as in Example 1 to prepare mRNA, named DP K -F T21 (mRNA).

[0082] The results are as follows Figure 4 As shown by Figure 4 It can be seen that the mRNA degradation system constructed in Example 1 and the plasmid degradation system constructed in Example 2 were successfully expressed in H358 cells. After the plasmid and mRNA forms were introduced into the cells, they both had the effect of degrading KRAS protein. Compared with the TrimAway technology (Comparative Example 1), the fusion protein form can achieve the same effect of degrading KRAS protein.

[0083] Example 3

[0084] The optimal degradation time of KRAS protein by the mRNA degradation system prepared in Example 1 was investigated, and the specific steps were as follows:

[0085] The ORF structure obtained by the method of Example 1 is T21-DP K (See Figure 3 2)) mRNA, and the method of Example 1 was used for packaging, and 5 μg T21-DP was transfected into H358 cells by LNP at the same time. K mRNA, cells were collected at 0, 12, 24, 36, 48, 60, and 72 h after transfection, and protein expression was detected by western blot after lysis. The results are shown in Figure 5 As shown, the degradation system can be sustainably expressed in the cells, and obvious degradation effect appears 24 hours after the degradation system is transferred into the cells, and can be maintained up to 72 hours.

[0086] Example 4

[0087] Too long mRNA will affect its stability. Therefore, the linker sequence of TRIM21 protein is optimized to improve the stability of mRNA. The specific steps are as follows:

[0088] The method of embodiment 1 is used to construct the following Figure 3 The degradation systems of the five degradation modules shown in 1)-5) were respectively encapsulated by LNP and transfected into H358 cells. After 48 hours, the cells were collected and the protein expression levels were detected by western blot after lysis. The results are shown in FIG. Figure 6 As shown, through screening, degradation systems 1), 2), and 3) showed obvious degradation effects after being transferred into cells, and could degrade 60-70% of KRAS protein. The degradation effects of degradation systems 4) and 5) were poor, reaching 30-40%, indicating that the deletion of B-BOX and Coil sequences had an adverse effect on the function of the degradation system.

[0089] Example 5

[0090] The eGFP protein was degraded using a plasmid containing the above open reading frame (ORF), and the specific steps were as follows:

[0091] S5.1、DP e (eGFP designed ankyrin repeat fold protein) as the targeting module. The nucleotide sequence of the targeting module, the full-length sequence of TRIM21 protein, the FC region sequence and the P2A sequence were sent to the company for Figure 7 The sequence shown was sequentially connected to the pcDNA3.1 plasmid to prepare a recombinant plasmid, named 1)DP e -F T21, 2) T21-DP e .

[0092] S5.2. Transform the received recombinant plasmid into Escherichia coli DH5α and culture overnight at 37°C and 200 rpm (12-16 h). Extract the plasmid using a kit and co-transfect 2.5 μg eGFP and 2.5 eGFP Predator 1) and 2) plasmid expression vectors into 293T cells using Lipo3000.

[0093] The expression of eGFP was observed using a laser confocal microscope. Figure 8 As shown, the fluorescence intensity of eGFP decreased 24h and 48h after transfection, that is, both eGFPPredator 1) and 2) had a degradation effect on eGFP, and the degradation could be continuous.

[0094] S5.3. Analyze the fluorescence intensity of eGFP in cells using flow cytometry. The results are as follows: Figure 9As shown in the figure, the peak value of eGFP shifted to the left after 24 hours of transfection, that is, the fluorescence intensity of eGFP decreased. Therefore, eGFP Predator has a degradation effect on eGFP, and DP e -F T21 has better degradation effect.

[0095] S5.4. Investigate whether eGFP degradation occurs through the ubiquitin-proteasome pathway

[0096] In the presence or absence of MG132 (proteasome inhibitor, final concentration of 5 μM), 2.5 μg of eGFP and 2.5 μg of eGFP Predator 1) and 2) plasmid expression vectors were co-transfected into 293T cells by lipo3000. The eGFP degradation effect was observed using an inverted fluorescence microscope. Figure 10 As shown, the fluorescence intensity of eGFP was detected by enzyme-labeled instrument. Figure 11 As shown by Figure 10 and 11 It can be seen that the proteasome inhibitor MG132 has no effect on the expression of eGFP; DP e -F T21 and T21-DP e eGFP was degraded and the degradation was continuous. After adding the proteasome inhibitor MG132, DP e -F T21 and T21-DP e The degradation of eGFP is inhibited, so the degradation effect is caused by the ubiquitin proteasome degradation system.

[0097] Therefore, the method provided by the present invention can effectively and continuously degrade the target protein, is highly efficient and scalable, and can achieve complete elimination of the target protein within a dozen minutes; the specific recognition function of the target protein is achieved through the antigen-antibody specific hybridization reaction, avoiding the unavoidable off-target effects of CRISPR technology, PROTACs technology, RNAi technology, etc., and has universal applicability; the introduction of the targeting module is simple and easy to operate, and no pre-modification of the target protein is required; mRNA drugs can be safely and efficiently delivered to specific target cells and protect them from degradation, and do not need to enter the cell nucleus, which can effectively avoid the safety risks of genome integration and cell transformation; production is safe and reliable, and is produced through enzymatic in vitro transcription (IVT) reactions, without relying on the cell expansion process, avoiding the complex production problems associated with cell culture.

[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. An mRNA comprising an open reading frame, characterized in that The structure of mRNA 5′-3′ is: 5′ cap-5′ UTR-open reading frame-3′ UTR-Poly A, the sequence of 3′ UTR is shown in SEQ ID NO.2, and the sequence of 5′ UTR is shown in SEQ ID NO.3; The open reading frame is a degradation module, a connection module, and a targeting module connected in sequence; The connecting module is a GSSS flexible peptide; Targeting module is DP K , DP K The amino acid sequence is shown in SEQ ID NO.1; The degradation module is one of the full length of TRIM21 protein, RING-B-Box-Coil, RING-Coil-PRYSPRY, and RING.

2. A drug for targeted degradation of intracellular proteins, characterized in that: The drug has the mRNA according to claim 1 as an effective component; the drug is a drug-loaded nanoparticle containing mRNA formed by co-incubating the synthesized mRNA with lipid nanoparticles in an acidic buffer; The intracellular protein is KRAS protein; The mRNA was diluted to 170 ng / μL with a pH 5 citrate buffer to obtain an mRNA solution. The lipid nanoparticles were LNP1273, in which the HUO (SM-102) content was 50%, the DSPC content was 10%, the Chol content was 38.4%, and the dmg-PEG2000 content was 1.5%. LNP1273 was dissolved in ethanol to obtain a lipid nanoparticle suspension. The volume ratio of the mRNA solution to the lipid nanoparticle suspension was 3:

1.

3. A plasmid comprising the open reading frame of claim 1.

4. Use of the mRNA according to claim 1 or the plasmid according to claim 3 in protein degradation for non-medical purposes, characterized in that: The protein is KRAS protein.

Images